pre-miRNA Information
pre-miRNA hsa-mir-544a   
Genomic Coordinates chr14: 101048658 - 101048748
Description Homo sapiens miR-544a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-544a
Sequence 55| AUUCUGCAUUUUUAGCAAGUUC |76
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1286637864 5 dbSNP
rs1394789797 9 dbSNP
rs1172200176 17 dbSNP
Putative Targets

Gene Information
Gene Symbol ZBTB17   
Synonyms MIZ-1, ZNF151, ZNF60, pHZ-67
Description zinc finger and BTB domain containing 17
Transcript NM_003443   
Expression
Putative miRNA Targets on ZBTB17
3'UTR of ZBTB17
(miRNA target sites are highlighted)
>ZBTB17|NM_003443|3'UTR
   1 GCTGGCGGCCCTTCTGACTGTTTATTTAAGGATGGATGGCACCCTGGAACCGGGAAGGGTGGCCTGTTCCCTAGAGAGAA
  81 TAAATTGGATTATTTTCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN1091169 6 COSMIC
COSN27005483 7 COSMIC
COSN20073488 16 COSMIC
COSN30462757 31 COSMIC
COSN27005486 51 COSMIC
COSN30451079 52 COSMIC
COSN16129673 76 COSMIC
COSN30102604 78 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1355929725 2 dbSNP
rs760106995 4 dbSNP
rs754463422 6 dbSNP
rs766998489 7 dbSNP
rs769327064 21 dbSNP
rs753479324 24 dbSNP
rs761351987 24 dbSNP
rs199620366 29 dbSNP
rs773758392 31 dbSNP
rs373585975 34 dbSNP
rs762557481 37 dbSNP
rs1264367912 38 dbSNP
rs775337300 42 dbSNP
rs1487614511 43 dbSNP
rs1163511245 45 dbSNP
rs769640407 47 dbSNP
rs1211414775 48 dbSNP
rs921993436 52 dbSNP
rs1204080700 55 dbSNP
rs1463080602 57 dbSNP
rs976730505 60 dbSNP
rs752662499 61 dbSNP
rs576334772 69 dbSNP
rs1282490708 74 dbSNP
rs888588875 75 dbSNP
rs1340310661 76 dbSNP
rs759504837 78 dbSNP
rs1461152307 79 dbSNP
rs1027653161 88 dbSNP
rs983637068 91 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
139 hsa-miR-544a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053511 BMI1 BMI1 proto-oncogene, polycomb ring finger 4 1
MIRT054802 CDH1 cadherin 1 3 2
MIRT075814 ZCCHC14 zinc finger CCHC-type containing 14 2 3
MIRT125570 SCD stearoyl-CoA desaturase 1 1
MIRT246745 SF1 splicing factor 1 2 2
MIRT259487 TXLNG taxilin gamma 2 2
MIRT307650 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 2 2
MIRT377046 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT386936 STAT3 signal transducer and activator of transcription 3 3 1
MIRT394127 UBQLN1 ubiquilin 1 1 1
MIRT439199 ZNF483 zinc finger protein 483 1 1
MIRT439207 ZNF33A zinc finger protein 33A 1 1
MIRT439262 ZBTB17 zinc finger and BTB domain containing 17 1 1
MIRT439263 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT439281 XAB2 XPA binding protein 2 1 1
MIRT439314 VAT1 vesicle amine transport 1 1 1
MIRT439380 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT439397 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT439419 TMOD1 tropomodulin 1 1 1
MIRT439491 SYT5 synaptotagmin 5 1 1
MIRT439511 STXBP1 syntaxin binding protein 1 1 1
MIRT439586 SMAD7 SMAD family member 7 1 1
MIRT439727 RPS6 ribosomal protein S6 1 1
MIRT439768 RLIM ring finger protein, LIM domain interacting 1 1
MIRT439828 RAD50 RAD50 double strand break repair protein 1 1
MIRT439840 RAB21 RAB21, member RAS oncogene family 1 1
MIRT439846 RAB14 RAB14, member RAS oncogene family 1 1
MIRT439975 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT440031 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT440135 NCOA2 nuclear receptor coactivator 2 1 1
MIRT440173 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT440222 MMP2 matrix metallopeptidase 2 1 1
MIRT440433 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT440443 INTS3 integrator complex subunit 3 1 1
MIRT440449 INS insulin 1 1
MIRT440512 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440534 GPR56 adhesion G protein-coupled receptor G1 1 1
MIRT440540 GOLGB1 golgin B1 1 1
MIRT440580 GEM GTP binding protein overexpressed in skeletal muscle 1 1
MIRT440629 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT440667 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440680 CCSER1 coiled-coil serine rich protein 1 1 1
MIRT440696 FADS1 fatty acid desaturase 1 1 1
MIRT440761 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT440764 DUSP26 dual specificity phosphatase 26 1 1
MIRT440769 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT440774 DSP desmoplakin 1 1
MIRT440792 DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 1 1
MIRT440801 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 1 1
MIRT440888 CPE carboxypeptidase E 1 1
MIRT440923 CLTC clathrin heavy chain 1 1
MIRT440950 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT440993 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT441014 CAPN3 calpain 3 1 1
MIRT441106 BRD4 bromodomain containing 4 1 1
MIRT441144 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT441173 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT441258 ADM adrenomedullin 1 1
MIRT441279 ACTB actin beta 2 5
MIRT441298 ACACB acetyl-CoA carboxylase beta 1 1
MIRT443751 SLC7A14 solute carrier family 7 member 14 2 2
MIRT450469 TRMT5 tRNA methyltransferase 5 2 4
MIRT450852 HMGN2 high mobility group nucleosomal binding domain 2 2 6
MIRT454152 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT465705 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT466121 TMEM170A transmembrane protein 170A 2 2
MIRT471376 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 2 2
MIRT477475 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT481660 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT502469 FAM98A family with sequence similarity 98 member A 2 8
MIRT503952 ZNF180 zinc finger protein 180 2 6
MIRT505585 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 6
MIRT529936 SYNGR1 synaptogyrin 1 2 2
MIRT530626 PPIC peptidylprolyl isomerase C 2 4
MIRT536883 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT546847 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT548448 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT557130 HOXA13 homeobox A13 2 2
MIRT560089 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560984 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT566340 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567838 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT609236 SERPINA4 serpin family A member 4 2 2
MIRT611452 ZWILCH zwilch kinetochore protein 2 2
MIRT612058 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT612783 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT615116 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT616572 C1orf56 chromosome 1 open reading frame 56 2 2
MIRT616690 LPL lipoprotein lipase 2 2
MIRT616986 COL19A1 collagen type XIX alpha 1 chain 2 2
MIRT619427 CYB5R3 cytochrome b5 reductase 3 2 2
MIRT623320 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT626897 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT637554 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT639473 SLC6A4 solute carrier family 6 member 4 2 2
MIRT639753 GPR45 G protein-coupled receptor 45 2 2
MIRT640703 MRS2 MRS2, magnesium transporter 2 2
MIRT642489 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT644578 SPOP speckle type BTB/POZ protein 2 2
MIRT645009 NGRN neugrin, neurite outgrowth associated 2 2
MIRT646533 KLK2 kallikrein related peptidase 2 2 2
MIRT648625 LEMD2 LEM domain containing 2 2 2
MIRT650235 ERI1 exoribonuclease 1 2 2
MIRT651932 UBN1 ubinuclein 1 2 2
MIRT652960 SVEP1 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 2 2
MIRT654842 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT656142 MSH5 mutS homolog 5 2 2
MIRT656730 LMBRD2 LMBR1 domain containing 2 2 2
MIRT657340 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT658991 DLGAP2 DLG associated protein 2 2 2
MIRT660714 AMER1 APC membrane recruitment protein 1 2 2
MIRT666591 RFX3 regulatory factor X3 2 2
MIRT667201 NKX2-3 NK2 homeobox 3 2 2
MIRT668732 DIO2 iodothyronine deiodinase 2 2 2
MIRT669479 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT681083 GSTO2 glutathione S-transferase omega 2 2 2
MIRT686736 STX16 syntaxin 16 2 2
MIRT687432 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT689887 SOD2 superoxide dismutase 2 2 2
MIRT695759 WDR35 WD repeat domain 35 2 2
MIRT698346 TMEM127 transmembrane protein 127 2 2
MIRT702752 IGF1R insulin like growth factor 1 receptor 2 2
MIRT703137 GPR137C G protein-coupled receptor 137C 2 2
MIRT705063 C4orf32 family with sequence similarity 241 member A 2 2
MIRT709597 IFT74 intraflagellar transport 74 2 2
MIRT709997 TXNDC12 thioredoxin domain containing 12 2 2
MIRT710463 ASTN2 astrotactin 2 2 2
MIRT710468 CDH5 cadherin 5 2 2
MIRT715625 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720091 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721054 DCC DCC netrin 1 receptor 2 2
MIRT721961 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT722122 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT722538 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 2 2
MIRT723325 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT725330 NEUROD1 neuronal differentiation 1 2 2
MIRT731556 HOXA10 homeobox A10 2 1
MIRT732380 BCL6 B-cell CLL/lymphoma 6 3 1
MIRT736700 E2F5 E2F transcription factor 5 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-544a Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE450, TE-1)
hsa-miR-544a Trastuzumab sensitive High Breast Cancer cell line (SKBR3)
hsa-mir-544a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-544a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-544a Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-544a Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-544a Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-544a Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission