miRTarBase - #MIRT439494


—
pre-miRNA Information
pre-miRNA hsa-mir-382   
Genomic Coordinates chr14: 101054306 - 101054381
Synonyms MIRN382, hsa-mir-382, MIR382
Description Homo sapiens miR-382 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-382-5p
Sequence 11| GAAGUUGUUCGUGGUGGAUUCG |32
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs192719529 5 dbSNP
rs764920693 10 dbSNP
rs752396166 11 dbSNP
rs762649016 21 dbSNP
rs764006384 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SYT13   
Synonyms -
Description synaptotagmin 13
Transcript NM_020826   
Expression
Putative miRNA Targets on SYT13
3'UTR of SYT13
(miRNA target sites are highlighted)		 
>SYT13|NM_020826|3'UTR
   1 CCAGCTGCCCAGCTGCCTCCCTTCTTGGACAGCCCTGACCCGTCCTCTGCAACCTCCTTTCTGTGCCCCTTTCCTCATTC
  81 TGACACCCAGAAGACAGTGACAGATGTGTTTGCAAGGCTGGGATGGCTCTCTCATCATACTCTTGTTTCTTAGAAATAAG
 161 CAAGACAGAGCAGGAAATGGAATATGCGGGTCACACTGAGGAATGCATTTTGCTCATCTGTGTTATTGAAGGAGGTGCTT
 241 ATTAAATACAGTTCCTATGCCTGTTTTATAGGTGGGGTTAGGCCAGATGCAGAGAAAGCTAAATGTGGGAATCATGGATG
 321 CAAAGAAGAATTTGGCTTTTTGAAAAACAAGCATTTCAAAAATGATGAAGGAAGTGAAAGTATCCTGGATCAACTCCTAG
 401 AGTTAGAGATTGCCCAGGTGGAAAGAAACCTTAGCCAGCGTTCAATCAAGCTCACCATGCAGGGCAGTCACCCGGCAGTT
 481 CTCAAACTTTAGCATGTGAAGAGTCACCAGCAGATTCCTGGGCTCGCCTGGAGACATTCCTAGTCGGTATTCCTGGTCGA
 561 AGCCCAGGAGCCTTCCTTTTTAACAAGCTGATGTAGAGGGTGGAGCACTGTATGTGGAGAAATTCCTTCTACAATATTCC
 641 ACACAGGTTTTTGGCCACAGTCCTTGATGGAGTCCCAAAACCATGGTGCAGCCAGTTCCAATGCTGGACACCTCAACCAT
 721 CAGGGTGAAATCTGGGGCCTCAGCTTTTTAATTTAATTATTTTAATTCTTAATACTTTAATTTGTGCATTTCATAAGCCC
 801 CCTGCTCTTGGACTGAATTTTGTGCTTTTTATTGAAGAATTTTATTGTTTTTATCTTAAAATCAGTTTCTATTATCCTTG
 881 GGGAGACCATCCCTAACAAAGTACAGGTGGGATCTCCTGTGAGTCATTGGCTGGGTTCTGATTGCTAGATGTCACACCCA
 961 CCAGCATCACCAAAGTGACTCTGAGATAGACCGGTCCCTTCTCAGCGTTCCAGTCACTTCAGGAGGAATTTAGTTATTGA
1041 CTTAGTCTATGACATCTGGCTACATGTAGGTAGAGAAGAAAGATAATTTTAAAAAGGAAATCAGGTCTTTTGCAACTGTG
1121 CCTCCCTCTGTCTGTTTTCACTTGAATGGGTAAATAACCAGCAGCTAGGTTTTGAATTCCTACCTTGTTATTCTAAACAG
1201 ATGTCCACATTGTTAATTAAATCTAAATTATGAGCCTTGCTGAGTGGATACGGTACTTACACCTGAACCAGGATTCCTGG
1281 GTTCTGTTGTTGACATTGCCCTTCAGCACCTGTTTGGCCAGCTGTGTAAGATAGGACTAATGACTAGGAAGCCTACCCCA
1361 ATGAATGATATACTAGATGAAATAGTGTTCAAAACCTGTAGGCACTCTCTGGCTAAAAACAAACTCTGAGGCCACCAGCA
1441 GATCATCTTTAAGCTAAGTTACTATTTTTCACCTTTTTTTTTAGACGGAGTTTTGCTCTTTGTTGCCCAGGCTGGAGTGC
1521 AGTGGCACGATCTCGGCTCACTGCAACCTCCGCCTCCCAAGTTCAAGCGATTCTCCTCTCTCAGCCTCCTGGGTAGCTGG
1601 GATTACAGGTGCCCACCAACATGCCTGGCTAATTTTTGTACTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTG
1681 GTCTTCAACTCCAGATCTCAGGTGATCTACCCTCCTCGGCCTCCCAAAGTACTGGGATTACAGGCCTGAGCCACCGCGCC
1761 CGGCCTATTTTTCACTTTAATTTGGCAGCTGAGAATGCCCAGAAAGTGCCAGAAGCATCGTGGCATTTCCAGAACCATGG
1841 ATTCTGCCTTTGGACCCCTCTCTATTAATATTAAAACTCTGGGCCTTCAGATGTCACCCTAATCCACTTCCCTAAGACAG
1921 AATTTCTGGACAAGATGGGTAAGGGCTTCATTCCTTCAACAAGTCAAGTCATACTTGGCCTCTCCCTGAGAATCTGAGCA
2001 GGAGCCTTATAACCTGTGGTCATTATTTTTTCTTTCTGTACAGAAATAGAAAAGCATTAGAAATAACTTCTAACCATCCT
2081 CTGAAAAAACAGAAAAAATATCGAATCCCTCTTTCATGAGAAGTCTTTTGGATAATTGGAAACCTTCATCACTGAGGTTG
2161 GCCAGCCCCTGCCAAGTGTTGTGTAGGCAAAGCACTTGTTAGTGGCTTCCTATGAAATGTTTTAGAGATCTCTTCACCAT
2241 ACTGGTTTCTTCTCTTTGGTTGGTGTGGGTAAAAGAAAACAAAACATTTCCTATAAGCTGAAAGCTGACCAGCATTCTCT
2321 TCTTGGTAACATCTACTACTCCAATCTAGAAAATTTGGATTCTAGACCAAAAATCAGGAAACATGGCTCCTTATAAATCT
2401 GTGCAGCTGCCTTATAGTACCATCAAAGGAATTTCAGGTGGGCTGGGCGGGGCCCCGATCCCAGAATTATCAACTCCACC
2481 CATCATCATTTGGTCATGAAGCATCCTTTCATTCTTCTTCTTCTTTTTTTTGGGGGGGCGGGGCGGGGGAGGGATCTCAA
2561 AGTTTTAGTCTTCCAGAATCCAAATTAAAGGTTGCCCCTGATGGGGGCCAGGTTCCGCCACAGAACATCTTAGATGTCAG
2641 CCTTGACCTCACTTAGCAGGGATTACAGAAATGAGATACATTTTGAAGGAGAGTTGTCTGTTATGTTCACTGTATTCTAA
2721 GTGCCTGGGATAAAGCTGTCTCATGGGTGCTCCATATATATTCATATATATTTGTTGAGTGAATTAATGAATTAAGAGTG
2801 GCTGGCAGAGTAGGCAGAAAAAGACACTGCAAATGGCATAAAAATTAAAGTCCTAGCTGAGTTCTCAATGGTAAAGGCAT
2881 CAGATGTCTTAGCAGTCAAGCTAGAAATTCATGACAATGAGTATTACTATTTGCCTAATGGCAACTCATTGCTCTCCATG
2961 TAAATGTAATCAACAGATGAAGAGAATATAATTGCTCTGCTTTTCCACTAAAACTCCATCTTAGTGAATTTTAAATTATC
3041 CAGAGATGTCAAACTGCCAAATAAAAATATTTCAGTAGTCTTTGCATCAGCTTACCTTGTACCAGAAACATTTCCAATTT
3121 ACTATCAAATTATAGTAACTGAGCCTGTGTGAAGTATCTCATCATTTTCGAAAGGAACACCTTGTGTGATGCCAGTGAGC
3201 ATTTCTAAAAAGGGTGTGAGGTAGAGGTAAAAATAAGGTGAGAGACCATTTCAGAATGCACTGTTGCTCAAAAAGGTGAT
3281 CTGGTTCTTTCTTCAGAGATTTCTACGGGGATAGAAAATCGGGAGTCTGCCCTCATTAATCTGTGATTCCACCTCTTGCA
3361 CCAAATCAATATCTATTTGTTGAGCACTTATTGATTAAGACCTTGCATATGTCTGTCCATTTTGATTTGAGATACAACTT
3441 TTTGTGTGGGTTGAATGACAAATCACTCCAAACAAAGCTGGGCACAGAGAATCAGCTAGGAGACCAGTTATTCAGGGTCC
3521 ATTTCTCTTGGATGTAAAGGAGTCCTGGGTAAAATGTGGCTGTAACCTAAACCAACTAGTCCTTGTGATTTGTTTCTGCC
3601 CTCTGTGTTTCCTGTTGTCAAATGCTAAGTGTGTGTTTTGCAGTCATGAACTAAAGCACAAAAAGATGCATGAGACATTG
3681 TAGTCATATGTCTGGTGTGACACTTTGGAGCAAAAACCTTGCAGTGGTAAATAAAAAATTTCCAACAGGGAAAAAAAAAA
3761 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcuUAGGUGGUGCU--------UGUUGAAg 5'
             :||||:: :||        ||||||| 
Target 5' tctGTCCATTTTGATTTGAGATACAACTTt 3'
 3412 - 3441 149.00 -13.20
2 
miRNA  3' gcuuAGGUGGUG-CUUGUUGAAg 5'
              |||:|||| ||||| ||| 
Target 5' aggtTCCGCCACAGAACATCTTa 3'
 2610 - 2632 146.00 -22.40
3 
miRNA  3' gcUUAGGUGGUGCUUGUUGAAg 5'
            ||  ||::|  ||:||||| 
Target 5' gaAAAGCATTAGAAATAACTTc 3'
 2049 - 2070 144.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30185398 16 COSMIC
COSN26997668 28 COSMIC
COSN30479283 30 COSMIC
COSN31498471 34 COSMIC
COSN30140413 42 COSMIC
COSN31510588 57 COSMIC
COSN30479308 73 COSMIC
COSN30484713 88 COSMIC
COSN31584512 109 COSMIC
COSN31598360 118 COSMIC
COSN31479976 142 COSMIC
COSN31479631 174 COSMIC
COSN31479614 180 COSMIC
COSN31590606 187 COSMIC
COSN18013250 543 COSMIC
COSN22546134 558 COSMIC
COSN5912306 839 COSMIC
COSN15668269 888 COSMIC
COSN23768177 1438 COSMIC
COSN23089453 1633 COSMIC
COSN142456 1656 COSMIC
COSN8447142 1756 COSMIC
COSN5912305 2496 COSMIC
COSN17075941 2531 COSMIC
COSN14629610 2550 COSMIC
COSN17533446 2956 COSMIC
COSN22374101 3269 COSMIC
COSN21613128 3305 COSMIC
COSN16158255 3373 COSMIC
COSN32065214 3429 COSMIC
COSN28706039 3477 COSMIC
COSN30544074 3625 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1425676668 2 dbSNP
rs142076217 5 dbSNP
rs1188182150 7 dbSNP
rs762146736 8 dbSNP
rs1249658977 9 dbSNP
rs1207906331 12 dbSNP
rs1423037383 13 dbSNP
rs1488106190 14 dbSNP
rs201235940 17 dbSNP
rs760751432 19 dbSNP
rs775571639 24 dbSNP
rs747560575 27 dbSNP
rs147576947 33 dbSNP
rs762844394 37 dbSNP
rs1366995924 39 dbSNP
rs371855733 41 dbSNP
rs769617717 42 dbSNP
rs1390605734 44 dbSNP
rs1294662214 47 dbSNP
rs1301622419 53 dbSNP
rs1033931006 54 dbSNP
rs1002329213 56 dbSNP
rs1463283325 61 dbSNP
rs1293517531 62 dbSNP
rs764951424 65 dbSNP
rs556583916 66 dbSNP
rs1282896671 75 dbSNP
rs1447098299 79 dbSNP
rs1217783814 88 dbSNP
rs145131600 89 dbSNP
rs570678674 98 dbSNP
rs993427971 107 dbSNP
rs547638183 108 dbSNP
rs761605589 114 dbSNP
rs1166910129 119 dbSNP
rs1188463717 121 dbSNP
rs1259843994 126 dbSNP
rs533758751 134 dbSNP
rs192283535 138 dbSNP
rs1008196064 140 dbSNP
rs1385960272 143 dbSNP
rs1402529820 159 dbSNP
rs187721510 178 dbSNP
rs1174570287 179 dbSNP
rs1359156904 185 dbSNP
rs547928510 187 dbSNP
rs1189632823 188 dbSNP
rs1441228663 190 dbSNP
rs889323146 192 dbSNP
rs1051018816 195 dbSNP
rs1349055391 204 dbSNP
rs1049838381 212 dbSNP
rs1278602928 222 dbSNP
rs1350678160 226 dbSNP
rs1460316490 230 dbSNP
rs1225033750 232 dbSNP
rs1196794026 235 dbSNP
rs531296587 237 dbSNP
rs1347122331 251 dbSNP
rs1211292863 256 dbSNP
rs141172450 257 dbSNP
rs182588623 261 dbSNP
rs1203980928 263 dbSNP
rs1181277852 268 dbSNP
rs944990827 270 dbSNP
rs546684224 272 dbSNP
rs1285450697 277 dbSNP
rs1241931355 282 dbSNP
rs989454779 284 dbSNP
rs1394978711 298 dbSNP
rs770646662 298 dbSNP
rs958188643 315 dbSNP
rs1176106170 316 dbSNP
rs1369033760 317 dbSNP
rs1429515222 326 dbSNP
rs1327755917 328 dbSNP
rs1307589033 334 dbSNP
rs1443713658 340 dbSNP
rs1392959866 348 dbSNP
rs926508391 349 dbSNP
rs1368464666 350 dbSNP
rs980988532 353 dbSNP
rs970798565 363 dbSNP
rs1024979280 364 dbSNP
rs1195070824 364 dbSNP
rs1439821103 366 dbSNP
rs993460529 374 dbSNP
rs962058734 377 dbSNP
rs938345183 394 dbSNP
rs1016670569 395 dbSNP
rs552968253 396 dbSNP
rs1195972322 412 dbSNP
rs1006500902 415 dbSNP
rs145452669 416 dbSNP
rs111792448 418 dbSNP
rs998065922 430 dbSNP
rs1396730368 437 dbSNP
rs969803962 439 dbSNP
rs900931279 440 dbSNP
rs192857864 445 dbSNP
rs776276293 447 dbSNP
rs956410940 449 dbSNP
rs149753043 453 dbSNP
rs1363005874 454 dbSNP
rs1008936322 455 dbSNP
rs892172691 456 dbSNP
rs764014349 457 dbSNP
rs1341241381 459 dbSNP
rs1291515608 465 dbSNP
rs955351898 466 dbSNP
rs1207601996 469 dbSNP
rs760389469 471 dbSNP
rs1355000074 473 dbSNP
rs562254471 474 dbSNP
rs926501382 478 dbSNP
rs542379032 495 dbSNP
rs1194556027 496 dbSNP
rs775435601 497 dbSNP
rs1375092114 499 dbSNP
rs1472017460 502 dbSNP
rs1416793920 503 dbSNP
rs535957515 508 dbSNP
rs1461488838 512 dbSNP
rs576586398 518 dbSNP
rs1038876412 525 dbSNP
rs1287525288 529 dbSNP
rs1006020370 531 dbSNP
rs548937874 532 dbSNP
rs1231294381 536 dbSNP
rs886309231 537 dbSNP
rs1335786443 539 dbSNP
rs1047630632 542 dbSNP
rs116580208 543 dbSNP
rs1390095382 545 dbSNP
rs1206177606 546 dbSNP
rs962088758 547 dbSNP
rs577128626 552 dbSNP
rs1459286531 554 dbSNP
rs985173464 555 dbSNP
rs553787308 558 dbSNP
rs139608531 562 dbSNP
rs1166676909 563 dbSNP
rs1248135433 569 dbSNP
rs567955790 581 dbSNP
rs1387118318 582 dbSNP
rs769983275 587 dbSNP
rs1312091519 593 dbSNP
rs1355887317 597 dbSNP
rs914292048 598 dbSNP
rs1305150355 599 dbSNP
rs1335242211 602 dbSNP
rs188053965 610 dbSNP
rs990307617 616 dbSNP
rs375719350 625 dbSNP
rs113902190 655 dbSNP
rs1486868103 658 dbSNP
rs1210015798 665 dbSNP
rs1189544993 668 dbSNP
rs1248058059 669 dbSNP
rs1417982108 677 dbSNP
rs748464070 683 dbSNP
rs1327027090 685 dbSNP
rs924808344 688 dbSNP
rs987038241 689 dbSNP
rs1267403312 693 dbSNP
rs892194170 695 dbSNP
rs1028601047 701 dbSNP
rs1296656345 707 dbSNP
rs1053467493 719 dbSNP
rs1372934766 721 dbSNP
rs1223936977 726 dbSNP
rs1346859938 734 dbSNP
rs1392008271 739 dbSNP
rs1276892681 741 dbSNP
rs1309188958 746 dbSNP
rs975384073 761 dbSNP
rs963042686 764 dbSNP
rs867922801 767 dbSNP
rs114870973 768 dbSNP
rs1202932390 772 dbSNP
rs1437302094 775 dbSNP
rs1480127950 778 dbSNP
rs1196045698 781 dbSNP
rs1251987324 782 dbSNP
rs1192858164 784 dbSNP
rs1452044822 784 dbSNP
rs1395686289 785 dbSNP
rs1045424869 793 dbSNP
rs552208895 798 dbSNP
rs1353741750 799 dbSNP
rs1159034489 800 dbSNP
rs1470545574 801 dbSNP
rs1392298958 806 dbSNP
rs569774767 809 dbSNP
rs1327144653 810 dbSNP
rs1373887156 814 dbSNP
rs917777208 822 dbSNP
rs190615938 829 dbSNP
rs1477511037 837 dbSNP
rs1242290879 844 dbSNP
rs1227624486 846 dbSNP
rs1259596295 847 dbSNP
rs550139392 847 dbSNP
rs1212577174 853 dbSNP
rs1253515981 861 dbSNP
rs1463137126 863 dbSNP
rs1184733475 868 dbSNP
rs1247418524 869 dbSNP
rs755305062 871 dbSNP
rs984816564 874 dbSNP
rs150566200 875 dbSNP
rs907100012 880 dbSNP
rs1326707871 885 dbSNP
rs1396819549 894 dbSNP
rs144075378 896 dbSNP
rs1028992871 899 dbSNP
rs1363007946 902 dbSNP
rs1344604154 907 dbSNP
rs1384342145 908 dbSNP
rs116067918 911 dbSNP
rs948350172 914 dbSNP
rs966272621 926 dbSNP
rs1232334236 943 dbSNP
rs1273217652 947 dbSNP
rs1020491312 983 dbSNP
rs1010387621 992 dbSNP
rs1486067094 994 dbSNP
rs1363111334 996 dbSNP
rs1320540043 997 dbSNP
rs1195634848 1004 dbSNP
rs1255627140 1006 dbSNP
rs934434856 1007 dbSNP
rs924786528 1023 dbSNP
rs956488610 1028 dbSNP
rs1420037999 1033 dbSNP
rs986945564 1034 dbSNP
rs1159012203 1038 dbSNP
rs1346367328 1054 dbSNP
rs1361368622 1062 dbSNP
rs530745755 1065 dbSNP
rs186236856 1066 dbSNP
rs1355251697 1069 dbSNP
rs1413728039 1076 dbSNP
rs3793 1084 dbSNP
rs771549212 1092 dbSNP
rs1170093961 1094 dbSNP
rs759013715 1103 dbSNP
rs1317485602 1106 dbSNP
rs1013479639 1107 dbSNP
rs1277861704 1118 dbSNP
rs1485228174 1118 dbSNP
rs982866269 1120 dbSNP
rs1473753397 1126 dbSNP
rs369427027 1134 dbSNP
rs1468653804 1141 dbSNP
rs1176738703 1147 dbSNP
rs183419886 1157 dbSNP
rs1422006891 1158 dbSNP
rs1172333688 1169 dbSNP
rs1036166847 1182 dbSNP
rs546232466 1185 dbSNP
rs940485034 1209 dbSNP
rs1313100539 1212 dbSNP
rs909302465 1219 dbSNP
rs1209219650 1231 dbSNP
rs907047414 1235 dbSNP
rs139623401 1239 dbSNP
rs554129157 1242 dbSNP
rs1373452045 1249 dbSNP
rs749931166 1251 dbSNP
rs932079525 1252 dbSNP
rs1346875106 1253 dbSNP
rs1211404563 1255 dbSNP
rs1340232209 1271 dbSNP
rs146346356 1276 dbSNP
rs1296970617 1280 dbSNP
rs1204119785 1285 dbSNP
rs921957869 1287 dbSNP
rs1233472326 1290 dbSNP
rs1012821298 1291 dbSNP
rs976065769 1294 dbSNP
rs764896054 1296 dbSNP
rs1192307234 1297 dbSNP
rs892790895 1304 dbSNP
rs913451056 1306 dbSNP
rs1174723802 1308 dbSNP
rs372376293 1310 dbSNP
rs551355803 1312 dbSNP
rs902905856 1318 dbSNP
rs1282914138 1325 dbSNP
rs2863174 1326 dbSNP
rs1033172354 1332 dbSNP
rs770696047 1352 dbSNP
rs1371547504 1354 dbSNP
rs1370220849 1357 dbSNP
rs559240167 1361 dbSNP
rs1276344107 1363 dbSNP
rs969145589 1368 dbSNP
rs1427433070 1369 dbSNP
rs1337217279 1370 dbSNP
rs1274060982 1371 dbSNP
rs191986394 1384 dbSNP
rs1459132882 1399 dbSNP
rs1380366095 1406 dbSNP
rs1211952166 1407 dbSNP
rs1023275955 1409 dbSNP
rs1369510832 1411 dbSNP
rs748385237 1412 dbSNP
rs896415847 1422 dbSNP
rs941629090 1424 dbSNP
rs1475296056 1431 dbSNP
rs1166960491 1434 dbSNP
rs1036198001 1444 dbSNP
rs1466712676 1452 dbSNP
rs554407005 1455 dbSNP
rs1411581766 1462 dbSNP
rs1004800733 1475 dbSNP
rs887642119 1482 dbSNP
rs910151206 1483 dbSNP
rs1181203391 1485 dbSNP
rs537658456 1486 dbSNP
rs568663371 1487 dbSNP
rs1429836057 1495 dbSNP
rs1179662639 1496 dbSNP
rs1482210559 1498 dbSNP
rs928012350 1502 dbSNP
rs1222455485 1505 dbSNP
rs982199950 1512 dbSNP
rs971197157 1521 dbSNP
rs1288425807 1522 dbSNP
rs932083424 1528 dbSNP
rs921989711 1529 dbSNP
rs779061461 1533 dbSNP
rs558413426 1534 dbSNP
rs148307222 1535 dbSNP
rs1351571747 1541 dbSNP
rs944648208 1546 dbSNP
rs913230839 1551 dbSNP
rs77965111 1552 dbSNP
rs1032944552 1559 dbSNP
rs1185363215 1560 dbSNP
rs998895420 1568 dbSNP
rs1293718132 1569 dbSNP
rs1164913226 1570 dbSNP
rs7114849 1578 dbSNP
rs1399861606 1590 dbSNP
rs926137125 1591 dbSNP
rs1342172697 1592 dbSNP
rs1050830426 1597 dbSNP
rs980270885 1599 dbSNP
rs749336797 1611 dbSNP
rs1292914331 1615 dbSNP
rs561303360 1616 dbSNP
rs185886310 1617 dbSNP
rs1039869173 1619 dbSNP
rs866517020 1620 dbSNP
rs180952904 1623 dbSNP
rs1484897562 1627 dbSNP
rs1208271116 1636 dbSNP
rs1472125657 1641 dbSNP
rs1250160322 1644 dbSNP
rs1185444068 1646 dbSNP
rs1423864249 1652 dbSNP
rs1191979799 1656 dbSNP
rs910090842 1664 dbSNP
rs1014536781 1666 dbSNP
rs1005238737 1667 dbSNP
rs1159198853 1672 dbSNP
rs887684861 1678 dbSNP
rs929963124 1680 dbSNP
rs1403243753 1688 dbSNP
rs1027921951 1693 dbSNP
rs928002487 1701 dbSNP
rs1304913504 1707 dbSNP
rs995997548 1717 dbSNP
rs1330448739 1718 dbSNP
rs900587983 1723 dbSNP
rs982149678 1726 dbSNP
rs1226980542 1736 dbSNP
rs1040518831 1743 dbSNP
rs1328898580 1744 dbSNP
rs1279122468 1746 dbSNP
rs189706654 1754 dbSNP
rs991704504 1755 dbSNP
rs560746116 1756 dbSNP
rs59028717 1757 dbSNP
rs936267817 1758 dbSNP
rs1382161214 1760 dbSNP
rs1435163413 1761 dbSNP
rs532624092 1762 dbSNP
rs1156853243 1764 dbSNP
rs1467730479 1774 dbSNP
rs1296672902 1775 dbSNP
rs980684401 1780 dbSNP
rs714720 1802 dbSNP
rs1333924759 1809 dbSNP
rs1378005936 1815 dbSNP
rs1177890776 1819 dbSNP
rs575683812 1820 dbSNP
rs756566307 1825 dbSNP
rs1302353099 1826 dbSNP
rs1314318167 1828 dbSNP
rs768784117 1853 dbSNP
rs899552589 1856 dbSNP
rs917412572 1857 dbSNP
rs991905499 1864 dbSNP
rs113096223 1872 dbSNP
rs1267719335 1876 dbSNP
rs1434756514 1880 dbSNP
rs1168584007 1888 dbSNP
rs1372768253 1893 dbSNP
rs888659050 1898 dbSNP
rs1172851739 1901 dbSNP
rs1047753753 1903 dbSNP
rs930257239 1905 dbSNP
rs6416129 1909 dbSNP
rs1370181642 1919 dbSNP
rs781423308 1922 dbSNP
rs554445783 1923 dbSNP
rs1380945032 1937 dbSNP
rs544095801 1940 dbSNP
rs983116577 1945 dbSNP
rs1218896878 1958 dbSNP
rs1259376697 1966 dbSNP
rs1250510458 1967 dbSNP
rs1046359050 1974 dbSNP
rs1220735681 1976 dbSNP
rs1464794895 1977 dbSNP
rs1256958935 1988 dbSNP
rs780614287 2005 dbSNP
rs1235830253 2008 dbSNP
rs1489326265 2013 dbSNP
rs116265147 2026 dbSNP
rs3168293 2032 dbSNP
rs1300130324 2036 dbSNP
rs1027540973 2039 dbSNP
rs996491083 2041 dbSNP
rs1196127104 2045 dbSNP
rs1415678168 2052 dbSNP
rs1366726759 2056 dbSNP
rs758958612 2057 dbSNP
rs989585333 2064 dbSNP
rs1452042824 2079 dbSNP
rs935831845 2080 dbSNP
rs925844062 2090 dbSNP
rs1400170167 2094 dbSNP
rs1279705389 2097 dbSNP
rs1402780533 2102 dbSNP
rs1304399074 2103 dbSNP
rs1313302735 2106 dbSNP
rs977721241 2109 dbSNP
rs1213581978 2120 dbSNP
rs900368543 2128 dbSNP
rs1018775119 2143 dbSNP
rs1009008575 2145 dbSNP
rs1464333830 2157 dbSNP
rs1219071441 2158 dbSNP
rs967261710 2163 dbSNP
rs74316935 2165 dbSNP
rs1053542084 2181 dbSNP
rs779564665 2183 dbSNP
rs976378875 2184 dbSNP
rs4272773 2187 dbSNP
rs1392114836 2188 dbSNP
rs1018436983 2202 dbSNP
rs75607370 2205 dbSNP
rs1421965386 2218 dbSNP
rs1044692625 2228 dbSNP
rs573831581 2239 dbSNP
rs994314192 2249 dbSNP
rs948966643 2251 dbSNP
rs1380724866 2258 dbSNP
rs3180446 2263 dbSNP
rs992939656 2265 dbSNP
rs1308526147 2266 dbSNP
rs939124233 2267 dbSNP
rs1278423876 2268 dbSNP
rs1442021196 2269 dbSNP
rs1211116618 2271 dbSNP
rs1239226240 2272 dbSNP
rs1479701315 2274 dbSNP
rs907590950 2286 dbSNP
rs879534775 2287 dbSNP
rs1441895496 2290 dbSNP
rs983533239 2293 dbSNP
rs1172118565 2299 dbSNP
rs1424931248 2309 dbSNP
rs1413492596 2330 dbSNP
rs1334403409 2332 dbSNP
rs951782687 2336 dbSNP
rs1205445884 2341 dbSNP
rs141803769 2343 dbSNP
rs7110580 2345 dbSNP
rs1330571864 2346 dbSNP
rs1377608930 2347 dbSNP
rs1448950867 2376 dbSNP
rs1294813440 2377 dbSNP
rs548947609 2386 dbSNP
rs1344052456 2388 dbSNP
rs1226967703 2391 dbSNP
rs1305815658 2392 dbSNP
rs895189481 2410 dbSNP
rs1054274797 2411 dbSNP
rs777438519 2414 dbSNP
rs532033726 2415 dbSNP
rs79127149 2420 dbSNP
rs1478597183 2424 dbSNP
rs752518767 2426 dbSNP
rs1308341745 2428 dbSNP
rs1463582149 2436 dbSNP
rs552717820 2438 dbSNP
rs1031715816 2439 dbSNP
rs1448827740 2443 dbSNP
rs532562528 2445 dbSNP
rs904556875 2448 dbSNP
rs1294010576 2449 dbSNP
rs1044779410 2455 dbSNP
rs560643182 2457 dbSNP
rs1360081759 2464 dbSNP
rs922472679 2478 dbSNP
rs1461525064 2482 dbSNP
rs976703998 2488 dbSNP
rs1212357433 2501 dbSNP
rs1013146854 2505 dbSNP
rs896049922 2506 dbSNP
rs1422525023 2514 dbSNP
rs1257266069 2517 dbSNP
rs1183300819 2520 dbSNP
rs1201520367 2522 dbSNP
rs1483846092 2523 dbSNP
rs1272018697 2525 dbSNP
rs1194776558 2526 dbSNP
rs1356427535 2527 dbSNP
rs1423641017 2530 dbSNP
rs12283527 2531 dbSNP
rs1161379967 2532 dbSNP
rs1311767242 2532 dbSNP
rs772133209 2532 dbSNP
rs963698716 2533 dbSNP
rs1242529235 2534 dbSNP
rs1342434791 2535 dbSNP
rs1339733835 2536 dbSNP
rs574290305 2537 dbSNP
rs5791668 2538 dbSNP
rs530081388 2539 dbSNP
rs760783181 2539 dbSNP
rs1411377088 2540 dbSNP
rs780110951 2540 dbSNP
rs1299003101 2541 dbSNP
rs1352613826 2542 dbSNP
rs1306401734 2543 dbSNP
rs762760974 2544 dbSNP
rs984259527 2544 dbSNP
rs952471663 2545 dbSNP
rs1390952145 2548 dbSNP
rs1171566407 2550 dbSNP
rs1241391843 2550 dbSNP
rs1288640230 2551 dbSNP
rs1391564153 2552 dbSNP
rs1165010894 2554 dbSNP
rs1057245283 2562 dbSNP
rs567006169 2591 dbSNP
rs1417716268 2600 dbSNP
rs1438814421 2605 dbSNP
rs1158986110 2610 dbSNP
rs907622436 2611 dbSNP
rs1047506119 2612 dbSNP
rs1025179497 2616 dbSNP
rs116666864 2617 dbSNP
rs1329884200 2625 dbSNP
rs920296060 2646 dbSNP
rs1339591385 2648 dbSNP
rs1376867167 2650 dbSNP
rs767361390 2653 dbSNP
rs974381821 2673 dbSNP
rs1448194742 2675 dbSNP
rs964635663 2676 dbSNP
rs376326896 2678 dbSNP
rs1230603478 2679 dbSNP
rs1255108626 2682 dbSNP
rs1268842392 2688 dbSNP
rs185830550 2691 dbSNP
rs1235858539 2694 dbSNP
rs751287094 2697 dbSNP
rs1179197338 2698 dbSNP
rs1042495808 2703 dbSNP
rs1431295542 2704 dbSNP
rs763806064 2714 dbSNP
rs1198407861 2716 dbSNP
rs945859525 2719 dbSNP
rs1168562199 2724 dbSNP
rs1399658684 2729 dbSNP
rs545205422 2743 dbSNP
rs1334028513 2752 dbSNP
rs762598628 2754 dbSNP
rs1031914843 2755 dbSNP
rs1386608645 2762 dbSNP
rs1000315083 2763 dbSNP
rs1300125817 2764 dbSNP
rs969190955 2768 dbSNP
rs1331282724 2770 dbSNP
rs373085646 2771 dbSNP
rs1224991965 2777 dbSNP
rs1012842751 2780 dbSNP
rs896082493 2790 dbSNP
rs77095488 2804 dbSNP
rs968259477 2806 dbSNP
rs1278677394 2807 dbSNP
rs1021520477 2811 dbSNP
rs942656624 2812 dbSNP
rs1238611123 2817 dbSNP
rs1253066605 2827 dbSNP
rs553109807 2830 dbSNP
rs765281973 2836 dbSNP
rs1487370951 2838 dbSNP
rs1190449832 2842 dbSNP
rs1267834014 2848 dbSNP
rs1004410572 2871 dbSNP
rs377699991 2875 dbSNP
rs759400251 2877 dbSNP
rs1049019820 2878 dbSNP
rs1325637719 2886 dbSNP
rs1490646217 2895 dbSNP
rs1385135258 2912 dbSNP
rs536667180 2915 dbSNP
rs911147914 2923 dbSNP
rs1348684229 2925 dbSNP
rs983775572 2929 dbSNP
rs1294434936 2932 dbSNP
rs1393349416 2937 dbSNP
rs4237653 2941 dbSNP
rs1275989261 2942 dbSNP
rs1339263601 2946 dbSNP
rs920308634 2949 dbSNP
rs1410227577 2950 dbSNP
rs918304719 2951 dbSNP
rs139236137 2956 dbSNP
rs1478168783 2958 dbSNP
rs970864278 2959 dbSNP
rs1490798421 2966 dbSNP
rs1025128858 2968 dbSNP
rs554142525 2970 dbSNP
rs181525446 2978 dbSNP
rs1195882169 2979 dbSNP
rs1411745033 2987 dbSNP
rs528362824 2988 dbSNP
rs1423684815 2995 dbSNP
rs1166120492 3002 dbSNP
rs76413043 3004 dbSNP
rs75623298 3007 dbSNP
rs78546447 3008 dbSNP
rs1033014321 3016 dbSNP
rs1418323344 3019 dbSNP
rs1467612537 3031 dbSNP
rs559530493 3054 dbSNP
rs1248631128 3056 dbSNP
rs1000832397 3058 dbSNP
rs1359547599 3061 dbSNP
rs1463439009 3064 dbSNP
rs1290067466 3065 dbSNP
rs1376346791 3077 dbSNP
rs1227666154 3084 dbSNP
rs1283333659 3086 dbSNP
rs556317618 3094 dbSNP
rs1313422408 3097 dbSNP
rs776606125 3098 dbSNP
rs768900261 3125 dbSNP
rs1237736874 3133 dbSNP
rs1276801890 3149 dbSNP
rs1488709969 3155 dbSNP
rs1218226191 3156 dbSNP
rs538567491 3159 dbSNP
rs1483007398 3162 dbSNP
rs1182941388 3169 dbSNP
rs569548027 3170 dbSNP
rs1438188097 3172 dbSNP
rs774598141 3176 dbSNP
rs1158378989 3184 dbSNP
rs116182158 3197 dbSNP
rs1437904767 3201 dbSNP
rs1160919746 3203 dbSNP
rs900988151 3212 dbSNP
rs1446713241 3218 dbSNP
rs1040876508 3220 dbSNP
rs978980010 3221 dbSNP
rs539225181 3227 dbSNP
rs1444498683 3230 dbSNP
rs1308182557 3234 dbSNP
rs1318099355 3239 dbSNP
rs1415378892 3258 dbSNP
rs1354158644 3270 dbSNP
rs566949100 3273 dbSNP
rs968846405 3274 dbSNP
rs1225682199 3275 dbSNP
rs1276848795 3277 dbSNP
rs1403957245 3283 dbSNP
rs1210964063 3284 dbSNP
rs1022972968 3288 dbSNP
rs1170440933 3304 dbSNP
rs546727520 3305 dbSNP
rs991454699 3306 dbSNP
rs768846345 3307 dbSNP
rs1035639475 3308 dbSNP
rs1178586596 3309 dbSNP
rs1239166243 3312 dbSNP
rs7106507 3320 dbSNP
rs560972364 3321 dbSNP
rs550581397 3332 dbSNP
rs1027165680 3336 dbSNP
rs2902427 3347 dbSNP
rs1176455066 3350 dbSNP
rs1407671985 3356 dbSNP
rs1463936317 3359 dbSNP
rs2863173 3361 dbSNP
rs771369622 3362 dbSNP
rs972445951 3373 dbSNP
rs544931723 3377 dbSNP
rs970476907 3383 dbSNP
rs943092257 3386 dbSNP
rs917677384 3397 dbSNP
rs1347336392 3417 dbSNP
rs890155418 3436 dbSNP
rs1051410741 3449 dbSNP
rs934614640 3451 dbSNP
rs959806680 3453 dbSNP
rs1230638252 3461 dbSNP
rs1439887300 3465 dbSNP
rs573042610 3469 dbSNP
rs1360547242 3473 dbSNP
rs8929 3477 dbSNP
rs1001557918 3480 dbSNP
rs575720491 3486 dbSNP
rs542778243 3495 dbSNP
rs1199699701 3498 dbSNP
rs978627134 3502 dbSNP
rs573759036 3517 dbSNP
rs901899606 3518 dbSNP
rs1411625581 3525 dbSNP
rs947171606 3540 dbSNP
rs1311371616 3547 dbSNP
rs562357930 3549 dbSNP
rs1370739512 3551 dbSNP
rs915744257 3556 dbSNP
rs1169995501 3562 dbSNP
rs991559690 3575 dbSNP
rs1218132618 3576 dbSNP
rs1278946289 3589 dbSNP
rs960093911 3590 dbSNP
rs141207837 3592 dbSNP
rs1227118810 3600 dbSNP
rs1427230269 3607 dbSNP
rs1289525696 3608 dbSNP
rs931255626 3612 dbSNP
rs1182365840 3619 dbSNP
rs1035670240 3620 dbSNP
rs777201410 3621 dbSNP
rs896809935 3635 dbSNP
rs151149235 3640 dbSNP
rs755779963 3650 dbSNP
rs752416805 3651 dbSNP
rs1373176145 3661 dbSNP
rs1476320637 3667 dbSNP
rs1186906255 3668 dbSNP
rs951669002 3674 dbSNP
rs1412779547 3680 dbSNP
rs1425117253 3681 dbSNP
rs949062282 3682 dbSNP
rs1485478766 3685 dbSNP
rs1027610122 3686 dbSNP
rs995770174 3695 dbSNP
rs938184025 3701 dbSNP
rs900034993 3707 dbSNP
rs780828455 3708 dbSNP
rs1328279028 3710 dbSNP
rs577518093 3717 dbSNP
rs754711833 3718 dbSNP
rs1284189512 3721 dbSNP
rs1275592106 3724 dbSNP
rs559248255 3727 dbSNP
rs1357472445 3734 dbSNP
rs890186528 3739 dbSNP
rs979689895 3739 dbSNP
rs1051442551 3745 dbSNP
rs143009829 3746 dbSNP
rs149113991 3748 dbSNP
rs1021230858 3750 dbSNP
rs1445193751 3751 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.478 3.2e-5 0.568 4.9e-7 64 Click to see details
GSE28544 Breast cancer 0.607 8.3e-4 0.656 2.5e-4 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.614 9.1e-4 0.634 5.8e-4 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.438 1.6e-2 -0.399 2.7e-2 24 Click to see details
GSE38226 Liver fibrosis 0.433 2.5e-2 0.499 1.1e-2 21 Click to see details
GSE27834 Pluripotent stem cells -0.494 2.6e-2 -0.438 4.5e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.367 3.6e-2 -0.142 2.5e-1 25 Click to see details
GSE19783 ER- ER- breast cancer 0.177 5.9e-2 0.170 6.7e-2 79 Click to see details
GSE17306 Multiple myeloma -0.188 9.8e-2 -0.050 3.7e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.228 1.4e-1 0.128 2.7e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.19 1.5e-1 -0.228 1.0e-1 32 Click to see details
GSE21032 Prostate cancer -0.108 1.7e-1 -0.122 1.4e-1 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.212 1.8e-1 -0.344 6.9e-2 20 Click to see details
GSE19350 CNS germ cell tumors 0.238 2.3e-1 0.238 2.3e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.078 2.3e-1 -0.059 2.9e-1 90 Click to see details
GSE28260 Renal cortex and medulla 0.148 3.1e-1 0.165 3.0e-1 13 Click to see details
GSE19536 Breast cancer 0.033 3.7e-1 -0.003 4.9e-1 100 Click to see details
GSE17498 Multiple myeloma -0.018 4.6e-1 0.038 4.1e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.023 4.6e-1 0.059 4.0e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.023 4.6e-1 0.059 4.0e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.023 4.6e-1 0.059 4.0e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.559 0 -0.515 0 50 Click to see details
PAAD 0.966 0.02 0.400 0.3 4 Click to see details
KIRP -0.271 0.07 -0.261 0.07 32 Click to see details
HNSC 0.201 0.1 0.084 0.3 42 Click to see details
LIHC 0.174 0.12 0.202 0.08 49 Click to see details
PCPG 0.922 0.13 1.000 0.5 3 Click to see details
UCEC -0.226 0.18 -0.163 0.25 19 Click to see details
KICH -0.185 0.19 -0.263 0.11 24 Click to see details
STAD 0.123 0.25 -0.009 0.48 32 Click to see details
LUAD -0.165 0.3 0.007 0.49 12 Click to see details
LUSC -0.077 0.32 -0.157 0.17 38 Click to see details
THCA -0.062 0.33 -0.148 0.14 55 Click to see details
KIRC 0.051 0.35 0.095 0.23 62 Click to see details
BLCA -0.081 0.37 -0.036 0.44 18 Click to see details
ESCA 0.097 0.39 0.191 0.29 11 Click to see details
BRCA -0.023 0.42 0.012 0.46 84 Click to see details
CESC 0.211 0.43 0.500 0.33 3 Click to see details
CHOL 0.06 0.44 -0.167 0.33 9 Click to see details
COAD -0.049 0.45 0.071 0.43 8 Click to see details
COAD -0.049 0.45 0.071 0.43 8 Click to see details
COAD -0.049 0.45 0.071 0.43 8 Click to see details
112 hsa-miR-382-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053778 PTEN phosphatase and tensin homolog 4 1
MIRT060847 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT064748 CCND2 cyclin D2 2 6
MIRT066666 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT077432 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT082804 ZNF264 zinc finger protein 264 2 4
MIRT089341 PCBP1 poly(rC) binding protein 1 2 6
MIRT176641 SMC3 structural maintenance of chromosomes 3 2 2
MIRT223217 ZKSCAN5 zinc finger with KRAB and SCAN domains 5 2 2
MIRT229780 GNL3L G protein nucleolar 3 like 2 2
MIRT244332 ARL4A ADP ribosylation factor like GTPase 4A 1 1
MIRT326971 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT369626 APCDD1 APC down-regulated 1 2 2
MIRT407707 MXD1 MAX dimerization protein 1 2 1
MIRT437905 NFIA nuclear factor I A 2 1
MIRT438103 DRD1 dopamine receptor D1 1 1
MIRT439190 ZNF652 zinc finger protein 652 1 1
MIRT439248 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT439276 XPO1 exportin 1 1 1
MIRT439382 TSPYL1 TSPY like 1 1 1
MIRT439494 SYT13 synaptotagmin 13 1 1
MIRT439497 SYNJ2 synaptojanin 2 1 1
MIRT439516 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT439564 SOGA2 microtubule crosslinking factor 1 1 1
MIRT439677 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT439709 SAR1B secretion associated Ras related GTPase 1B 1 1
MIRT439802 RBM39 RNA binding motif protein 39 1 1
MIRT439819 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT439894 PRNP prion protein 1 1
MIRT439921 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT439942 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT439999 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440023 PCNXL2 pecanex homolog 2 1 1
MIRT440041 PARM1 prostate androgen-regulated mucin-like protein 1 1 1
MIRT440180 MTRNR2L8 MT-RNR2-like 8 1 1
MIRT440191 MTRNR2L2 MT-RNR2-like 2 1 1
MIRT440195 MTRNR2L1 MT-RNR2-like 1 1 1
MIRT440198 MTPN myotrophin 1 1
MIRT440303 LUZP6 leucine zipper protein 6 1 1
MIRT440365 KIF5C kinesin family member 5C 1 1
MIRT440376 KIAA2022 neurite extension and migration factor 1 1
MIRT440514 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440626 FNIP1 folliculin interacting protein 1 1 1
MIRT440679 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT440762 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT440814 DICER1 dicer 1, ribonuclease III 1 1
MIRT440839 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit 1 1
MIRT440851 DAD1 defender against cell death 1 1 1
MIRT440909 COPS4 COP9 signalosome subunit 4 1 1
MIRT440931 CLTC clathrin heavy chain 1 1
MIRT441003 CASP3 caspase 3 1 1
MIRT441121 BBS4 Bardet-Biedl syndrome 4 1 1
MIRT441181 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT441259 ADM adrenomedullin 1 1
MIRT441796 EXOSC2 exosome component 2 2 2
MIRT443001 SLC3A1 solute carrier family 3 member 1 2 2
MIRT445896 FAM46A family with sequence similarity 46 member A 2 2
MIRT445930 UFL1 UFM1 specific ligase 1 2 2
MIRT447479 NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 2 2
MIRT450664 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT454105 TMEM209 transmembrane protein 209 2 2
MIRT459477 HIST1H3G histone cluster 1 H3 family member g 2 2
MIRT464867 UBB ubiquitin B 2 8
MIRT466300 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT470024 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 2
MIRT472335 NETO2 neuropilin and tolloid like 2 2 4
MIRT472973 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT478514 CTTN cortactin 2 6
MIRT501170 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501800 NHLRC3 NHL repeat containing 3 2 6
MIRT504301 ZNF318 zinc finger protein 318 2 6
MIRT507913 CALM1 calmodulin 1 2 4
MIRT511139 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT512231 ATXN3 ataxin 3 2 6
MIRT514375 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT516686 ZNF860 zinc finger protein 860 2 4
MIRT523197 HIST1H3F histone cluster 1 H3 family member f 2 2
MIRT529767 SF3B1 splicing factor 3b subunit 1 2 2
MIRT533901 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT534934 PTGDR prostaglandin D2 receptor 2 2
MIRT535125 PLSCR4 phospholipid scramblase 4 2 2
MIRT536454 KLHL3 kelch like family member 3 2 2
MIRT537076 GPR176 G protein-coupled receptor 176 2 2
MIRT537336 FRAXA fragile site, folic acid type, rare, fra(X)(q27.3) A (macroorchidism, mental retardation) 2 2
MIRT537513 FAM105A family with sequence similarity 105 member A 2 2
MIRT544499 SLC25A46 solute carrier family 25 member 46 2 2
MIRT546072 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546537 NHS NHS actin remodeling regulator 2 4
MIRT552796 YAF2 YY1 associated factor 2 2 2
MIRT559300 ATXN1 ataxin 1 2 2
MIRT559851 GSKIP GSK3B interacting protein 2 2
MIRT563341 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT563969 RAB6A RAB6A, member RAS oncogene family 2 2
MIRT564767 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT565057 VAMP3 vesicle associated membrane protein 3 2 2
MIRT565585 SLC6A8 solute carrier family 6 member 8 2 2
MIRT574166 ATG10 autophagy related 10 2 2
MIRT612545 RPAP2 RNA polymerase II associated protein 2 2 4
MIRT613882 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT617251 SPIC Spi-C transcription factor 2 2
MIRT620608 SAP30 Sin3A associated protein 30 2 2
MIRT620665 MRPS18C mitochondrial ribosomal protein S18C 2 2
MIRT630854 KLHDC10 kelch domain containing 10 2 2
MIRT661986 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 4
MIRT686138 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT698032 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT700741 PLEKHA8 pleckstrin homology domain containing A8 2 2
MIRT716928 G3BP2 G3BP stress granule assembly factor 2 2 2
MIRT731079 YBX1 Y-box binding protein 1 3 1
MIRT733642 TOP1 DNA topoisomerase I 2 0
MIRT734728 NR3C1 nuclear receptor subfamily 3 group C member 1 3 0
MIRT756465 NR1H4 nuclear receptor subfamily 1 group H member 4 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-382 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-382 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-382 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-382 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-382 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-382 Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-382 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-382 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-382-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-382-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-382-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-382-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-382-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-382-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-382-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-382-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-382-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-382-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-382-5p (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-382-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-382-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-382-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-382-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-382-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-382-5p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 resistant
hsa-miR-382-5p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 resistant
hsa-miR-382-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-382-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-382-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-382-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-382-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-382-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-382-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-382-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-382-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-382-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-382-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-382-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-382-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-382-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-382-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-382-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-382-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-382-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-382-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-382-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-382-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-382-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-382-5p 2-(2-chloro-4,5-dimethoxyphenyl)-1-(1h-indol-3-yl)ethanone 266625 NSC105348 sensitive
hsa-miR-382-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-382-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-382-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-382-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-382-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-382-5p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 sensitive
hsa-miR-382-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-382-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-382-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-382-5p 2-methyl-4,4-diphenyl-1,4-benzoxaphosphinin-4-ium;bromide 24199840 NSC346098 sensitive
hsa-miR-382-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-382-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-382-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-382-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-382-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-382-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-382-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-382-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-382-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-382-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-382-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-382-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-382-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-382-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-382-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-382-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-382-5p 3-bromo-2,4,6-trinitrotoluene 219376 NSC596 resistant
hsa-miR-382-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-382-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-382-5p 3-deazacytidine 1652 NSC133115 resistant
hsa-miR-382-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-382-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-382-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-382-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-382-5p 3,3'-diethyl-9-methylthiacarbocyanine iodide 5351210 NSC96932 sensitive
hsa-miR-382-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-382-5p 3,4-dihydroxy-2-methyl-3,4-bis(p-tolyl)isoquinolin-1-one 387986 NSC682352 sensitive
hsa-miR-382-5p 3h-xanthen-3-one, 2,6,7-trihydroxy-9-(o-hydroxy-phenyl)- 72722 NSC9037 sensitive
hsa-miR-382-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-382-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-382-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-382-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-382-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-382-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-382-5p 4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-3-phenyl-1h-1,2,4-triazol-5-one 9556349 NSC698058 resistant
hsa-miR-382-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-382-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-382-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-382-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-382-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-382-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-382-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-382-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-382-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-382-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-382-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-382-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-382-5p 5-acetyl-6-(2-diethylaminoethylsulfanyl)-1,3-diphenyl-2-thioxo-pyrimidin-4-one NSC707006 resistant
hsa-miR-382-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-382-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-382-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-382-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-382-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-382-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-382-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-382-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-382-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-382-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-382-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-382-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-382-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-382-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-382-5p 7-hydroxy-2-nonyl-4h-chromen-4-one 5375154 NSC631965 sensitive
hsa-miR-382-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-382-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-382-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-382-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-382-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-382-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-382-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-382-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-382-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-382-5p 9-bromo-2,3-dimethoxy-7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-6-one 395805 NSC700693 resistant
hsa-miR-382-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-382-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-382-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-382-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-382-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-382-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-382-5p Antineoplastic-d648114 372647 NSC648114 sensitive
hsa-miR-382-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-382-5p Benzyl n-[5-[(2-methylpropan-2-yl)oxycarbonylamino]-6-[2-[[4-[2-[[2-[(2-methylpropan-2-yl)oxycarbonylamino]-6-(phenylmethoxycarbonylamino)hexanoyl]amino]ethylamino]-9,10-dioxoanthracen-1-yl]amino]ethy 438923 NSC684439 sensitive
hsa-miR-382-5p Berberal 5351462 NSC5355 sensitive
hsa-miR-382-5p Berberine chloride 12456 NSC163088 sensitive
hsa-miR-382-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-382-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-382-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-382-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-382-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-382-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-382-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-382-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-382-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-382-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-382-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-382-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-382-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-382-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-382-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-382-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-382-5p Fixierer p 70397 NSC63839 resistant
hsa-miR-382-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-382-5p Gtpl10345 378629 NSC661421 resistant
hsa-miR-382-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-382-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-382-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-382-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-382-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-382-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-382-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-382-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-382-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-382-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-382-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-382-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-382-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-382-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-382-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-382-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-382-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-382-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-382-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-382-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-382-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-382-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-382-5p Musennin 267361 NSC106554 sensitive
hsa-miR-382-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-382-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-382-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-382-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-382-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-382-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-382-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-382-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-382-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-382-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-382-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-382-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-382-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-382-5p NSC372474 NSC372474 resistant
hsa-miR-382-5p NSC636476 NSC636476 sensitive
hsa-miR-382-5p NSC670163 NSC670163 sensitive
hsa-miR-382-5p NSC751830 NSC751830 resistant
hsa-miR-382-5p Oxidanium;1,3-diphenylpropane-1,3-dione;neodymium(3+);hydroxide 24202397 NSC647042 sensitive
hsa-miR-382-5p Paucin 282787 NSC136722 resistant
hsa-miR-382-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-382-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-382-5p Phosphonium, 1,8-octanediylbis[triphenyl-, diiodide 382552 NSC670162 sensitive
hsa-miR-382-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-382-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-382-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-382-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-382-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-382-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-382-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 sensitive
hsa-miR-382-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-382-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-382-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-382-5p Sb-236687 17892742 NSC756422 resistant
hsa-miR-382-5p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-382-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-382-5p Stl298328 387753 NSC681782 resistant
hsa-miR-382-5p Stl323102 375895 NSC656208 resistant
hsa-miR-382-5p Stl361983 256661 NSC83715 resistant
hsa-miR-382-5p Stl434863 394348 NSC697730 resistant
hsa-miR-382-5p Stl523755 334956 NSC342610 sensitive
hsa-miR-382-5p Suavedol 65631 NSC141545 resistant
hsa-miR-382-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-382-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-382-5p Tetrocarcin a, sodium salt 6474412 NSC333856 sensitive
hsa-miR-382-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-382-5p Tris(1,10-phenanthroline)lanthanum(iii)-trithiocyanate 24202211 NSC632737 resistant
hsa-miR-382-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-382-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-382-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-382-5p Etoposide 36462 NSC141540 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-382-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-382-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-382-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-382-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-382-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-382-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-382-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-382-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-382-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-382-5p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-382-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-382-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-382-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-382-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-382-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-382-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-382-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-382-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-382-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-382-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (T24)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-382-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-382-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-382-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission