miRTarBase - #MIRT438603


—
pre-miRNA Information
pre-miRNA hsa-mir-758   
Genomic Coordinates chr14: 101026020 - 101026107
Synonyms MIRN758, hsa-mir-758, MIR758
Description Homo sapiens miR-758 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-758-3p
Sequence 52| UUUGUGACCUGGUCCACUAACC |73
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs992122694 10 dbSNP
rs1165305945 14 dbSNP
rs1432780238 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TLR3   
Synonyms CD283, IIAE2
Description toll like receptor 3
Transcript NM_003265   
Expression
Putative miRNA Targets on TLR3
3'UTR of TLR3
(miRNA target sites are highlighted)		 
>TLR3|NM_003265|3'UTR
   1 ATTTATTTAAATATTCAATTAGCAAAGGAGAAACTTTCTCAATTTAAAAAGTTCTATGGCAAATTTAAGTTTTCCATAAA
  81 GGTGTTATAATTTGTTTATTCATATTTGTAAATGATTATATTCTATCACAATTACATCTCTTCTAGGAAAATGTGTCTCC
 161 TTATTTCAGGCCTATTTTTGACAATTGACTTAATTTTACCCAAAATAAAACATATAAGCACGTAAAAAAAAAAAAAAAAA
 241 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccaaucaccugguccAGUGUUu 5'
                         |||||| 
Target 5' aatgattatattctaTCACAAt 3'
 111 - 132 120.00 -5.50
2 
miRNA  3' ccAAUCACCUGGU-----C-CAGUGUUu 5'
            | |||   |||     | ||:|:|| 
Target 5' ttTAAGTTTTCCATAAAGGTGTTATAAt 3'
 64 - 91 112.00 -5.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31547827 8 COSMIC
COSN30515090 30 COSMIC
COSN31824447 31 COSMIC
COSN32062623 126 COSMIC
COSN20776276 773 COSMIC
COSN29833747 911 COSMIC
COSN28535716 974 COSMIC
COSN16168444 994 COSMIC
COSN7634080 1229 COSMIC
COSN4832525 1262 COSMIC
COSN25201962 1587 COSMIC
COSN25386712 1626 COSMIC
COSN21874348 1627 COSMIC
COSN22980456 1844 COSMIC
COSN40762 2108 COSMIC
COSN6819876 2179 COSMIC
COSN5564609 2421 COSMIC
COSN17596484 2877 COSMIC
COSN9021499 3065 COSMIC
COSN17530368 3141 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1040691293 6 dbSNP
rs1365553609 19 dbSNP
rs868559408 21 dbSNP
rs756143075 23 dbSNP
rs777913593 25 dbSNP
rs113522127 28 dbSNP
rs1164808453 30 dbSNP
rs183429070 37 dbSNP
rs924327402 39 dbSNP
rs771447002 41 dbSNP
rs1158235160 43 dbSNP
rs934904004 48 dbSNP
rs774655611 49 dbSNP
rs1197418291 57 dbSNP
rs746197952 58 dbSNP
rs759473498 60 dbSNP
rs914831023 77 dbSNP
rs1224651305 91 dbSNP
rs185993189 102 dbSNP
rs1305630952 115 dbSNP
rs1452178606 118 dbSNP
rs1272116531 120 dbSNP
rs566577183 124 dbSNP
rs948857150 133 dbSNP
rs1420954807 135 dbSNP
rs1403910445 136 dbSNP
rs530115491 137 dbSNP
rs1300798374 155 dbSNP
rs1364562411 157 dbSNP
rs1387064146 158 dbSNP
rs1304368904 169 dbSNP
rs1427115292 171 dbSNP
rs1303054357 179 dbSNP
rs1353263303 181 dbSNP
rs6811199 199 dbSNP
rs904247050 206 dbSNP
rs1410855060 212 dbSNP
rs763049418 214 dbSNP
rs1238178118 215 dbSNP
rs1044583997 218 dbSNP
rs538660784 221 dbSNP
rs1034151342 222 dbSNP
rs960230719 223 dbSNP
rs1218852539 227 dbSNP
rs1289757495 230 dbSNP
rs1014210903 233 dbSNP
rs1488276149 234 dbSNP
rs1210665515 236 dbSNP
rs1014841821 239 dbSNP
rs76877525 241 dbSNP
rs1232213884 248 dbSNP
rs973383736 252 dbSNP
rs1048180592 253 dbSNP
rs1309072091 261 dbSNP
rs886473985 263 dbSNP
rs1178456042 268 dbSNP
rs920696318 275 dbSNP
rs765125474 282 dbSNP
rs1222539604 298 dbSNP
rs1323715227 300 dbSNP
rs1381450324 301 dbSNP
rs953461178 302 dbSNP
rs986713683 318 dbSNP
rs768569343 319 dbSNP
rs1371866950 320 dbSNP
rs1016826140 351 dbSNP
rs12501587 366 dbSNP
rs1161132088 367 dbSNP
rs1402928867 375 dbSNP
rs1174652523 381 dbSNP
rs944869466 388 dbSNP
rs77751105 390 dbSNP
rs543342360 392 dbSNP
rs1417368302 393 dbSNP
rs1407298508 414 dbSNP
rs1177736494 418 dbSNP
rs945733009 419 dbSNP
rs190909893 420 dbSNP
rs1202791492 422 dbSNP
rs1461534597 427 dbSNP
rs1264591745 428 dbSNP
rs1236298587 432 dbSNP
rs1315840518 438 dbSNP
rs955285310 442 dbSNP
rs148844800 450 dbSNP
rs1224835746 454 dbSNP
rs145310902 455 dbSNP
rs955669354 465 dbSNP
rs1452348154 470 dbSNP
rs1407167069 477 dbSNP
rs1055948685 490 dbSNP
rs559402121 494 dbSNP
rs528235177 496 dbSNP
rs545122357 503 dbSNP
rs28524783 506 dbSNP
rs1420877295 507 dbSNP
rs530502730 508 dbSNP
rs1182806310 512 dbSNP
rs1444982420 512 dbSNP
rs1014873185 516 dbSNP
rs980659893 522 dbSNP
rs1243770271 524 dbSNP
rs1485304256 526 dbSNP
rs1260875908 530 dbSNP
rs1312930273 530 dbSNP
rs1356534115 541 dbSNP
rs1313519215 543 dbSNP
rs897723035 545 dbSNP
rs1384020971 547 dbSNP
rs762159285 548 dbSNP
rs928848145 552 dbSNP
rs1380747909 553 dbSNP
rs182910340 554 dbSNP
rs1421563425 557 dbSNP
rs1363676909 565 dbSNP
rs1162882756 568 dbSNP
rs1245746290 580 dbSNP
rs1027622900 592 dbSNP
rs1047767627 594 dbSNP
rs1427621495 596 dbSNP
rs1261974582 606 dbSNP
rs1187805434 616 dbSNP
rs1489656338 632 dbSNP
rs1267424309 637 dbSNP
rs1290338692 642 dbSNP
rs1222419600 647 dbSNP
rs187868236 668 dbSNP
rs1198396780 671 dbSNP
rs1239299501 676 dbSNP
rs1326122114 682 dbSNP
rs986273387 684 dbSNP
rs1239245823 685 dbSNP
rs138968504 688 dbSNP
rs941980958 717 dbSNP
rs191782118 724 dbSNP
rs1392781860 729 dbSNP
rs182881186 752 dbSNP
rs1165994864 753 dbSNP
rs966268680 773 dbSNP
rs566716752 774 dbSNP
rs988242325 775 dbSNP
rs10025405 780 dbSNP
rs946933784 799 dbSNP
rs1267563657 801 dbSNP
rs1199502195 810 dbSNP
rs978398926 815 dbSNP
rs761100648 821 dbSNP
rs1490672447 828 dbSNP
rs925680276 830 dbSNP
rs1270068692 839 dbSNP
rs1194478314 858 dbSNP
rs1028564700 867 dbSNP
rs1220707537 867 dbSNP
rs1008483258 868 dbSNP
rs765024605 876 dbSNP
rs376841047 878 dbSNP
rs895536762 879 dbSNP
rs1332804322 885 dbSNP
rs1326809451 903 dbSNP
rs1464827712 904 dbSNP
rs1390700611 907 dbSNP
rs949883937 915 dbSNP
rs970703122 916 dbSNP
rs1402200875 924 dbSNP
rs1428146959 924 dbSNP
rs1478706740 925 dbSNP
rs1361514100 927 dbSNP
rs1036169430 932 dbSNP
rs568947307 933 dbSNP
rs1239173803 935 dbSNP
rs1200900445 948 dbSNP
rs1460190763 956 dbSNP
rs1262719976 961 dbSNP
rs763458124 967 dbSNP
rs1224318020 968 dbSNP
rs1238252466 968 dbSNP
rs1277793109 968 dbSNP
rs928793310 968 dbSNP
rs1336276797 970 dbSNP
rs763416303 972 dbSNP
rs149785773 973 dbSNP
rs187644978 974 dbSNP
rs1337016559 976 dbSNP
rs192515872 977 dbSNP
rs1054676591 978 dbSNP
rs1157411079 978 dbSNP
rs543430069 980 dbSNP
rs765087034 982 dbSNP
rs112253252 990 dbSNP
rs942115353 991 dbSNP
rs1211104217 993 dbSNP
rs760283258 993 dbSNP
rs573807377 994 dbSNP
rs1204617593 997 dbSNP
rs1320474237 1003 dbSNP
rs189359526 1013 dbSNP
rs921960152 1021 dbSNP
rs113814587 1031 dbSNP
rs1021047082 1032 dbSNP
rs145919793 1044 dbSNP
rs2310394 1046 dbSNP
rs926851105 1053 dbSNP
rs1317084653 1057 dbSNP
rs958427422 1058 dbSNP
rs1052902850 1061 dbSNP
rs1402646567 1062 dbSNP
rs141856876 1069 dbSNP
rs1477252925 1070 dbSNP
rs1182802270 1072 dbSNP
rs564938137 1074 dbSNP
rs949742799 1075 dbSNP
rs764811370 1078 dbSNP
rs575331782 1084 dbSNP
rs919124857 1090 dbSNP
rs930458007 1094 dbSNP
rs745700007 1095 dbSNP
rs889015865 1096 dbSNP
rs1359658990 1098 dbSNP
rs1290410097 1114 dbSNP
rs1035917057 1116 dbSNP
rs150608752 1117 dbSNP
rs983600463 1120 dbSNP
rs1040740460 1121 dbSNP
rs901944892 1135 dbSNP
rs1359976851 1137 dbSNP
rs922011821 1137 dbSNP
rs931969912 1139 dbSNP
rs1417762630 1140 dbSNP
rs1279118330 1148 dbSNP
rs912459729 1165 dbSNP
rs943983127 1171 dbSNP
rs569133282 1172 dbSNP
rs1197353186 1174 dbSNP
rs185672061 1176 dbSNP
rs1222040017 1182 dbSNP
rs1223625846 1183 dbSNP
rs1435892786 1190 dbSNP
rs1271957143 1192 dbSNP
rs1278425844 1194 dbSNP
rs1218869326 1196 dbSNP
rs1319551754 1198 dbSNP
rs1280877502 1200 dbSNP
rs1011278106 1214 dbSNP
rs1020993313 1216 dbSNP
rs1294660735 1217 dbSNP
rs1313289344 1220 dbSNP
rs1439160951 1226 dbSNP
rs1212865520 1228 dbSNP
rs968212052 1231 dbSNP
rs1258372430 1232 dbSNP
rs530364837 1233 dbSNP
rs538053513 1238 dbSNP
rs1480170698 1239 dbSNP
rs1425905806 1242 dbSNP
rs560344976 1250 dbSNP
rs532553167 1260 dbSNP
rs552269913 1262 dbSNP
rs568983968 1267 dbSNP
rs1193881176 1268 dbSNP
rs959866610 1270 dbSNP
rs373449820 1282 dbSNP
rs189406765 1283 dbSNP
rs533454961 1284 dbSNP
rs143129674 1285 dbSNP
rs918989451 1288 dbSNP
rs1005169624 1289 dbSNP
rs1221436053 1293 dbSNP
rs930489140 1295 dbSNP
rs1049347714 1297 dbSNP
rs1309060377 1301 dbSNP
rs1447950491 1308 dbSNP
rs1402863030 1315 dbSNP
rs963497300 1316 dbSNP
rs910474941 1321 dbSNP
rs1178320948 1322 dbSNP
rs192199805 1323 dbSNP
rs1407136254 1324 dbSNP
rs1362673474 1329 dbSNP
rs1179069414 1333 dbSNP
rs1441344745 1345 dbSNP
rs184570644 1358 dbSNP
rs147473470 1361 dbSNP
rs188364781 1365 dbSNP
rs139669807 1367 dbSNP
rs911911474 1368 dbSNP
rs1213016427 1373 dbSNP
rs1315709540 1377 dbSNP
rs879237057 1380 dbSNP
rs1042480013 1381 dbSNP
rs1241450900 1393 dbSNP
rs943950516 1395 dbSNP
rs757348168 1397 dbSNP
rs1380146690 1400 dbSNP
rs913153674 1402 dbSNP
rs1001059746 1409 dbSNP
rs1034223949 1416 dbSNP
rs575205730 1424 dbSNP
rs1287624568 1425 dbSNP
rs1159201778 1431 dbSNP
rs544283791 1433 dbSNP
rs1338565356 1435 dbSNP
rs1421378008 1437 dbSNP
rs959657003 1444 dbSNP
rs1182746412 1458 dbSNP
rs1424089913 1463 dbSNP
rs1014286251 1464 dbSNP
rs1257806161 1467 dbSNP
rs1184296723 1469 dbSNP
rs1485273159 1481 dbSNP
rs1220396915 1490 dbSNP
rs560771754 1493 dbSNP
rs1217996246 1495 dbSNP
rs1025227205 1517 dbSNP
rs1356459505 1520 dbSNP
rs971072948 1521 dbSNP
rs773827101 1523 dbSNP
rs1333507647 1526 dbSNP
rs1043299723 1529 dbSNP
rs1026079687 1530 dbSNP
rs1315147411 1554 dbSNP
rs1440885819 1556 dbSNP
rs1380693503 1557 dbSNP
rs1339950595 1561 dbSNP
rs951849394 1567 dbSNP
rs1401836554 1568 dbSNP
rs1379587371 1581 dbSNP
rs1440300532 1584 dbSNP
rs1162483460 1587 dbSNP
rs554442960 1591 dbSNP
rs1056789931 1596 dbSNP
rs1477253681 1600 dbSNP
rs895508970 1600 dbSNP
rs574354926 1601 dbSNP
rs984651072 1602 dbSNP
rs1015147994 1604 dbSNP
rs1323166315 1615 dbSNP
rs910412149 1617 dbSNP
rs899431058 1633 dbSNP
rs181236772 1634 dbSNP
rs370209582 1636 dbSNP
rs1489022734 1648 dbSNP
rs1267542643 1651 dbSNP
rs1225518779 1661 dbSNP
rs975996565 1662 dbSNP
rs953477542 1663 dbSNP
rs1220519878 1664 dbSNP
rs1343606723 1667 dbSNP
rs1322845747 1670 dbSNP
rs1392625074 1671 dbSNP
rs987995495 1672 dbSNP
rs1400548891 1673 dbSNP
rs751750656 1681 dbSNP
rs1018944995 1682 dbSNP
rs1376807910 1687 dbSNP
rs1479190054 1692 dbSNP
rs1376528615 1708 dbSNP
rs1198789583 1713 dbSNP
rs1241513947 1719 dbSNP
rs34579053 1736 dbSNP
rs1434189650 1757 dbSNP
rs1269996146 1761 dbSNP
rs560382026 1763 dbSNP
rs545712228 1770 dbSNP
rs1042345338 1771 dbSNP
rs1200714814 1782 dbSNP
rs913127268 1791 dbSNP
rs1274265082 1794 dbSNP
rs1233966124 1800 dbSNP
rs947329627 1804 dbSNP
rs532185513 1806 dbSNP
rs1290111855 1811 dbSNP
rs1445737594 1822 dbSNP
rs1453018524 1826 dbSNP
rs1400712014 1842 dbSNP
rs1202162065 1844 dbSNP
rs13137589 1848 dbSNP
rs1458103754 1879 dbSNP
rs1400874466 1883 dbSNP
rs1467050363 1884 dbSNP
rs1379856481 1897 dbSNP
rs563280278 1897 dbSNP
rs1439503744 1901 dbSNP
rs937102479 1903 dbSNP
rs562651912 1914 dbSNP
rs936716703 1917 dbSNP
rs766804873 1919 dbSNP
rs781293285 1922 dbSNP
rs895574213 1933 dbSNP
rs1240050924 1941 dbSNP
rs1055206458 1951 dbSNP
rs1201087145 1957 dbSNP
rs895341266 1961 dbSNP
rs940307198 1968 dbSNP
rs78600754 1981 dbSNP
rs1025257769 1982 dbSNP
rs1377385724 1983 dbSNP
rs899399936 1986 dbSNP
rs1168897344 1988 dbSNP
rs1450090749 1989 dbSNP
rs1339492721 1991 dbSNP
rs866659750 1994 dbSNP
rs993167986 1995 dbSNP
rs770050237 2013 dbSNP
rs1400046774 2017 dbSNP
rs951739118 2020 dbSNP
rs984987842 2021 dbSNP
rs1381393932 2025 dbSNP
rs1160811183 2030 dbSNP
rs1339270059 2034 dbSNP
rs145234935 2046 dbSNP
rs568396555 2047 dbSNP
rs527649091 2051 dbSNP
rs145136747 2052 dbSNP
rs975859523 2065 dbSNP
rs1287962705 2068 dbSNP
rs566724029 2071 dbSNP
rs968597815 2073 dbSNP
rs923209911 2079 dbSNP
rs945255255 2086 dbSNP
rs979124079 2089 dbSNP
rs538843893 2090 dbSNP
rs185834937 2101 dbSNP
rs568113633 2102 dbSNP
rs1399993088 2103 dbSNP
rs925308743 2105 dbSNP
rs367678877 2110 dbSNP
rs1361708889 2118 dbSNP
rs1300476337 2136 dbSNP
rs958747841 2138 dbSNP
rs1413468016 2140 dbSNP
rs1164066502 2141 dbSNP
rs936682011 2143 dbSNP
rs1055641178 2148 dbSNP
rs189044080 2151 dbSNP
rs1257121912 2155 dbSNP
rs537574826 2168 dbSNP
rs763798666 2173 dbSNP
rs1318360655 2175 dbSNP
rs554634495 2180 dbSNP
rs1261141919 2192 dbSNP
rs940448308 2197 dbSNP
rs1046575809 2198 dbSNP
rs756756963 2210 dbSNP
rs897422347 2212 dbSNP
rs774591365 2216 dbSNP
rs930908567 2219 dbSNP
rs1341793707 2225 dbSNP
rs994457799 2225 dbSNP
rs1280679686 2229 dbSNP
rs1434870802 2230 dbSNP
rs1027240174 2231 dbSNP
rs545351401 2231 dbSNP
rs574367406 2235 dbSNP
rs539814763 2240 dbSNP
rs887465719 2242 dbSNP
rs73025946 2251 dbSNP
rs1170107714 2253 dbSNP
rs1478206819 2253 dbSNP
rs1017785117 2262 dbSNP
rs182317445 2263 dbSNP
rs1189412011 2265 dbSNP
rs1477618036 2269 dbSNP
rs1247129059 2271 dbSNP
rs1173340685 2273 dbSNP
rs1223471033 2276 dbSNP
rs1456200759 2278 dbSNP
rs558836203 2283 dbSNP
rs546079922 2284 dbSNP
rs1414465828 2289 dbSNP
rs1198836510 2292 dbSNP
rs1319409631 2294 dbSNP
rs1298476418 2309 dbSNP
rs1334168181 2314 dbSNP
rs1367496343 2323 dbSNP
rs1030087009 2324 dbSNP
rs1341754532 2326 dbSNP
rs1275858579 2329 dbSNP
rs1281301156 2333 dbSNP
rs1375089873 2334 dbSNP
rs575503320 2337 dbSNP
rs978017848 2344 dbSNP
rs1466286203 2357 dbSNP
rs1402551413 2362 dbSNP
rs925203598 2364 dbSNP
rs1174037068 2395 dbSNP
rs779756874 2396 dbSNP
rs1425749383 2398 dbSNP
rs1340787645 2407 dbSNP
rs1220214435 2408 dbSNP
rs1040543295 2412 dbSNP
rs1237283748 2414 dbSNP
rs1344135253 2415 dbSNP
rs990805703 2418 dbSNP
rs1253795163 2429 dbSNP
rs916667800 2435 dbSNP
rs370644081 2438 dbSNP
rs531918573 2441 dbSNP
rs918799665 2448 dbSNP
rs1237081138 2452 dbSNP
rs1214597828 2453 dbSNP
rs1308896848 2472 dbSNP
rs1447881829 2474 dbSNP
rs1375774831 2476 dbSNP
rs1262720911 2477 dbSNP
rs749631927 2483 dbSNP
rs1447433923 2505 dbSNP
rs1022249118 2506 dbSNP
rs749104897 2507 dbSNP
rs1417716679 2516 dbSNP
rs888676982 2520 dbSNP
rs1477953643 2528 dbSNP
rs1159014312 2529 dbSNP
rs1006318444 2537 dbSNP
rs1253602607 2541 dbSNP
rs1180877254 2547 dbSNP
rs1038658878 2558 dbSNP
rs1403669706 2559 dbSNP
rs900256623 2567 dbSNP
rs755213906 2569 dbSNP
rs1310875520 2584 dbSNP
rs541973079 2584 dbSNP
rs958666265 2591 dbSNP
rs1379993474 2592 dbSNP
rs879468999 2596 dbSNP
rs993053696 2596 dbSNP
rs1359797200 2598 dbSNP
rs961785210 2600 dbSNP
rs1030034446 2606 dbSNP
rs1366447080 2612 dbSNP
rs1163650024 2617 dbSNP
rs1233834458 2619 dbSNP
rs1415416184 2625 dbSNP
rs1190860792 2631 dbSNP
rs966538981 2636 dbSNP
rs920345681 2638 dbSNP
rs999300558 2646 dbSNP
rs1217932095 2654 dbSNP
rs779174044 2665 dbSNP
rs1351486445 2674 dbSNP
rs1032685629 2678 dbSNP
rs148686854 2679 dbSNP
rs1295257503 2682 dbSNP
rs1488699357 2686 dbSNP
rs1339875893 2694 dbSNP
rs1278787755 2695 dbSNP
rs1383789318 2696 dbSNP
rs1388313930 2697 dbSNP
rs991228691 2701 dbSNP
rs945005249 2702 dbSNP
rs1396193609 2703 dbSNP
rs1168046827 2707 dbSNP
rs527685805 2708 dbSNP
rs916621597 2719 dbSNP
rs547769935 2723 dbSNP
rs970716758 2724 dbSNP
rs1040512345 2725 dbSNP
rs760325372 2727 dbSNP
rs1430808476 2734 dbSNP
rs918663856 2737 dbSNP
rs1200070601 2740 dbSNP
rs1190958911 2749 dbSNP
rs570849161 2750 dbSNP
rs770517428 2751 dbSNP
rs1196928205 2753 dbSNP
rs187048954 2754 dbSNP
rs1258714968 2757 dbSNP
rs552480040 2760 dbSNP
rs930142248 2761 dbSNP
rs1300389280 2772 dbSNP
rs1043754311 2781 dbSNP
rs568993313 2790 dbSNP
rs776383240 2791 dbSNP
rs1328891589 2807 dbSNP
rs1464719193 2817 dbSNP
rs1519312 2818 dbSNP
rs747464154 2825 dbSNP
rs1002590201 2826 dbSNP
rs1421090581 2834 dbSNP
rs1291463808 2846 dbSNP
rs1198724606 2849 dbSNP
rs1040351850 2854 dbSNP
rs1033711435 2859 dbSNP
rs1177004244 2867 dbSNP
rs1457480703 2870 dbSNP
rs554392012 2872 dbSNP
rs115602674 2874 dbSNP
rs997120204 2882 dbSNP
rs1051486709 2883 dbSNP
rs1014216640 2898 dbSNP
rs1255364270 2899 dbSNP
rs192383540 2901 dbSNP
rs999330361 2918 dbSNP
rs1349792817 2919 dbSNP
rs868443679 2925 dbSNP
rs180674528 2927 dbSNP
rs1374571673 2930 dbSNP
rs771430249 2932 dbSNP
rs1032135158 2933 dbSNP
rs761252376 2935 dbSNP
rs893624632 2938 dbSNP
rs186109810 2941 dbSNP
rs1012207315 2948 dbSNP
rs1400809376 2957 dbSNP
rs561307940 2960 dbSNP
rs1027378659 2962 dbSNP
rs951848310 2963 dbSNP
rs1397344699 2965 dbSNP
rs1157216740 2970 dbSNP
rs986186977 2976 dbSNP
rs576428732 2978 dbSNP
rs75625203 2980 dbSNP
rs1255481109 2986 dbSNP
rs556780855 2987 dbSNP
rs35103715 2988 dbSNP
rs1239126970 3009 dbSNP
rs1355970582 3011 dbSNP
rs1210795954 3018 dbSNP
rs1280947085 3030 dbSNP
rs1025752967 3035 dbSNP
rs1339368195 3036 dbSNP
rs1456782123 3046 dbSNP
rs1415998766 3047 dbSNP
rs1377772420 3057 dbSNP
rs1296780118 3059 dbSNP
rs565910223 3060 dbSNP
rs1409100734 3061 dbSNP
rs1238213281 3065 dbSNP
rs1160518803 3068 dbSNP
rs759918425 3075 dbSNP
rs190200986 3090 dbSNP
rs142076538 3092 dbSNP
rs1476171395 3093 dbSNP
rs1458158375 3094 dbSNP
rs1260984247 3104 dbSNP
rs896526598 3108 dbSNP
rs1134628 3110 dbSNP
rs562047893 3114 dbSNP
rs1447374196 3115 dbSNP
rs942859897 3118 dbSNP
rs111807961 3123 dbSNP
rs975713576 3135 dbSNP
rs768230172 3141 dbSNP
rs1397860902 3144 dbSNP
rs1445890379 3148 dbSNP
rs897759116 3165 dbSNP
rs993308042 3171 dbSNP
rs1399864536 3176 dbSNP
rs1027513324 3182 dbSNP
rs1320682846 3186 dbSNP
rs1379073189 3186 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions QSG-7701
Disease MIMAT0003879
Location of target site 3'UTR
Tools used in this research miRanda , Pictar
Original Description (Extracted from the article) ... "we transfected QSG-7701 cells with miR-758 mimics and inhibitors. The results showed that miR-758 down-regulated both TLR3 and TLR7 expression and that its inhibitor could upregulate both TLR3 and TLR7 expression (Fig. 4B). Furthermore ...

- Yang Q; Fu S; Wang J, 2014, Archives of virology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccaaucaccugguccAGUGUUu 5'
                         |||||| 
Target 5' aaugauuauauucuaUCACAAu 3'
 		1 - 22
Article - Yang Q; Fu S; Wang J
- Archives of virology, 2014
Chronic infection with hepatotropic viruses is the main cause of chronic liver disease and cirrhosis worldwide. Toll-like receptor 3 (TLR3) and Toll-like receptor 7 (TLR7) are pathogen-recognition receptors that are expressed on innate immune cells. They recognize viral RNA, which induces their activation, with a subsequent increase in type I interferon transcription. Hepatitis C virus (HCV) infection inhibits the expression of TLR3 and TLR7; however, the mechanism by which this occurs is unclear. MicroRNAs (miRNAs) are small RNAs that posttranscriptionally regulate gene expression. Their aberrant expression is commonly correlated with disease status, as is the case with HCV infection. Here, we found that miR-758 levels were increased in patients with HCV infection and were correlated with TLR3 and TLR7 expression levels in the patients with HCV infection, and bioinformatics analysis predicted that TLR3 and TLR7 are targets of miR-758. Therefore, we postulate that HCV may increase the level of miR-758, which inhibits the expression of TLR3 and TLR7, resulting in a loss of antiviral effect. In order to test our hypothesis, we constructed an HCV core protein expression plasmid and used it to transfect liver cells. The results showed that HCV infection increased miR-758 levels and decreased TLR3/TLR7 expression. Furthermore, using RT-PCR and luciferase reporter analysis, we found that miR-758 targets TLR3 and TLR7, with a subsequent decrease in IFNalpha and IFNbeta production. In conclusion, our results highlight the upregulation of miR-758 expression by HCV as a novel mechanism contributing to downregulation of TLR3 and TLR7 in patients with HCV infection.
LinkOut: [PMID: 25008898]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.713 4.6e-5 -0.703 6.4e-5 24 Click to see details
GSE28260 Renal cortex and medulla 0.657 7.3e-3 0.643 8.9e-3 13 Click to see details
GSE21849 B cell lymphoma -0.352 3.1e-2 -0.015 4.7e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.407 5.9e-2 0.350 9.2e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.314 6.3e-2 0.424 1.7e-2 25 Click to see details
GSE19536 Breast cancer -0.14 8.2e-2 -0.089 1.9e-1 100 Click to see details
GSE17306 Multiple myeloma 0.199 8.5e-2 0.340 8.4e-3 49 Click to see details
GSE17498 Multiple myeloma -0.211 9.6e-2 -0.227 7.9e-2 40 Click to see details
GSE19783 ER- ER- breast cancer -0.092 2.1e-1 -0.053 3.2e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.21 2.6e-1 0.266 2.0e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.071 2.9e-1 -0.123 1.7e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.084 3.2e-1 0.018 4.6e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.082 3.7e-1 0.248 1.5e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.07 3.7e-1 0.035 4.3e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.018 4.7e-1 -0.057 4.1e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.018 4.7e-1 -0.057 4.1e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.251 0.05 -0.234 0.07 42 Click to see details
THCA 0.224 0.06 0.319 0.01 50 Click to see details
LIHC -0.217 0.07 -0.172 0.12 49 Click to see details
CESC -0.965 0.08 -1.000 0.5 3 Click to see details
COAD -0.474 0.12 -0.095 0.41 8 Click to see details
STAD -0.203 0.13 -0.276 0.06 32 Click to see details
CHOL -0.396 0.15 -0.467 0.1 9 Click to see details
UCEC 0.232 0.17 0.228 0.17 19 Click to see details
ESCA 0.308 0.18 0.364 0.14 11 Click to see details
LUAD 0.269 0.2 0.210 0.26 12 Click to see details
BRCA 0.068 0.27 0.102 0.18 84 Click to see details
PAAD 0.459 0.27 0.200 0.4 4 Click to see details
PCPG -0.523 0.32 -0.500 0.33 3 Click to see details
PRAD -0.049 0.37 -0.076 0.3 50 Click to see details
KIRC 0.046 0.37 0.011 0.47 52 Click to see details
BLCA 0.081 0.37 -0.007 0.49 18 Click to see details
KIRP -0.026 0.45 -0.065 0.37 29 Click to see details
KICH 0.027 0.45 0.087 0.35 23 Click to see details
LUSC 0.003 0.49 0.036 0.42 38 Click to see details
LUSC 0.003 0.49 0.036 0.42 38 Click to see details
LUSC 0.003 0.49 0.036 0.42 38 Click to see details
48 hsa-miR-758-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118609 NCOA3 nuclear receptor coactivator 3 2 2
MIRT122451 SMIM13 small integral membrane protein 13 2 2
MIRT438602 TLR7 toll like receptor 7 3 1
MIRT438603 TLR3 toll like receptor 3 3 1
MIRT446951 CD248 CD248 molecule 2 2
MIRT447942 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT450648 TMEM70 transmembrane protein 70 2 2
MIRT463976 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT465151 TSC22D2 TSC22 domain family member 2 2 2
MIRT468670 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469019 RNF41 ring finger protein 41 2 2
MIRT475623 HMGA1 high mobility group AT-hook 1 2 4
MIRT485794 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT492982 NAV1 neuron navigator 1 2 2
MIRT493720 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT498889 RBM12B RNA binding motif protein 12B 2 4
MIRT499194 TJAP1 tight junction associated protein 1 2 2
MIRT499331 RAB25 RAB25, member RAS oncogene family 2 2
MIRT510550 WTAP WT1 associated protein 2 4
MIRT524405 COL4A1 collagen type IV alpha 1 chain 2 4
MIRT530160 C11orf44 chromosome 11 open reading frame 44 2 2
MIRT534595 RORA RAR related orphan receptor A 2 2
MIRT538452 CNKSR2 connector enhancer of kinase suppressor of Ras 2 2 2
MIRT543494 MDM2 MDM2 proto-oncogene 2 4
MIRT547860 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT553785 TACC1 transforming acidic coiled-coil containing protein 1 2 2
MIRT553903 SUN2 Sad1 and UNC84 domain containing 2 2 4
MIRT559303 ATXN1 ataxin 1 2 2
MIRT563350 ZNF181 zinc finger protein 181 2 2
MIRT565404 TFDP1 transcription factor Dp-1 2 2
MIRT566891 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT613227 CCDC39 coiled-coil domain containing 39 2 2
MIRT613470 TG thyroglobulin 2 4
MIRT619930 WSCD2 WSC domain containing 2 2 2
MIRT627180 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT632962 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT634304 SNTN sentan, cilia apical structure protein 2 2
MIRT635292 IRX2 iroquois homeobox 2 2 2
MIRT639740 SLC1A1 solute carrier family 1 member 1 2 2
MIRT641892 SMNDC1 survival motor neuron domain containing 1 2 2
MIRT645871 PRRG3 proline rich and Gla domain 3 2 2
MIRT648691 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT650048 KRBA1 KRAB-A domain containing 1 2 2
MIRT667626 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT669725 A1CF APOBEC1 complementation factor 2 2
MIRT710429 BTNL3 butyrophilin like 3 2 2
MIRT710805 SLC4A1AP solute carrier family 4 member 1 adaptor protein 2 2
MIRT723980 SOX17 SRY-box 17 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-758 Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-758 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-758 5-Fluorouracil approved 3385 Quantitative real-time PCR human squamous cell carcinoma cell line KYSE410 21743970 2011 up-regulated
miR-758 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-758 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-758 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-758 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-758-3p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-758-3p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-758-3p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-758-3p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-758-3p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-758-3p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-1h-indol-2-one 5471470 NSC711610 sensitive
hsa-miR-758-3p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-758-3p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-758-3p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-758-3p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-758-3p [(11bR)-9,10-dimethoxy-4-phenylimino-2,6,7,11b-tetrahydro-1H-[1,3]thiazino[4,3-a]isoquinolin-1-yl]methyl benzoate 371073 NSC645016 sensitive
hsa-miR-758-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-(2-methylphenyl)propanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hepta 383478 NSC671870 sensitive
hsa-miR-758-3p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 resistant
hsa-miR-758-3p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-758-3p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-758-3p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-758-3p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-758-3p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-758-3p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-758-3p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-758-3p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-758-3p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-758-3p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-758-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-758-3p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-758-3p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-758-3p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-758-3p 2-(trifluoromethyl)benzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383194 NSC671313 sensitive
hsa-miR-758-3p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-758-3p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-758-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 sensitive
hsa-miR-758-3p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-758-3p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-758-3p 2-methyl-1-[10-[(2-methylquinolin-4-yl)amino]decyl]quinolin-1-ium-4-amine;chloride;hydrochloride 387885 NSC682096 sensitive
hsa-miR-758-3p 2-methyl-4,4-diphenyl-1,4-benzoxaphosphinin-4-ium;bromide 24199840 NSC346098 sensitive
hsa-miR-758-3p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-758-3p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-758-3p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-758-3p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-758-3p 2,3-dibenzoyloxy-4-hydroxy-4-oxobutanoate;(2,5-dimethylphenyl)-(4-methylphenyl)-phenylsulfanium 5351228 NSC116693 sensitive
hsa-miR-758-3p 2,5-dibenzyl-2-undecyloctahydro-1h-pyrrolo[3,4-c]pyridin-2-ium bromide 378731 NSC661832 sensitive
hsa-miR-758-3p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-758-3p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-758-3p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-758-3p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-758-3p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-758-3p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-758-3p 4-(4-carbazol-9-ylbutanoylamino)-n-[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 406397 NSC724462 sensitive
hsa-miR-758-3p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-758-3p 4-[(13R)-13-hydroxy-13-[(2S,5S)-5-[(2S,5S)-5-[1-hydroxy-13-[(2S)-2-methyl-5-oxo-2H-furan-4-yl]tridecyl]oxolan-2-yl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one 374064 NSC651320 sensitive
hsa-miR-758-3p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-758-3p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-758-3p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-758-3p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-758-3p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-758-3p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-758-3p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-758-3p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-758-3p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-758-3p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-758-3p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-758-3p 5,11-dimethyl-2-[(pentanoyloxy)methyl]-6h-pyrido[4,3-b]carbazol-2-ium iodide 367409 NSC637130 sensitive
hsa-miR-758-3p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-758-3p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-758-3p 6,7-dimethyl-4-[(2z)-2-(5-oxooxolan-2-ylidene)ethoxy]chromen-2-one 24205380 NSC735332 resistant
hsa-miR-758-3p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-758-3p 7-[(3-fluorophenyl)methoxy]-9-[(3-fluorophenyl)methyl]-2-[(4-fluorophenyl)methyl]-1-methylpyrido[3,4-b]indol-2-ium 54766740 NSC760181 sensitive
hsa-miR-758-3p 7-hydroxy-2-nonyl-4h-chromen-4-one 5375154 NSC631965 sensitive
hsa-miR-758-3p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-758-3p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-758-3p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-758-3p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-758-3p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-758-3p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-758-3p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-758-3p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-758-3p 9-bromo-2,3-dimethoxy-7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-6-one 395805 NSC700693 resistant
hsa-miR-758-3p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-758-3p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-758-3p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-758-3p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-758-3p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-758-3p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-758-3p Ellipticine 3213 NSC71795 sensitive
hsa-miR-758-3p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-758-3p Ethyl (E)-3-(6-methoxy-1-thiophen-3-yl-3,4-dihydronaphthalen-2-yl)prop-2-enoate 24205739 NSC736553 sensitive
hsa-miR-758-3p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-758-3p Fixierer p 70397 NSC63839 resistant
hsa-miR-758-3p Gtpl10345 378629 NSC661421 resistant
hsa-miR-758-3p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-758-3p Haloprogin 3561 NSC100071 resistant
hsa-miR-758-3p Heteromine a 391982 NSC691767 sensitive
hsa-miR-758-3p Hexyl (e)-3-[(2s,4z)-2-(hydroxymethyl)-4-(4-methyl-3-propan-2-ylpentylidene)-5-oxooxolan-2-yl]prop-2-enoate 5471817 NSC714070 sensitive
hsa-miR-758-3p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-758-3p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-758-3p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-758-3p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-758-3p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-758-3p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-758-3p Kuc100204 378309 NSC660313 sensitive
hsa-miR-758-3p Laurusin 135476719 NSC106486 resistant
hsa-miR-758-3p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-758-3p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-758-3p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-758-3p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-758-3p Musennin 267361 NSC106554 sensitive
hsa-miR-758-3p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-758-3p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-758-3p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-758-3p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-758-3p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-758-3p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-758-3p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-758-3p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-758-3p None 12201866 NSC179207 resistant
hsa-miR-758-3p NSC644919 NSC644919 sensitive
hsa-miR-758-3p NSC699071 NSC699071 sensitive
hsa-miR-758-3p NSC751830 NSC751830 resistant
hsa-miR-758-3p Oxidanium;1,3-diphenylpropane-1,3-dione;neodymium(3+);hydroxide 24202397 NSC647042 sensitive
hsa-miR-758-3p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-758-3p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-758-3p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-758-3p Protein: pahiv4 NSC678525 sensitive
hsa-miR-758-3p Pyrazolanthrone 8515 NSC75890 resistant
hsa-miR-758-3p Pyrimido[5,4-g]pteridine-2,4,6,8(1h,3h,7h,9h)-tetrone, 1,9-bis(methoxymethyl)-3,7-dimethyl-, 5-oxide 385097 NSC676032 sensitive
hsa-miR-758-3p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-758-3p Stl298328 387753 NSC681782 resistant
hsa-miR-758-3p Stl323035 383655 NSC672073 sensitive
hsa-miR-758-3p Stl361983 256661 NSC83715 resistant
hsa-miR-758-3p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-758-3p Tris(1,10-phenanthroline)lanthanum(iii)-trithiocyanate 24202211 NSC632737 resistant
hsa-miR-758-3p Xestin a 5352066 NSC647638 resistant
hsa-miR-758-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-758-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-758-3p Etoposide 36462 NSC141540 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-758-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Cancer cell line (ECA-109)
hsa-miR-758-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-758-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-758-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-758-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-758-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-758-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-758-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-758-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-758-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-758-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-758-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-758-3p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-758-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-758-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-758-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-758-3p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission