miRTarBase - #MIRT438687


—
pre-miRNA Information
pre-miRNA mmu-mir-181b-1   
Genomic Coordinates chr1: 137966639 - 137966718
Description Mus musculus miR-181b-1 stem-loop
Comment Mouse miR-181b was predicted by computational methods using conservation with human and Fugu rubripes sequences .
RNA Secondary Structure
pre-miRNA mmu-mir-181b-2   
Genomic Coordinates chr2: 38853830 - 38853918
Synonyms Mirn181b-2, mir-181b-2, Mir181b-2
Description Mus musculus miR-181b-2 stem-loop
Comment Mouse miR-181b was predicted by computational methods using conservation with human and Fugu rubripes sequences .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-181b-5p
Sequence 12| AACAUUCAUUGCUGUCGGUGGGU |34
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BK9AD8 miR-181b-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood Quantitative reverse transcription PCR
Gene Information
Gene Symbol Hspa5   
Synonyms AL022860, AU019543, Bip, D2Wsu141e, D2Wsu17e, Grp78, Hsce70, SEZ-7, Sez7, baffled, mBiP
Description heat shock protein 5
Transcript NM_001163434   
Other Transcripts NM_022310   
Expression
Putative miRNA Targets on Hspa5
3'UTR of Hspa5
(miRNA target sites are highlighted)		 
>Hspa5|NM_001163434|3'UTR
   1 GTGCACTGATCTGCTAGAGCTGTAATATTGTAAATACTGGACTCAGGAACTTTCGTTGGGAGAAAATTGAGAGAACTTAA
  81 GTCTCGAATGTAATTGGAATCTTCACCTCAGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCAT
 161 TAGCAGTTGCTCACATGTCTTGGGGTCAGGGAGAGGAGGAATTGGCTATTTTAAAAATTGAGAAAAAGGTGGGTCAGGGT
 241 GTGTGTTCACCTTGGATATGGTCTATTTAACAATTGGGTCATGCACATGTGGTGTAGGAACTTTTTTCTACCATAAGTGA
 321 CACCAATAAATGTTTGTTATTTACACTGGTCTAATTTTTGTGAAAAGTTTGTAATTATATCCATCTTTTATTTTAGATAA
 401 CTAAAATTTAAGACTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugGGUG---GCUGUCGUUACUUACAa 5'
            |||:   :|||| |||| ||||| 
Target 5' taCCATAAGTGACACCAATAAATGTt 3'
 309 - 334 145.00 -16.90
2 
miRNA  3' uggguggcugucguuaCUUACAa 5'
                          |||||| 
Target 5' agagaacttaagtctcGAATGTa 3'
 70 - 92 120.00 -9.00
3 
miRNA  3' ugggugGCUGUCG---UUACUUACAa 5'
                | |:|||   |:||: ||| 
Target 5' aaaatgCTATAGCCCAAGTGGCTGTt 3'
 122 - 147 109.00 -11.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions N2A neuroblastoma cell
Location of target site 3'UTR
Tools used in this research PicTar , TargetScan
Original Description (Extracted from the article) ... miR-181b Targeting HSPA5 and UCHL1. ...

- Peng Z; Li J; Li Y; Yang X; Feng S; Han S; Li J, 2013, Journal of neuroscience research.

Article - Peng Z; Li J; Li Y; Yang X; Feng S; Han S; Li J
- Journal of neuroscience research, 2013
Understanding the molecular mechanism of cerebral hypoxic preconditioning (HPC)-induced endogenous neuroprotection may provide potential therapeutic targets for ischemic stroke. By using bioinformatics analysis, we found that miR-181b, one of 19 differentially expressed miRNAs, may target aconitate hydratase (ACO2), heat shock protein A5 (HSPA5), and ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHL1) among 26 changed protein kinase C isoform-specific interacting proteins in HPC mouse brain. In this study, the role of miR-181b in oxygen-glucose deprivation (OGD)-induced N2A cell ischemic injury in vitro and mouse middle cerebral artery occlusion (MCAO)-induced cerebral ischemic injury in vivo, and its regulation of ACO2, HSPA5, and UCHL1 were further determined. We found that miR-181b expression levels significantly decreased in mouse brain following MCAO and in OGD-treated N2A cells. Up- and downregulation of miR-181b by transfection of pre- or anti-miR-181b could negatively regulate HSPA5 and UCHL1 (but not ACO2) protein levels as well as N2A cell death and programmed cell death in OGD-treated N2A cells. By using a T7 promoter-driven control dual luciferase assay, we confirmed that miR-181b could bind to the 3'-untranslated rergions of HSPA5 and UCHL1 mRNAs and repress their translations. miR-181b antagomir reduced caspase-3 cleavage and neural cell loss in cerebral ischemic cortex and improved neurological deficit of mice after MCAO. In addition, HSPA5 and UCHL1 short interfering RNAs (siRNAs) blocked anti-miR-181b-mediated neuroprotection against OGD-induced N2A cell injury in vitro. These results suggest that the downregulated miR-181b induces neuroprotection against ischemic injury through negatively regulating HSPA5 and UCHL1 protein levels, providing a potential therapeutic target for ischemic stroke.
LinkOut: [PMID: 23900885]
56 mmu-miR-181b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004755 Timp3 tissue inhibitor of metalloproteinase 3 4 1
MIRT005296 Aicda activation-induced cytidine deaminase 5 1
MIRT005300 Slc35d3 solute carrier family 35, member D3 2 1
MIRT005301 Ak4 adenylate kinase 4 2 1
MIRT005302 Ndrg1 N-myc downstream regulated gene 1 2 1
MIRT005303 Pitpnc1 phosphatidylinositol transfer protein, cytoplasmic 1 2 1
MIRT005304 Tmem14a transmembrane protein 14A 2 1
MIRT005305 Cd244 CD244 natural killer cell receptor 2B4 2 1
MIRT005306 Gch1 GTP cyclohydrolase 1 2 1
MIRT005307 Errfi1 ERBB receptor feedback inhibitor 1 2 1
MIRT005308 Hk2 hexokinase 2 2 1
MIRT005309 Mxi1 MAX interactor 1, dimerization protein 2 1
MIRT005310 Ccdc58 coiled-coil domain containing 58 2 1
MIRT005311 Sc4mol methylsterol monoxygenase 1 2 1
MIRT005312 Pfkfb3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 2 1
MIRT005313 Pdxp pyridoxal (pyridoxine, vitamin B6) phosphatase 2 1
MIRT005314 Atp5g1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) 2 1
MIRT005315 Casp3 caspase 3 2 1
MIRT005316 Ulk3 unc-51-like kinase 3 2 1
MIRT005317 Snx25 sorting nexin 25 2 1
MIRT005318 Higd1a HIG1 domain family, member 1A 2 1
MIRT006312 Cbx7 chromobox 7 2 1
MIRT438370 SIX2 SIX homeobox 2 3 1
MIRT438687 Hspa5 heat shock protein 5 3 1
MIRT438688 Uchl1 ubiquitin carboxy-terminal hydrolase L1 3 1
MIRT577184 Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 5
MIRT577425 Tulp3 tubby-like protein 3 1 1
MIRT578325 Magea5 melanoma antigen, family A, 5 1 1
MIRT579346 Arhgef15 Rho guanine nucleotide exchange factor (GEF) 15 1 4
MIRT580671 Stk32a serine/threonine kinase 32A 1 1
MIRT580762 Spp1 secreted phosphoprotein 1 1 1
MIRT581071 Sgpp1 sphingosine-1-phosphate phosphatase 1 1 1
MIRT582047 Osbpl3 oxysterol binding protein-like 3 1 1
MIRT582656 Lnp lunapark, ER junction formation factor 1 2
MIRT583661 Fam160b2 family with sequence similarity 160, member B2 1 5
MIRT583691 Fam122b family with sequence similarity 122, member B 1 1
MIRT584580 Bnc2 basonuclin 2 1 1
MIRT584878 Ap1g1 adaptor protein complex AP-1, gamma 1 subunit 1 1
MIRT586224 Ptchd2 dispatched RND transporter family member 3 1 2
MIRT587223 Fam69c family with sequence similarity 69, member C 1 1
MIRT588616 Trim2 tripartite motif-containing 2 1 1
MIRT589131 Rad51d RAD51 paralog D 1 1
MIRT589794 Ikzf2 IKAROS family zinc finger 2 1 2
MIRT590593 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT591186 Ms4a4c membrane-spanning 4-domains, subfamily A, member 4C 1 3
MIRT591489 Aqp3 aquaporin 3 1 2
MIRT592858 Adamts9 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 1 2
MIRT594856 Nacc1 nucleus accumbens associated 1, BEN and BTB (POZ) domain containing 1 1
MIRT594983 Ebf3 early B cell factor 3 1 1
MIRT596592 Zfp689 zinc finger protein 689 1 1
MIRT598537 Itpk1 inositol 1,3,4-triphosphate 5/6 kinase 1 1
MIRT598728 H2-D1 histocompatibility 2, D region locus 1 1 1
MIRT600002 4930563E22Rik RIKEN cDNA 4930563E22 gene 1 1
MIRT603966 Gpd1l glycerol-3-phosphate dehydrogenase 1-like 1 1
MIRT605134 Clmn calmin 1 1
MIRT606009 Dagla diacylglycerol lipase, alpha 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-181b Teniposide approved 452548 Quantitative real-time PCR glioma cells 25151861 2014 up-regualted
miR-181b All-trans-retinoic acid (ATRA) approved 444795 Microarray acute promyelocytic leukemia 17260024 2008 down-regulated
miR-181b Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-181b Trichostatin A (TSA) NULL 444732 Microarray human pancreatic cancer cell line BxPC-3 19112422 2009 down-regulated
miR-181b Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
miR-181b Gemcitabine approved 60750 Microarray ovarian cancer 19237188 2009 up-regulated
miR-181b All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR acute promyelocytic leukemia (APL) 19749800 2009 down-regulated
miR-181b Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 down-regulated
miR-181b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-181b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-181b Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-181b Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-181b Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-181b Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-181b Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-181b Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-181b 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-181b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-181b Estrogen NULL NULL Microarray mouse uterus 20720260 2010 down-regulated
miR-181b Estrogen NULL NULL Quantitative real-time PCR mouse uterus 20720260 2010 down-regulated
miR-181b Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-181b Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-181b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-181b Perfluorooctane sulfonate NULL 74483 Quantitative real-time PCR zebrafish embryos 20878907 2011 down-regulated
miR-181b Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-181b-5p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Ductal Adenocarcinoma tissue and cell line (SW1990, CFPAC-1)

Error report submission