pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol TNPO3   
Synonyms IPO12, LGMD1F, MTR10A, TRN-SR, TRN-SR2, TRNSR
Description transportin 3
Transcript NM_012470   
Expression
Putative miRNA Targets on TNPO3
3'UTR of TNPO3
(miRNA target sites are highlighted)
>TNPO3|NM_012470|3'UTR
   1 CTCACACTCCTGCACTGTGCCTGTCACCCAGGAATGTCTTTTTTAATTAGAAGACAGGAAGAAAACAAAAACCAGACTGT
  81 GTCCCACAATCAGAAACCTCCGTTGTGGCAGAGGGGCCTTCACCGCCACCAGGGTGTCCCGCCAGACAGGGAGAGACTCC
 161 AGCCTTCTGAGGCCATCCTGAGGAGTTCCTGTTTGGGGGTGTGAGGGAAAATCAGCGCGGATTTTAAAAAGATGGCTGTG
 241 GCCTGCCCGGCGTGGTGGGAGGGGAGCTGGTTTCCTGGTGAACTTTCTAAAAGGAAAAATAATTTTAAGTAAAGAAAAAA
 321 GAAAAAAAAGGAAGACTAAACAGAAACCAGAACTGAAACATTCACCTGGTAGCAAATGACACATGCACGCACACACACAT
 401 ACACGCACAAGCGCCAGTGCGCACGTGTACACAGAAAAACAAAAGGACAAGCTTTCTGTGAAACAAAATATTTACTTAGG
 481 GATAATGTGGGGATTCACATGAATTAAATAGCTGCAATTGGAAGAAGAGGGTCAGGGTCATTTGTTCAGGTTTTCTATTG
 561 TTTTGTCCTCTCTTTCCTCTCCTACCCTTCCTTCTCTTTCTCTCTCCCCTCCTTTTAAATGCAAATGAGTAGAAATTTCT
 641 TCTACCTTCCCCAGCTGTTTCTTCCCACCTTTAGAGTTGTTTAGACAAGGAGGAGTAAGCAAGGAACTTGTTCTGCTTTC
 721 TATCGTGGTCACATTGGTGATGCTCGGGACCTGCCAGGGTCAGAATTTATGGATATCTGAACCCTGACCCCGTTCATTCT
 801 CTCAGTCCACTTCCAATCCACATCAGTTTGTTGTCTGCCTTGGAGAGAAGAGCCAAAACTGGGGTGGGCGGGTGGGTGGG
 881 GAGTGCAGGATATAAATGTGTAAGTTTTTGTTTTTTAAGGTTTTTTTCTTAGTGAATTATTCACCCACAGACATGAGAGA
 961 AAAAAAGAGGGAGGGTGTGTGGAGAAAAAATGTTTACAGGGCTAACAAGGGATGATGTGTCATTTAGTATGTTACTAAAA
1041 AGTGTGGAAATGACTTGATTTTAAGGGGAGGGTGAGGCCGAAGAGGGAAGCCCAAAGCAGATCTTAATGTTTCAAAGGAG
1121 TGCAGCCCTTCACAGCCATCAGATATGAGGGCACTGTTCTGTCTGGTGTTGTAGCCATCTCAAGAACAAATCAACAGCAA
1201 CAAAAGAGAAAGAATAAATTTTTAAAATTTAACCAGTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUCGGCGACAGU----GUGCGUGUc 5'
            |||   || ||    |||||||| 
Target 5' gtAGCAAATGACACATGCACGCACAc 3'
369 - 394 154.00 -19.82
2
miRNA  3' agucggcgacaGUGUGCGUGUC------ 5'
                     :|||||||||       
Target 5' gcacacacacaTACACGCACAAGCGCCA 3'
389 - 416 133.00 -15.00
3
miRNA  3' agucggcgacAGU--GUGCGUGUc 5'
                    |:|  ||| |||| 
Target 5' tcttagtgaaTTATTCACCCACAg 3'
927 - 950 114.00 -11.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30506435 5 COSMIC
COSN30455928 15 COSMIC
COSN20061526 53 COSMIC
COSN7653521 423 COSMIC
COSN26815737 668 COSMIC
COSN14954734 814 COSMIC
COSN22440580 888 COSMIC
COSN9828585 1477 COSMIC
COSN15714111 1582 COSMIC
COSN5647648 1752 COSMIC
COSN24383639 1757 COSMIC
COSN20054883 1790 COSMIC
COSN27742481 1910 COSMIC
COSN30744867 1914 COSMIC
COSN1342400 1953 COSMIC
COSN30540368 1965 COSMIC
COSN1342399 2079 COSMIC
COSN26584280 2159 COSMIC
COSN31537499 2159 COSMIC
COSN28671784 2160 COSMIC
COSN26572097 2168 COSMIC
COSN31486394 2180 COSMIC
COSN30157917 2185 COSMIC
COSN26580845 2223 COSMIC
COSN26569065 2227 COSMIC
COSN31540906 2258 COSMIC
COSN31541662 2326 COSMIC
COSN45517 2449 COSMIC
COSN1342397 2510 COSMIC
COSN7959597 2629 COSMIC
rs12539741 504 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200504407 5 dbSNP
rs367588781 7 dbSNP
rs768556713 8 dbSNP
rs761344005 10 dbSNP
rs1436793563 11 dbSNP
rs762673457 13 dbSNP
rs775433249 17 dbSNP
rs1381148844 21 dbSNP
rs374925221 22 dbSNP
rs1160351145 23 dbSNP
rs745334283 27 dbSNP
rs1034374944 32 dbSNP
rs370478881 34 dbSNP
rs774182472 38 dbSNP
rs1002852004 42 dbSNP
rs776168652 49 dbSNP
rs768376563 51 dbSNP
rs1264745904 53 dbSNP
rs1461756172 61 dbSNP
rs751792927 62 dbSNP
rs1236214545 64 dbSNP
rs1299707021 65 dbSNP
rs1481673947 69 dbSNP
rs1046777996 72 dbSNP
rs1266992870 75 dbSNP
rs906132049 84 dbSNP
rs1023142811 88 dbSNP
rs993425247 96 dbSNP
rs897694639 111 dbSNP
rs1014853030 114 dbSNP
rs896008703 117 dbSNP
rs1465371070 124 dbSNP
rs1464351785 125 dbSNP
rs1037545164 126 dbSNP
rs1048349086 132 dbSNP
rs570925545 133 dbSNP
rs1481340030 143 dbSNP
rs1402702838 146 dbSNP
rs573289850 153 dbSNP
rs1050160507 156 dbSNP
rs777702255 157 dbSNP
rs62478578 159 dbSNP
rs899244626 174 dbSNP
rs1217723835 177 dbSNP
rs1270839637 178 dbSNP
rs1309157401 185 dbSNP
rs933017385 187 dbSNP
rs754034901 190 dbSNP
rs1037709472 195 dbSNP
rs62478577 196 dbSNP
rs967664151 198 dbSNP
rs1257105959 214 dbSNP
rs943318182 217 dbSNP
rs910485479 219 dbSNP
rs1477712159 220 dbSNP
rs1191905953 225 dbSNP
rs1422322474 227 dbSNP
rs73463007 233 dbSNP
rs1170602033 237 dbSNP
rs537302124 239 dbSNP
rs753924828 240 dbSNP
rs1304591245 250 dbSNP
rs990297662 257 dbSNP
rs958844944 259 dbSNP
rs555303259 280 dbSNP
rs913765080 288 dbSNP
rs988373991 298 dbSNP
rs957853778 302 dbSNP
rs1357388790 309 dbSNP
rs1224753502 318 dbSNP
rs924997374 319 dbSNP
rs766545436 321 dbSNP
rs1214154260 322 dbSNP
rs570317487 322 dbSNP
rs1199170459 324 dbSNP
rs980415205 332 dbSNP
rs1025643701 333 dbSNP
rs1412182440 334 dbSNP
rs1442259325 336 dbSNP
rs1164907568 338 dbSNP
rs368444745 346 dbSNP
rs1365865667 348 dbSNP
rs969001276 351 dbSNP
rs1024576874 356 dbSNP
rs540615285 357 dbSNP
rs79016461 360 dbSNP
rs529617354 371 dbSNP
rs1026522179 374 dbSNP
rs575306404 380 dbSNP
rs1248314323 384 dbSNP
rs77154763 385 dbSNP
rs1006088591 392 dbSNP
rs1222276279 394 dbSNP
rs1037761567 395 dbSNP
rs1350800179 405 dbSNP
rs1447950146 408 dbSNP
rs1308676431 411 dbSNP
rs1393873802 413 dbSNP
rs1378175969 416 dbSNP
rs1303174940 421 dbSNP
rs767692211 423 dbSNP
rs1385311206 433 dbSNP
rs553742576 441 dbSNP
rs534095390 443 dbSNP
rs1386334802 446 dbSNP
rs1409643022 452 dbSNP
rs1401108123 466 dbSNP
rs933089821 468 dbSNP
rs1403879701 469 dbSNP
rs889146130 471 dbSNP
rs17166339 472 dbSNP
rs1236896044 480 dbSNP
rs1041395983 482 dbSNP
rs1351619376 487 dbSNP
rs1219062858 489 dbSNP
rs1261650272 491 dbSNP
rs1326366288 492 dbSNP
rs564882023 493 dbSNP
rs1204872959 494 dbSNP
rs1238043146 498 dbSNP
rs12539741 504 dbSNP
rs914850826 510 dbSNP
rs769101960 522 dbSNP
rs1470295399 525 dbSNP
rs1175512979 529 dbSNP
rs1426935473 530 dbSNP
rs1052281058 533 dbSNP
rs936476876 545 dbSNP
rs1177081780 546 dbSNP
rs368756102 547 dbSNP
rs1330954833 551 dbSNP
rs925051181 558 dbSNP
rs1336639862 563 dbSNP
rs1436025602 564 dbSNP
rs1347796887 575 dbSNP
rs749798845 575 dbSNP
rs1224454428 576 dbSNP
rs113844426 577 dbSNP
rs1337981798 580 dbSNP
rs561152570 596 dbSNP
rs138060966 600 dbSNP
rs776013244 603 dbSNP
rs992231978 604 dbSNP
rs972775613 610 dbSNP
rs960322178 611 dbSNP
rs1199822940 619 dbSNP
rs1026949778 625 dbSNP
rs993693833 632 dbSNP
rs963516936 635 dbSNP
rs769285911 636 dbSNP
rs537686705 639 dbSNP
rs1397312023 649 dbSNP
rs574858895 673 dbSNP
rs568591859 677 dbSNP
rs1347576421 680 dbSNP
rs962683039 680 dbSNP
rs1277939915 681 dbSNP
rs1329249707 685 dbSNP
rs1016423303 687 dbSNP
rs1230254408 690 dbSNP
rs1007678938 695 dbSNP
rs1006142361 696 dbSNP
rs889198303 697 dbSNP
rs1221020868 700 dbSNP
rs1289179783 703 dbSNP
rs1490728279 713 dbSNP
rs1223008738 714 dbSNP
rs1051814158 715 dbSNP
rs150351655 720 dbSNP
rs1195258242 722 dbSNP
rs1373525854 732 dbSNP
rs541128193 733 dbSNP
rs1444119163 742 dbSNP
rs1161716449 745 dbSNP
rs1367743340 749 dbSNP
rs888998457 750 dbSNP
rs1313224232 751 dbSNP
rs1383264570 755 dbSNP
rs997889216 761 dbSNP
rs1384217460 762 dbSNP
rs892394523 765 dbSNP
rs1319579286 767 dbSNP
rs1340348164 768 dbSNP
rs1454348985 769 dbSNP
rs140285449 781 dbSNP
rs1363034492 782 dbSNP
rs558833694 784 dbSNP
rs1246269533 797 dbSNP
rs1484785736 800 dbSNP
rs997730500 801 dbSNP
rs1262393980 802 dbSNP
rs745424766 803 dbSNP
rs936571765 806 dbSNP
rs867141439 809 dbSNP
rs1387243201 810 dbSNP
rs1445241675 813 dbSNP
rs1161482335 822 dbSNP
rs1044868225 831 dbSNP
rs1362225684 836 dbSNP
rs1455700020 860 dbSNP
rs901612033 873 dbSNP
rs866480234 880 dbSNP
rs780836348 884 dbSNP
rs1451074787 885 dbSNP
rs151285979 894 dbSNP
rs1339194439 895 dbSNP
rs1384387031 900 dbSNP
rs372680752 908 dbSNP
rs991847442 918 dbSNP
rs1314732454 920 dbSNP
rs1240983445 927 dbSNP
rs569942550 931 dbSNP
rs1322816850 936 dbSNP
rs929603356 949 dbSNP
rs1201694444 955 dbSNP
rs1165932903 968 dbSNP
rs144697993 970 dbSNP
rs1461844428 976 dbSNP
rs1389876691 980 dbSNP
rs536560869 984 dbSNP
rs1421080542 987 dbSNP
rs1189777767 992 dbSNP
rs1160358816 1011 dbSNP
rs972333101 1013 dbSNP
rs963611424 1016 dbSNP
rs1468514952 1017 dbSNP
rs892795028 1028 dbSNP
rs1407431614 1033 dbSNP
rs750428631 1040 dbSNP
rs1263249969 1043 dbSNP
rs1466141124 1043 dbSNP
rs142365008 1044 dbSNP
rs986298615 1054 dbSNP
rs937595268 1058 dbSNP
rs1292045592 1075 dbSNP
rs953447611 1081 dbSNP
rs1030801122 1089 dbSNP
rs981646542 1095 dbSNP
rs1221410138 1105 dbSNP
rs997542156 1106 dbSNP
rs538216233 1119 dbSNP
rs746782100 1121 dbSNP
rs532056216 1134 dbSNP
rs1030986578 1137 dbSNP
rs1249672842 1137 dbSNP
rs1000771421 1146 dbSNP
rs1268391418 1157 dbSNP
rs1479681199 1159 dbSNP
rs973221456 1166 dbSNP
rs1430675232 1173 dbSNP
rs1321709227 1193 dbSNP
rs1386276453 1196 dbSNP
rs571308882 1201 dbSNP
rs903776338 1202 dbSNP
rs962745027 1208 dbSNP
rs1352262891 1211 dbSNP
rs147671331 1212 dbSNP
rs947855981 1230 dbSNP
rs369597580 1238 dbSNP
rs376332110 1243 dbSNP
rs1389979597 1275 dbSNP
rs777737270 1280 dbSNP
rs1368286156 1282 dbSNP
rs192443779 1284 dbSNP
rs1293286956 1289 dbSNP
rs561088594 1296 dbSNP
rs1205914321 1303 dbSNP
rs1376397738 1318 dbSNP
rs1291372729 1319 dbSNP
rs542909014 1320 dbSNP
rs1432083064 1326 dbSNP
rs901661524 1329 dbSNP
rs1270048201 1331 dbSNP
rs145325448 1338 dbSNP
rs752650512 1340 dbSNP
rs1185298843 1350 dbSNP
rs1422208666 1354 dbSNP
rs1009937503 1355 dbSNP
rs892845612 1355 dbSNP
rs1054054145 1357 dbSNP
rs530419469 1358 dbSNP
rs1350255016 1364 dbSNP
rs370213417 1364 dbSNP
rs1273705998 1375 dbSNP
rs1046385622 1381 dbSNP
rs1287080441 1390 dbSNP
rs559738823 1393 dbSNP
rs1363957371 1402 dbSNP
rs1196124987 1409 dbSNP
rs1229293824 1411 dbSNP
rs942301098 1413 dbSNP
rs10275092 1417 dbSNP
rs1272985431 1418 dbSNP
rs568151572 1423 dbSNP
rs1446807384 1424 dbSNP
rs918748798 1428 dbSNP
rs1346234752 1433 dbSNP
rs1285225129 1437 dbSNP
rs953645714 1438 dbSNP
rs1030479068 1441 dbSNP
rs976601220 1442 dbSNP
rs956804274 1446 dbSNP
rs1031000587 1448 dbSNP
rs71581944 1452 dbSNP
rs1165110983 1467 dbSNP
rs1161549656 1472 dbSNP
rs985478765 1476 dbSNP
rs1346954143 1477 dbSNP
rs1435721816 1479 dbSNP
rs1400768252 1480 dbSNP
rs1335929320 1485 dbSNP
rs1380695408 1488 dbSNP
rs1454600574 1495 dbSNP
rs1285036023 1497 dbSNP
rs954011073 1499 dbSNP
rs921902104 1500 dbSNP
rs1222472278 1507 dbSNP
rs1466947442 1512 dbSNP
rs1000781324 1515 dbSNP
rs967946620 1517 dbSNP
rs577200572 1520 dbSNP
rs1203586838 1523 dbSNP
rs1429420626 1526 dbSNP
rs1023478785 1527 dbSNP
rs1012053116 1532 dbSNP
rs896334889 1535 dbSNP
rs1237748309 1542 dbSNP
rs1469300467 1546 dbSNP
rs1175333280 1555 dbSNP
rs1409896226 1560 dbSNP
rs1457523523 1565 dbSNP
rs1175641736 1577 dbSNP
rs1056287619 1603 dbSNP
rs1250116423 1606 dbSNP
rs994359104 1611 dbSNP
rs976394850 1612 dbSNP
rs558986761 1616 dbSNP
rs1250604596 1633 dbSNP
rs1335454854 1639 dbSNP
rs1440280565 1653 dbSNP
rs543571939 1661 dbSNP
rs1351500273 1665 dbSNP
rs1223242389 1666 dbSNP
rs1182324559 1673 dbSNP
rs1038047282 1680 dbSNP
rs940974057 1690 dbSNP
rs909480898 1691 dbSNP
rs756207867 1694 dbSNP
rs11761242 1703 dbSNP
rs1265133963 1711 dbSNP
rs10271573 1712 dbSNP
rs1253468220 1724 dbSNP
rs3210221 1731 dbSNP
rs1472812766 1735 dbSNP
rs3210222 1735 dbSNP
rs1350175053 1742 dbSNP
rs1427173585 1745 dbSNP
rs536500609 1749 dbSNP
rs976273332 1752 dbSNP
rs1339086978 1758 dbSNP
rs761962895 1770 dbSNP
rs751856857 1775 dbSNP
rs551130488 1788 dbSNP
rs1404778623 1800 dbSNP
rs1408895339 1819 dbSNP
rs1281761016 1821 dbSNP
rs1371489366 1825 dbSNP
rs1234611411 1826 dbSNP
rs531148935 1828 dbSNP
rs748873920 1833 dbSNP
rs979414402 1836 dbSNP
rs967998362 1845 dbSNP
rs1266040818 1849 dbSNP
rs1023573801 1853 dbSNP
rs1266498243 1856 dbSNP
rs1485609768 1856 dbSNP
rs1263627473 1858 dbSNP
rs1279791769 1864 dbSNP
rs76933194 1865 dbSNP
rs1012607485 1866 dbSNP
rs1346757798 1873 dbSNP
rs1046022026 1879 dbSNP
rs1268041577 1880 dbSNP
rs1226110622 1882 dbSNP
rs1340572144 1885 dbSNP
rs763371259 1886 dbSNP
rs1412888216 1889 dbSNP
rs1374699759 1894 dbSNP
rs960649870 1903 dbSNP
rs1415944838 1910 dbSNP
rs1394659747 1911 dbSNP
rs1035306152 1912 dbSNP
rs566028883 1915 dbSNP
rs1318284728 1917 dbSNP
rs1325166245 1922 dbSNP
rs1478244502 1927 dbSNP
rs1425915736 1930 dbSNP
rs993978282 1932 dbSNP
rs896917757 1939 dbSNP
rs1244792031 1940 dbSNP
rs1186549802 1947 dbSNP
rs1014924817 1957 dbSNP
rs1358227087 1962 dbSNP
rs1462738644 1963 dbSNP
rs775960188 1964 dbSNP
rs1244891661 1971 dbSNP
rs554207987 1972 dbSNP
rs565344564 1976 dbSNP
rs1328601623 1978 dbSNP
rs1284968771 1979 dbSNP
rs763650865 1986 dbSNP
rs1225719719 1988 dbSNP
rs1005285521 1995 dbSNP
rs1354453663 1997 dbSNP
rs1458770647 2009 dbSNP
rs1158328563 2015 dbSNP
rs941487952 2026 dbSNP
rs889482457 2032 dbSNP
rs1321727884 2033 dbSNP
rs571184947 2033 dbSNP
rs1451213944 2034 dbSNP
rs1312499976 2037 dbSNP
rs1341872588 2042 dbSNP
rs909994178 2042 dbSNP
rs1259928310 2043 dbSNP
rs1049829155 2049 dbSNP
rs1049414206 2054 dbSNP
rs549820076 2055 dbSNP
rs932262971 2056 dbSNP
rs531323756 2057 dbSNP
rs1258587936 2058 dbSNP
rs1424597802 2068 dbSNP
rs1181620277 2076 dbSNP
rs1362423501 2077 dbSNP
rs1319141166 2079 dbSNP
rs976739367 2081 dbSNP
rs762747776 2086 dbSNP
rs1468869062 2087 dbSNP
rs1040949899 2089 dbSNP
rs935484323 2090 dbSNP
rs988622652 2094 dbSNP
rs1348429864 2102 dbSNP
rs1229961239 2106 dbSNP
rs957183144 2114 dbSNP
rs1322699786 2138 dbSNP
rs1318349747 2143 dbSNP
rs1048805 2152 dbSNP
rs924046629 2153 dbSNP
rs969381359 2158 dbSNP
rs1411143845 2159 dbSNP
rs3847098 2160 dbSNP
rs1257825327 2162 dbSNP
rs1001230802 2168 dbSNP
rs1483578689 2168 dbSNP
rs969795483 2168 dbSNP
rs1024399883 2179 dbSNP
rs1183307348 2186 dbSNP
rs1386799857 2192 dbSNP
rs1479741499 2193 dbSNP
rs1178788659 2213 dbSNP
rs367595797 2221 dbSNP
rs1013893849 2226 dbSNP
rs897418561 2227 dbSNP
rs1297286943 2229 dbSNP
rs1242801135 2230 dbSNP
rs968092765 2238 dbSNP
rs1411486478 2239 dbSNP
rs1308393321 2240 dbSNP
rs1005754642 2242 dbSNP
rs756243825 2242 dbSNP
rs776039023 2243 dbSNP
rs1450153064 2250 dbSNP
rs148588258 2251 dbSNP
rs990835229 2252 dbSNP
rs1484145335 2258 dbSNP
rs770573020 2259 dbSNP
rs1362041210 2262 dbSNP
rs746623761 2263 dbSNP
rs972994162 2265 dbSNP
rs1426443939 2275 dbSNP
rs1041453944 2293 dbSNP
rs1295805625 2294 dbSNP
rs1228340563 2296 dbSNP
rs961221859 2316 dbSNP
rs528444706 2322 dbSNP
rs1431246658 2323 dbSNP
rs527532619 2324 dbSNP
rs945373318 2332 dbSNP
rs1005338007 2355 dbSNP
rs913174641 2356 dbSNP
rs988675005 2369 dbSNP
rs1381769501 2378 dbSNP
rs889535877 2382 dbSNP
rs935870378 2385 dbSNP
rs1344327838 2388 dbSNP
rs1229429742 2403 dbSNP
rs1291251141 2407 dbSNP
rs1320330404 2408 dbSNP
rs1347818023 2412 dbSNP
rs1224202054 2415 dbSNP
rs925792786 2421 dbSNP
rs560463885 2424 dbSNP
rs1485821127 2433 dbSNP
rs1185494720 2436 dbSNP
rs1245668502 2436 dbSNP
rs1450726554 2438 dbSNP
rs76327516 2440 dbSNP
rs1403436497 2446 dbSNP
rs1166621112 2447 dbSNP
rs1350455407 2455 dbSNP
rs1424830545 2473 dbSNP
rs1318394880 2477 dbSNP
rs902106254 2480 dbSNP
rs1367470404 2487 dbSNP
rs1367250820 2491 dbSNP
rs1024034228 2492 dbSNP
rs992929426 2494 dbSNP
rs1166433794 2503 dbSNP
rs1448845861 2504 dbSNP
rs1040606760 2508 dbSNP
rs1420109878 2516 dbSNP
rs532508222 2522 dbSNP
rs1291035040 2523 dbSNP
rs565147803 2525 dbSNP
rs1207400035 2528 dbSNP
rs1270519204 2533 dbSNP
rs902718461 2545 dbSNP
rs1188607717 2550 dbSNP
rs1236585981 2553 dbSNP
rs1043866253 2557 dbSNP
rs1015889130 2560 dbSNP
rs946843445 2562 dbSNP
rs186223553 2583 dbSNP
rs2280714 2584 dbSNP
rs1490887414 2594 dbSNP
rs939340778 2602 dbSNP
rs1272995150 2611 dbSNP
rs1028502766 2612 dbSNP
rs927891748 2621 dbSNP
rs1204846966 2624 dbSNP
rs771990103 2629 dbSNP
rs1450467151 2630 dbSNP
rs542693882 2630 dbSNP
rs1016814909 2635 dbSNP
rs983914829 2637 dbSNP
rs1217921962 2646 dbSNP
rs778938425 2651 dbSNP
rs552411679 2654 dbSNP
rs1277289148 2660 dbSNP
rs1440140198 2668 dbSNP
rs1053004080 2671 dbSNP
rs1405206180 2675 dbSNP
rs935929152 2677 dbSNP
rs925845084 2689 dbSNP
rs1306001307 2698 dbSNP
rs1414173579 2699 dbSNP
rs1461280774 2699 dbSNP
rs1354837201 2700 dbSNP
rs1175539963 2702 dbSNP
rs1028173566 2703 dbSNP
rs1028042527 2705 dbSNP
rs1001516303 2707 dbSNP
rs948563114 2708 dbSNP
rs905868767 2711 dbSNP
rs1428709515 2712 dbSNP
rs1200204584 2714 dbSNP
rs1044952770 2715 dbSNP
rs1481564781 2717 dbSNP
rs1249883724 2718 dbSNP
rs1351717097 2719 dbSNP
rs1290468867 2720 dbSNP
rs1223456561 2729 dbSNP
rs1181984744 2735 dbSNP
rs1481172636 2736 dbSNP
rs1278958854 2738 dbSNP
rs1253380814 2739 dbSNP
rs917018007 2746 dbSNP
rs992584535 2755 dbSNP
rs1312075701 2758 dbSNP
rs900859877 2759 dbSNP
rs1015269087 2766 dbSNP
rs1375817061 2770 dbSNP
rs754902210 2773 dbSNP
rs1223563388 2774 dbSNP
rs1389845987 2783 dbSNP
rs745911207 2786 dbSNP
rs1428058590 2790 dbSNP
rs983752857 2798 dbSNP
rs35440082 2805 dbSNP
rs1371584349 2810 dbSNP
rs1404679081 2813 dbSNP
rs1347082987 2815 dbSNP
rs1333313710 2818 dbSNP
rs999767478 2827 dbSNP
rs902772145 2828 dbSNP
rs1286081208 2838 dbSNP
rs1274927899 2846 dbSNP
rs1390388605 2847 dbSNP
rs1225747000 2853 dbSNP
rs1276269331 2867 dbSNP
rs1342646910 2872 dbSNP
rs781109544 2875 dbSNP
rs1043877282 2877 dbSNP
rs1265241656 2879 dbSNP
rs1373822152 2910 dbSNP
rs952951306 2912 dbSNP
rs946853627 2914 dbSNP
rs895236454 2917 dbSNP
rs1055194015 2918 dbSNP
rs1445795546 2927 dbSNP
rs997446434 2929 dbSNP
rs1405225527 2938 dbSNP
rs939415937 2940 dbSNP
rs1457762725 2953 dbSNP
rs1177324963 2958 dbSNP
rs1470990157 2969 dbSNP
rs1161817458 2976 dbSNP
rs1409776790 3005 dbSNP
rs144835455 3007 dbSNP
rs1320405914 3013 dbSNP
rs1419854563 3020 dbSNP
rs973139666 3047 dbSNP
rs1253134801 3061 dbSNP
rs1432210346 3062 dbSNP
rs1299410640 3066 dbSNP
rs1365440396 3070 dbSNP
rs1243866322 3071 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.384 0 0.180 0.11 50 Click to see details
LIHC 0.341 0.01 0.275 0.03 49 Click to see details
STAD 0.404 0.01 0.360 0.02 32 Click to see details
CHOL 0.666 0.03 0.750 0.01 9 Click to see details
UCEC 0.454 0.03 0.547 0.01 19 Click to see details
ESCA 0.536 0.04 0.545 0.04 11 Click to see details
BLCA -0.402 0.05 -0.428 0.04 18 Click to see details
KIRC -0.168 0.09 -0.062 0.31 68 Click to see details
KICH -0.257 0.11 -0.329 0.05 25 Click to see details
LUAD 0.229 0.24 0.182 0.29 12 Click to see details
LUSC 0.078 0.32 0.102 0.27 38 Click to see details
KIRP -0.076 0.34 -0.110 0.27 32 Click to see details
HNSC 0.065 0.34 0.139 0.19 42 Click to see details
CESC -0.449 0.35 -0.500 0.33 3 Click to see details
THCA 0.048 0.36 0.107 0.21 59 Click to see details
BRCA -0.035 0.38 -0.009 0.47 84 Click to see details
PCPG -0.321 0.4 0.500 0.33 3 Click to see details
COAD 0.048 0.46 -0.048 0.46 8 Click to see details
PAAD -0.045 0.48 -0.200 0.4 4 Click to see details
PAAD -0.045 0.48 -0.200 0.4 4 Click to see details
PAAD -0.045 0.48 -0.200 0.4 4 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission