miRTarBase - #MIRT439375


—
pre-miRNA Information
pre-miRNA hsa-mir-412   
Genomic Coordinates chr14: 101065447 - 101065537
Synonyms MIRN412, hsa-mir-412, MIR412
Description Homo sapiens miR-412 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-412-3p
Sequence 54| ACUUCACCUGGUCCACUAGCCGU |76
Evidence Not_experimental
Experiments
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
rs61992671 18 GWAS
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369997462 1 dbSNP
rs1439693090 7 dbSNP
rs1301668924 11 dbSNP
rs534204576 13 dbSNP
rs775386036 14 dbSNP
rs762832140 15 dbSNP
rs1203323285 16 dbSNP
rs61992671 18 dbSNP
rs1022012324 19 dbSNP
rs1207609936 20 dbSNP
rs139967426 21 dbSNP
rs539487075 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TUBA1A   
Synonyms B-ALPHA-1, LIS3, TUBA3
Description tubulin alpha 1a
Transcript NM_006009   
Expression
Putative miRNA Targets on TUBA1A
3'UTR of TUBA1A
(miRNA target sites are highlighted)		 
>TUBA1A|NM_006009|3'UTR
   1 AGTTAAAACGTCACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAAACATTGAAAAGTTGTGGTCTGATCAGT
  81 TAATTTGTATGTAGCAGTGTATGCTCTCATATACAATTACTGACCTATGCTCTAAAACATGAATGCTTTGTTACAGACCC
 161 AAGCTGTCCATTTCTGTGATGGGTTTTGAATAAAGTATTCCCTGTCTTAAATGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcCGAUCACCUGGUCCACUUCa 5'
             |||: |    |||| |||| 
Target 5' ggtGCTGCTTTTACAGG-GAAGc 3'
 18 - 39 104.00 -12.80
2 
miRNA  3' ugccgaucaccuggucCACUUCa 5'
                          |||| | 
Target 5' caagctgtccatttctGTGATGg 3'
 160 - 182 88.00 -6.70
3 
miRNA  3' ugcCGAUCACCUGGU---CCACUUca 5'
             |:| |||| |::    || ||  
Target 5' aaaGTT-GTGGTCTGATCAGTTAAtt 3'
 61 - 85 71.00 -7.25
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
422892 2 ClinVar
309110 211 ClinVar
COSN22511829 9 COSMIC
COSN24304521 10 COSMIC
COSN30108273 14 COSMIC
COSN30183397 19 COSMIC
COSN30171279 30 COSMIC
COSN30142022 40 COSMIC
COSN23019764 45 COSMIC
COSN31504421 63 COSMIC
COSN30449739 72 COSMIC
COSN26564243 77 COSMIC
COSN30181545 87 COSMIC
COSN30149401 95 COSMIC
COSN27000517 104 COSMIC
COSN31546834 116 COSMIC
COSN18737266 173 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781483247 2 dbSNP
rs768839661 5 dbSNP
rs1376412644 9 dbSNP
rs371718931 9 dbSNP
rs747080229 10 dbSNP
rs1062437 13 dbSNP
rs777929464 16 dbSNP
rs758417587 19 dbSNP
rs753757160 22 dbSNP
rs766255841 23 dbSNP
rs185938303 26 dbSNP
rs1345894136 30 dbSNP
rs1198874784 34 dbSNP
rs1490758927 37 dbSNP
rs1260566998 40 dbSNP
rs1462627376 58 dbSNP
rs1442745193 64 dbSNP
rs960498970 70 dbSNP
rs11558066 87 dbSNP
rs1062439 106 dbSNP
rs556755463 113 dbSNP
rs150293856 114 dbSNP
rs757230901 120 dbSNP
rs1178938678 121 dbSNP
rs571426354 124 dbSNP
rs1474238571 125 dbSNP
rs1033808642 127 dbSNP
rs1062440 132 dbSNP
rs1426514189 138 dbSNP
rs1001712334 141 dbSNP
rs557975791 146 dbSNP
rs1168740814 150 dbSNP
rs1243417298 158 dbSNP
rs1400114428 165 dbSNP
rs1062441 174 dbSNP
rs1447781118 179 dbSNP
rs1333637861 183 dbSNP
rs1368798290 185 dbSNP
rs1435882912 195 dbSNP
rs906064492 197 dbSNP
rs1450806529 200 dbSNP
rs753859336 204 dbSNP
rs1220912688 206 dbSNP
rs140121590 211 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
138 hsa-miR-412-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005780 ACVR1C activin A receptor type 1C 1 1
MIRT062013 YOD1 YOD1 deubiquitinase 2 2
MIRT345112 ATXN7L3 ataxin 7 like 3 2 2
MIRT383735 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT396956 CELF1 CUGBP Elav-like family member 1 2 2
MIRT439280 XIAP X-linked inhibitor of apoptosis 1 1
MIRT439313 VAT1 vesicle amine transport 1 1 1
MIRT439375 TUBA1A tubulin alpha 1a 1 1
MIRT439418 TMOD1 tropomodulin 1 1 1
MIRT439503 SURF4 surfeit 4 1 1
MIRT439563 SON SON DNA binding protein 1 1
MIRT439598 SLC3A2 solute carrier family 3 member 2 1 1
MIRT439670 SETD1B SET domain containing 1B 1 1
MIRT439767 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT439922 PPL periplakin 1 1
MIRT439947 PLEKHA6 pleckstrin homology domain containing A6 1 1
MIRT439952 PLCB4 phospholipase C beta 4 1 1
MIRT439961 PKD1 polycystin 1, transient receptor potential channel interacting 1 1
MIRT440005 PEG3 paternally expressed 3 1 1
MIRT440061 OSBPL8 oxysterol binding protein like 8 1 1
MIRT440166 MYH14 myosin heavy chain 14 1 1
MIRT440276 MAPK8IP1 mitogen-activated protein kinase 8 interacting protein 1 1 1
MIRT440437 IPO13 importin 13 1 1
MIRT440441 INTS3 integrator complex subunit 3 1 1
MIRT440448 INS insulin 1 1
MIRT440461 IGF2R insulin like growth factor 2 receptor 1 1
MIRT440472 IARS isoleucyl-tRNA synthetase 1 1
MIRT440530 GUCY1A3 guanylate cyclase 1 soluble subunit alpha 1 1
MIRT440542 GOLGA2 golgin A2 1 1
MIRT440569 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT440608 FTSJD2 cap methyltransferase 1 1 1
MIRT440750 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT440781 DOT1L DOT1 like histone lysine methyltransferase 1 1
MIRT440804 DNAJA4 DnaJ heat shock protein family (Hsp40) member A4 1 1
MIRT440867 CSDE1 cold shock domain containing E1 1 1
MIRT440890 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT440917 COL1A1 collagen type I alpha 1 chain 1 1
MIRT440967 CDH22 cadherin 22 1 1
MIRT440968 CDH2 cadherin 2 1 1
MIRT441024 CALR calreticulin 1 1
MIRT441278 ACTB actin beta 1 1
MIRT448421 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT462833 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT465062 TSR1 TSR1, ribosome maturation factor 2 2
MIRT476050 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT485318 MZT1 mitotic spindle organizing protein 1 2 4
MIRT493584 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 6
MIRT494567 BAK1 BCL2 antagonist/killer 1 2 2
MIRT497393 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT503250 ZNF257 zinc finger protein 257 2 10
MIRT503656 ZNF138 zinc finger protein 138 2 10
MIRT505882 RNF219 ring finger protein 219 2 2
MIRT507525 DSTN destrin, actin depolymerizing factor 2 4
MIRT510663 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT514682 ZNF701 zinc finger protein 701 2 4
MIRT515370 ZNF208 zinc finger protein 208 2 6
MIRT525237 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 2
MIRT527963 MTAP methylthioadenosine phosphorylase 2 2
MIRT528482 STAMBPL1 STAM binding protein like 1 2 2
MIRT529909 C1orf64 steroid receptor associated and regulated protein 2 4
MIRT531558 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT532234 KLF2 Kruppel like factor 2 2 4
MIRT532480 HOXA13 homeobox A13 2 2
MIRT535544 P2RY2 purinergic receptor P2Y2 2 2
MIRT547311 NR1D2 nuclear receptor subfamily 1 group D member 2 2 2
MIRT551795 ZNF117 zinc finger protein 117 2 4
MIRT554939 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT558171 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT568771 LY6K lymphocyte antigen 6 family member K 2 2
MIRT570766 ZNF99 zinc finger protein 99 2 2
MIRT572405 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT573396 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT610403 RXRB retinoid X receptor beta 2 2
MIRT610886 SCN8A sodium voltage-gated channel alpha subunit 8 2 2
MIRT611197 TMEM105 transmembrane protein 105 2 2
MIRT611244 ZNF550 zinc finger protein 550 2 2
MIRT615669 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 4
MIRT617974 DOCK4 dedicator of cytokinesis 4 2 2
MIRT619150 ZNF326 zinc finger protein 326 2 2
MIRT619608 MKKS McKusick-Kaufman syndrome 2 2
MIRT621053 DGKD diacylglycerol kinase delta 2 2
MIRT623665 HRK harakiri, BCL2 interacting protein 2 2
MIRT624883 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT624939 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT634198 TMOD2 tropomodulin 2 2 4
MIRT636727 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT637741 POLR3K RNA polymerase III subunit K 2 2
MIRT638002 ZC3H13 zinc finger CCCH-type containing 13 2 2
MIRT640395 ZNF785 zinc finger protein 785 2 2
MIRT640505 ANTXR1 anthrax toxin receptor 1 2 2
MIRT641293 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT641863 STOML1 stomatin like 1 2 2
MIRT642600 C14orf180 chromosome 14 open reading frame 180 2 2
MIRT642895 CASP1 caspase 1 2 2
MIRT643967 FHL2 four and a half LIM domains 2 2 4
MIRT645237 KCTD12 potassium channel tetramerization domain containing 12 2 2
MIRT646621 CENPL centromere protein L 2 2
MIRT648620 CYB561A3 cytochrome b561 family member A3 2 2
MIRT648908 ZNF551 zinc finger protein 551 2 2
MIRT649439 HIBADH 3-hydroxyisobutyrate dehydrogenase 2 2
MIRT650637 LTF lactotransferrin 2 2
MIRT650971 STARD3NL STARD3 N-terminal like 2 2
MIRT651067 ZNF518B zinc finger protein 518B 2 4
MIRT652384 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT653958 SEPN1 selenoprotein N 2 2
MIRT656885 KIF1C kinesin family member 1C 2 2
MIRT657965 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658080 FOXR2 forkhead box R2 2 2
MIRT662570 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT663089 METTL10 EEF1A lysine methyltransferase 2 2 2
MIRT683705 ZNF195 zinc finger protein 195 2 2
MIRT683835 ZNF682 zinc finger protein 682 2 2
MIRT706811 APOL4 apolipoprotein L4 2 2
MIRT707575 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT708606 ZNF260 zinc finger protein 260 2 2
MIRT708859 TMSB4X thymosin beta 4, X-linked 2 2
MIRT709861 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT709987 RBM41 RNA binding motif protein 41 2 2
MIRT710098 KPNA5 karyopherin subunit alpha 5 2 2
MIRT710211 ENAH ENAH, actin regulator 2 2
MIRT710868 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT710986 SUSD5 sushi domain containing 5 2 2
MIRT711460 RNF145 ring finger protein 145 2 2
MIRT712302 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT713609 SYTL4 synaptotagmin like 4 2 2
MIRT713789 MAK16 MAK16 homolog 2 2
MIRT715480 MYO9B myosin IXB 2 2
MIRT716328 POU5F1 POU class 5 homeobox 1 2 2
MIRT717252 TMEM246 transmembrane protein 246 2 2
MIRT718077 CLIC5 chloride intracellular channel 5 2 2
MIRT718463 EED embryonic ectoderm development 2 2
MIRT718645 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT718982 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT721078 RPS9 ribosomal protein S9 2 2
MIRT721419 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT721863 CENPJ centromere protein J 2 2
MIRT722492 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT723391 CALN1 calneuron 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-412 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-412 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-412 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-412 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-412-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved sensitive High Anaplastic Thyroid Cancer tissue
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-412-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-412-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-412-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-412-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission