pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol SIN3A   
Synonyms WITKOS
Description SIN3 transcription regulator family member A
Transcript NM_001145357   
Other Transcripts NM_001145358 , NM_015477   
Expression
Putative miRNA Targets on SIN3A
3'UTR of SIN3A
(miRNA target sites are highlighted)
>SIN3A|NM_001145357|3'UTR
   1 CTGCAAAGCCAGAGCAGATAACTTGGGGTGTGTGTGGGGATGTGTGTGTGGGCCTATGCACTCACACACTGAAGAAACAA
  81 GGAAGATGCCTTTCAAGCCTCACTGGGCCTCTCTGGGACATGGCCACCTGACCTGTGTGTGGCTGGTGCAGCCTGGCACC
 161 AAGTGGGCTACCTGTTAGGAACATGAATACCTTACAAAGCTGAAGCTGGAACTTTTCCCAAAGGGTTTTGGGTATAGCCT
 241 GCCCTGGAGGGGAAGGAAGTCCATGCAAGCAAAGACATGCAGTTTGCTTGCACACACCAGCAGAGCTAAGACTGGAGTCT
 321 CCTGTGGCCTAACTTTCAATGAGGGAACCGGATGCTGTTCACACTTTGACTGGATGGAGATGCATTTACAAAACAGACTG
 401 GAGAAGGACTTAATACTCAGATGGATTGGAACTATCATGGTCACTGCTCCTCTCCCCTCCCCACAAAAGGAAAAAAAAGC
 481 TGGATTTGATTTTTTTTTTCTGGTCACTCGAGCACATCTAAGATCACCCATTAGGTTTTATCTGGGACCTGCAGTTTGGC
 561 TTTGGGATTGATCATCTTGTGGATTTTATTCCTGACGATTCCCTTGCTGCCTACCCTTTTCTCTCCTCTGGTTCTCAACC
 641 TCAACGAGTTCAAATCAGTTGTCCTTTTTAGCTCCCGTGGAACTGTTTTGTATCTGCCTCTTTACTAGTCTACCTTAGTG
 721 CCATCCACCAGCTTTACTCTCTGACACACACACGCACACACACACACAATTTTAACTTGTTTTTTTGTACATAATGTACA
 801 TACTGTCAATTTTTTATTAAAAGAAATATGCTTTGATGTGCTAGCATAACTGCTCTAGCTTCTTGTGTACCATAGTACTG
 881 TGGCTTCAGATTTAGTACCTATGAACAGATGTACAAGACATTTATTACACTTTTTACCAAAGGGAGTTACCATTGTAGTA
 961 CTTTTGTGTAAAACTTGTCTTCCCCTTTGCCCCCAACTTTTTTTTTTTTTTTTTTGTAAATAAATAAAGCTTGGTTCTTA
1041 CTTAAGGAATAAACTCTCAACCCACGTCCCTTGTCCTCACCAGAAAATACTGTGAAGCAGGGATTTTGACTTCAGTTCCT
1121 TATCCAGGGTAGAAACAGGATTTTGCTTAAAATACTTGTTACTTGTCCCAAATCAAAATATTCCAAAATCTTAGAATACT
1201 TAAGTCTTTTAGTACGTGTTTTTTTCCCTTGTTCAAATAATCTGAAAATATTTTATATTTGGGTAAGTTGTCAAGCTATG
1281 TAGTTTGTATTTCTATATATTTTTTCTTATTCACATTGGTGATGGATGGGGGTGAGCAACTTAAATACCAAACCAGTGTT
1361 TGAAAAAAAAGTGTGCATAAGGCATGTGGTATACCTTATAAATGGAGTTGGGAGGGAGAGAATTTGAAATGGGATACCTA
1441 TTTTTTTAATTACATAAATTTAAACTAGCAGACATTTAAACATGAATGATTAGGATTTTTCTATGTGGTTAACCTGGACT
1521 TTCTGAACAAAGACCAACTGAGCCCCTCCCAGTACTCTGGTGGATTTTTCTTCAGCAACCATTACGCAAGTCTTAGTTGT
1601 AACCAGCAATGTTCTGTGTGTTTTATGTTTGCTTTTTAGTTAAAAATCACCACCACCACCAAAAAGAAAAACAAAATTTT
1681 TTGGCTCCTGGATTTTCAAAACACATGGTAGACCTCTCTGATTTTAGGCTTTTATTGTTTAAAGACAGTGTCTCGCTTTA
1761 TGACCCACACTGGAGTGCAGTGCCACGATCATAGCTCACTGCAGGCTTGACCTCCCAGGCTCAAGCAGTCCTCCCACCTC
1841 GGCCTCCTGAGTAGCTGCATGCCACCACGCCCAGCTAATTTTTTAACTTTTTGTAGAGACAGGGTCTTGCTATGCTGCCC
1921 AGGTTGGTCTCAAACTCCTGGCCTCAAGCTGTCCTCCCACCTCGGCCTCGCAAAGTGCTGAGATTACAGGTGTGAGCCAC
2001 CCTGGCCTGATTTTAGGCTTTTTTTGTACTGGGGAGAAGAGACTGTGAGCCAAAGTGTAGGGTGCCAAAAAGAGCTTTGT
2081 GGGATGAGATTTTAGGGCAAAGCTGGGGCAGTGTCTGACTTGGCGGTGGTCATGTGTACTGATTTAGGGGAAAGATCTTG
2161 AGGTTTTCTCAAATAATTCACCTATCCCCGTGTTCCCTCAAGAAAGGTCATGTTGACCTGGAACCATAGGGGAAATTGGT
2241 GGGGTGTGATCAGGGTCAGCCCCAGCTGTTGCTGCCCCTGCAGTGTTTTGTCCAGAGCACTTGCCTGCAGGTCAGGATAG
2321 GATTTCAAGGCCAGTTCAGGAGAAAGTCCCAACCCACCAGTGCAACCAACAAAAGAGTAAGTTTTACCTACAGCCTGGGT
2401 TTTCACAAGTAGCATTTTTATTCCTCCTGCTGTCTGACATCTGAGCTCCAAGCTCTAAACCCAACCTGTATTATATGCAG
2481 CAGCAGGTTATCTTTGTTTTAAATCACATTTGTTATTCTGTACTTAGTCACCTTTCCGTGTGATCTGCATTTGAAATGTT
2561 GTAAACTTGGTCAGTATTTCCATTAAAATATCAGGGCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUCGGCGAC----AGUGUGCGUGUc 5'
            | :| |||     |||||||||| 
Target 5' ttACTCTCTGACACACACACGCACAc 3'
734 - 759 158.00 -18.30
2
miRNA  3' agUCGGCG-ACAGU-GUGCGUGUc 5'
            |||:|| || || ||||| || 
Target 5' gtAGCTGCATGCCACCACGCCCAg 3'
1851 - 1874 140.00 -23.90
3
miRNA  3' agucGGCGACAGUG-UGCGUGUc 5'
              :|||| |:|: || |||| 
Target 5' tgtcTCGCT-TTATGACCCACAc 3'
1749 - 1770 125.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31565986 31 COSMIC
COSN31505344 37 COSMIC
COSN27010577 49 COSMIC
COSN30498268 69 COSMIC
COSN15660756 71 COSMIC
COSN24942068 88 COSMIC
COSN30162468 101 COSMIC
COSN20078238 161 COSMIC
COSN31599498 189 COSMIC
COSN17362186 206 COSMIC
COSN7248687 295 COSMIC
COSN17118745 509 COSMIC
COSN32063630 596 COSMIC
COSN23358104 755 COSMIC
COSN31485678 825 COSMIC
COSN25721444 869 COSMIC
COSN20112267 998 COSMIC
COSN31546872 1031 COSMIC
COSN31569993 1049 COSMIC
COSN31769885 1081 COSMIC
COSN31769884 1645 COSMIC
COSN5756587 1822 COSMIC
COSN31769883 1828 COSMIC
COSN1684447 1859 COSMIC
COSN30076075 1912 COSMIC
COSN31769882 1941 COSMIC
COSN8176635 1954 COSMIC
COSN31769877 1970 COSMIC
COSN31769871 1981 COSMIC
COSN28834806 2004 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200047225 4 dbSNP
rs200990835 9 dbSNP
rs1259981743 11 dbSNP
rs201719222 13 dbSNP
rs752842414 15 dbSNP
rs1467246109 16 dbSNP
rs982995156 18 dbSNP
rs765341672 25 dbSNP
rs1229767675 26 dbSNP
rs547340922 29 dbSNP
rs532469957 30 dbSNP
rs964054392 32 dbSNP
rs375599457 33 dbSNP
rs754066713 35 dbSNP
rs766248420 38 dbSNP
rs760381385 39 dbSNP
rs750282597 40 dbSNP
rs1369600271 46 dbSNP
rs773259322 48 dbSNP
rs767369178 49 dbSNP
rs764854469 51 dbSNP
rs1462598710 53 dbSNP
rs548132893 53 dbSNP
rs564424171 56 dbSNP
rs1163747937 63 dbSNP
rs763714161 70 dbSNP
rs1384189958 77 dbSNP
rs771207052 78 dbSNP
rs1445369354 82 dbSNP
rs1320053372 96 dbSNP
rs1342546085 99 dbSNP
rs62029732 101 dbSNP
rs1292984248 102 dbSNP
rs1280815410 107 dbSNP
rs546229127 111 dbSNP
rs1235272545 115 dbSNP
rs1344538859 115 dbSNP
rs1025763919 120 dbSNP
rs144550283 133 dbSNP
rs1231100815 137 dbSNP
rs755746193 145 dbSNP
rs971309352 148 dbSNP
rs1186741034 149 dbSNP
rs1429164086 151 dbSNP
rs57737877 163 dbSNP
rs1164899896 168 dbSNP
rs1334213209 178 dbSNP
rs1413605317 180 dbSNP
rs1013095658 182 dbSNP
rs1160287937 183 dbSNP
rs1360927930 185 dbSNP
rs1000000368 191 dbSNP
rs1312478628 194 dbSNP
rs1353827629 205 dbSNP
rs894135147 207 dbSNP
rs563625915 212 dbSNP
rs1054148677 221 dbSNP
rs1000113239 226 dbSNP
rs1335306721 231 dbSNP
rs543833406 236 dbSNP
rs903136699 237 dbSNP
rs1170055325 245 dbSNP
rs140598183 246 dbSNP
rs1210642491 262 dbSNP
rs902991373 264 dbSNP
rs1486451591 277 dbSNP
rs1181877095 278 dbSNP
rs933801319 281 dbSNP
rs922445738 286 dbSNP
rs1020160489 287 dbSNP
rs1389260502 288 dbSNP
rs1014123646 292 dbSNP
rs895519208 295 dbSNP
rs984124723 305 dbSNP
rs951622398 316 dbSNP
rs187952531 317 dbSNP
rs757112876 324 dbSNP
rs1395820782 335 dbSNP
rs982772167 338 dbSNP
rs1210874242 339 dbSNP
rs1378330443 348 dbSNP
rs752253829 349 dbSNP
rs1301720750 352 dbSNP
rs1314367919 353 dbSNP
rs1210383539 364 dbSNP
rs574917062 367 dbSNP
rs1278491935 380 dbSNP
rs898932117 384 dbSNP
rs77725500 391 dbSNP
rs1191727438 397 dbSNP
rs1396655744 407 dbSNP
rs764160332 416 dbSNP
rs1433594861 422 dbSNP
rs991237570 424 dbSNP
rs541281881 436 dbSNP
rs1037826413 437 dbSNP
rs1343334558 440 dbSNP
rs577132088 441 dbSNP
rs941514110 444 dbSNP
rs1372740602 449 dbSNP
rs908709068 453 dbSNP
rs558235290 454 dbSNP
rs1333450407 457 dbSNP
rs558866226 461 dbSNP
rs1295288189 464 dbSNP
rs1213368878 469 dbSNP
rs1381944456 470 dbSNP
rs1285253278 471 dbSNP
rs1401589950 471 dbSNP
rs1446694377 477 dbSNP
rs1440803297 478 dbSNP
rs1324550936 479 dbSNP
rs141122648 479 dbSNP
rs1370143753 480 dbSNP
rs1220229424 483 dbSNP
rs934220505 488 dbSNP
rs922618178 496 dbSNP
rs1305443526 500 dbSNP
rs767339561 500 dbSNP
rs975457385 502 dbSNP
rs964362357 504 dbSNP
rs536646765 509 dbSNP
rs569338410 510 dbSNP
rs554353369 511 dbSNP
rs145139026 514 dbSNP
rs1261219665 540 dbSNP
rs1426974043 544 dbSNP
rs796886802 545 dbSNP
rs1181168244 557 dbSNP
rs998523994 558 dbSNP
rs1163378346 559 dbSNP
rs1474922971 566 dbSNP
rs1437588066 568 dbSNP
rs56757384 573 dbSNP
rs1288664051 579 dbSNP
rs1360380504 583 dbSNP
rs1401453563 589 dbSNP
rs1333495519 597 dbSNP
rs900992029 600 dbSNP
rs1291884287 601 dbSNP
rs978775204 614 dbSNP
rs967221849 621 dbSNP
rs183206312 622 dbSNP
rs1240132262 623 dbSNP
rs942784217 626 dbSNP
rs888563832 631 dbSNP
rs1483502286 634 dbSNP
rs1048468717 640 dbSNP
rs565708519 644 dbSNP
rs895713587 645 dbSNP
rs982374481 646 dbSNP
rs949693695 661 dbSNP
rs1034655330 663 dbSNP
rs1001219889 664 dbSNP
rs1298373315 669 dbSNP
rs1354459466 671 dbSNP
rs1412307805 676 dbSNP
rs991431549 677 dbSNP
rs898790933 689 dbSNP
rs1379335664 699 dbSNP
rs755623260 705 dbSNP
rs1223142403 707 dbSNP
rs547570362 708 dbSNP
rs1037496230 709 dbSNP
rs866669776 710 dbSNP
rs1282114246 712 dbSNP
rs1355558668 714 dbSNP
rs958201309 717 dbSNP
rs940415662 718 dbSNP
rs1485472332 721 dbSNP
rs1291226843 739 dbSNP
rs1239277285 743 dbSNP
rs1473187950 748 dbSNP
rs752272290 749 dbSNP
rs759085083 752 dbSNP
rs1047246035 753 dbSNP
rs1020398755 754 dbSNP
rs767194668 754 dbSNP
rs934124195 754 dbSNP
rs922891460 756 dbSNP
rs901124650 758 dbSNP
rs1018098021 760 dbSNP
rs538895280 760 dbSNP
rs1006643762 761 dbSNP
rs1379068132 762 dbSNP
rs888281239 764 dbSNP
rs1349467066 767 dbSNP
rs1296039323 768 dbSNP
rs199688678 768 dbSNP
rs143718821 769 dbSNP
rs747009078 769 dbSNP
rs760053259 769 dbSNP
rs897139017 769 dbSNP
rs540750940 771 dbSNP
rs1350183389 782 dbSNP
rs1203948698 783 dbSNP
rs1164007514 787 dbSNP
rs1459489716 787 dbSNP
rs1179879842 790 dbSNP
rs1281802044 791 dbSNP
rs774215422 794 dbSNP
rs112103821 799 dbSNP
rs1394852014 805 dbSNP
rs925943583 826 dbSNP
rs1046875599 827 dbSNP
rs949655474 829 dbSNP
rs1161433634 846 dbSNP
rs916785362 850 dbSNP
rs1402303426 852 dbSNP
rs1447414318 854 dbSNP
rs1472931410 855 dbSNP
rs561610792 857 dbSNP
rs571555204 857 dbSNP
rs1368482921 858 dbSNP
rs978848693 872 dbSNP
rs1235167125 874 dbSNP
rs11551123 879 dbSNP
rs967421443 885 dbSNP
rs149497862 889 dbSNP
rs936799559 893 dbSNP
rs992636732 907 dbSNP
rs774947738 913 dbSNP
rs190562920 914 dbSNP
rs1034277066 924 dbSNP
rs1247645852 944 dbSNP
rs1001857425 950 dbSNP
rs967555112 962 dbSNP
rs1201508884 964 dbSNP
rs963112676 990 dbSNP
rs759107258 994 dbSNP
rs1269521657 995 dbSNP
rs1228492271 996 dbSNP
rs1315766429 998 dbSNP
rs912894077 998 dbSNP
rs1304418574 1000 dbSNP
rs1474887069 1003 dbSNP
rs1388090243 1012 dbSNP
rs1368109595 1013 dbSNP
rs1164066141 1016 dbSNP
rs1237928476 1016 dbSNP
rs1323981461 1016 dbSNP
rs1325699366 1016 dbSNP
rs1425149998 1016 dbSNP
rs1465731287 1016 dbSNP
rs398027970 1016 dbSNP
rs59183656 1016 dbSNP
rs79194450 1017 dbSNP
rs369832825 1018 dbSNP
rs1438673792 1021 dbSNP
rs530902296 1022 dbSNP
rs1015926659 1023 dbSNP
rs899842301 1025 dbSNP
rs1004660676 1029 dbSNP
rs1354868799 1030 dbSNP
rs1017504528 1037 dbSNP
rs1321096776 1039 dbSNP
rs1211947206 1041 dbSNP
rs1291024852 1045 dbSNP
rs1446856513 1049 dbSNP
rs1191026166 1050 dbSNP
rs886208788 1050 dbSNP
rs1051482929 1052 dbSNP
rs1186607851 1058 dbSNP
rs1457841950 1063 dbSNP
rs998372929 1065 dbSNP
rs901298379 1066 dbSNP
rs766043377 1078 dbSNP
rs1383929133 1089 dbSNP
rs137986718 1091 dbSNP
rs186543338 1098 dbSNP
rs1435127039 1103 dbSNP
rs1342645898 1110 dbSNP
rs926005035 1119 dbSNP
rs762951761 1120 dbSNP
rs1043020068 1130 dbSNP
rs1338838618 1155 dbSNP
rs946025289 1157 dbSNP
rs913330175 1160 dbSNP
rs113195221 1165 dbSNP
rs1285347029 1167 dbSNP
rs773074259 1172 dbSNP
rs959900630 1184 dbSNP
rs1193381957 1186 dbSNP
rs1026801496 1188 dbSNP
rs1488427228 1189 dbSNP
rs1209774106 1197 dbSNP
rs530217970 1203 dbSNP
rs1250473827 1204 dbSNP
rs1425108081 1206 dbSNP
rs1209829864 1209 dbSNP
rs559651904 1210 dbSNP
rs897266846 1215 dbSNP
rs1485265767 1216 dbSNP
rs927113857 1218 dbSNP
rs541219573 1220 dbSNP
rs577072714 1223 dbSNP
rs1420512316 1224 dbSNP
rs1302525075 1226 dbSNP
rs1400149115 1226 dbSNP
rs895168042 1226 dbSNP
rs1335368256 1227 dbSNP
rs1376857748 1247 dbSNP
rs565217438 1255 dbSNP
rs1311891377 1264 dbSNP
rs1354921415 1272 dbSNP
rs769704165 1274 dbSNP
rs1302473005 1278 dbSNP
rs1483913474 1280 dbSNP
rs1231847807 1285 dbSNP
rs541290419 1289 dbSNP
rs1200537746 1295 dbSNP
rs11551122 1306 dbSNP
rs543741252 1308 dbSNP
rs1367011774 1310 dbSNP
rs936936331 1315 dbSNP
rs1456403014 1319 dbSNP
rs575915232 1322 dbSNP
rs572569266 1331 dbSNP
rs554572885 1335 dbSNP
rs1384436101 1336 dbSNP
rs748292890 1337 dbSNP
rs1030090528 1344 dbSNP
rs997673381 1347 dbSNP
rs945806591 1355 dbSNP
rs1287162635 1371 dbSNP
rs912938371 1371 dbSNP
rs1491321356 1372 dbSNP
rs901374721 1373 dbSNP
rs535919886 1374 dbSNP
rs1007166205 1381 dbSNP
rs572115428 1395 dbSNP
rs1043258286 1399 dbSNP
rs1452972317 1412 dbSNP
rs1386577821 1415 dbSNP
rs1298654943 1420 dbSNP
rs776672855 1421 dbSNP
rs985329159 1430 dbSNP
rs952672586 1439 dbSNP
rs1332379673 1440 dbSNP
rs1189845762 1441 dbSNP
rs1026769995 1448 dbSNP
rs994374046 1449 dbSNP
rs1259104897 1455 dbSNP
rs961239930 1457 dbSNP
rs1189286523 1466 dbSNP
rs1265476626 1468 dbSNP
rs768947113 1468 dbSNP
rs766632326 1485 dbSNP
rs1177108970 1486 dbSNP
rs553950419 1503 dbSNP
rs913194324 1506 dbSNP
rs1401667791 1508 dbSNP
rs1057252715 1509 dbSNP
rs1292167812 1516 dbSNP
rs1370238881 1519 dbSNP
rs538833471 1522 dbSNP
rs552806890 1523 dbSNP
rs1277249187 1528 dbSNP
rs571493430 1530 dbSNP
rs1208207148 1533 dbSNP
rs1219944730 1537 dbSNP
rs1344116735 1542 dbSNP
rs1219347139 1548 dbSNP
rs1266960043 1552 dbSNP
rs1298052680 1557 dbSNP
rs1226651257 1563 dbSNP
rs1395559725 1570 dbSNP
rs1013685117 1571 dbSNP
rs538923937 1576 dbSNP
rs938753846 1580 dbSNP
rs1195972055 1583 dbSNP
rs1314712391 1585 dbSNP
rs28391007 1586 dbSNP
rs980363451 1596 dbSNP
rs780472269 1604 dbSNP
rs1312514524 1607 dbSNP
rs1458786170 1608 dbSNP
rs909137465 1609 dbSNP
rs1358231982 1614 dbSNP
rs1433080952 1620 dbSNP
rs1278257707 1621 dbSNP
rs1372867066 1626 dbSNP
rs983329946 1628 dbSNP
rs1314838828 1645 dbSNP
rs1322039908 1648 dbSNP
rs34967016 1652 dbSNP
rs763396315 1655 dbSNP
rs1461966773 1657 dbSNP
rs1487442896 1662 dbSNP
rs1029994023 1663 dbSNP
rs1190141253 1667 dbSNP
rs550081730 1671 dbSNP
rs964797968 1672 dbSNP
rs112471099 1673 dbSNP
rs1416603625 1676 dbSNP
rs1042669518 1677 dbSNP
rs181972110 1681 dbSNP
rs1158446764 1684 dbSNP
rs1378911112 1687 dbSNP
rs538151548 1688 dbSNP
rs191872675 1699 dbSNP
rs1358059505 1701 dbSNP
rs1041161778 1706 dbSNP
rs758637546 1709 dbSNP
rs1379846537 1716 dbSNP
rs746225590 1718 dbSNP
rs1195027575 1740 dbSNP
rs1021833422 1746 dbSNP
rs1337164245 1749 dbSNP
rs1010440254 1754 dbSNP
rs1267155492 1762 dbSNP
rs891827991 1766 dbSNP
rs1335619730 1768 dbSNP
rs773667376 1769 dbSNP
rs1057437506 1770 dbSNP
rs1292747293 1773 dbSNP
rs910887311 1773 dbSNP
rs938675301 1783 dbSNP
rs985128792 1784 dbSNP
rs1378852796 1786 dbSNP
rs930989307 1787 dbSNP
rs1158731280 1788 dbSNP
rs548574399 1791 dbSNP
rs905958688 1797 dbSNP
rs961475465 1800 dbSNP
rs1359284893 1801 dbSNP
rs1044452305 1804 dbSNP
rs112457783 1805 dbSNP
rs1329732839 1809 dbSNP
rs577901097 1811 dbSNP
rs941845414 1812 dbSNP
rs576434692 1818 dbSNP
rs1280287742 1826 dbSNP
rs909044537 1827 dbSNP
rs992634710 1829 dbSNP
rs779634216 1830 dbSNP
rs959481898 1831 dbSNP
rs1165567020 1832 dbSNP
rs1033671950 1833 dbSNP
rs530083556 1840 dbSNP
rs879552080 1841 dbSNP
rs559796776 1847 dbSNP
rs1245719517 1849 dbSNP
rs1000833291 1853 dbSNP
rs1192607928 1857 dbSNP
rs929193012 1859 dbSNP
rs757809706 1868 dbSNP
rs752302732 1869 dbSNP
rs976170762 1871 dbSNP
rs964380971 1875 dbSNP
rs1009833629 1877 dbSNP
rs1017778354 1879 dbSNP
rs1473257036 1880 dbSNP
rs556587373 1885 dbSNP
rs1434579381 1890 dbSNP
rs1276892453 1893 dbSNP
rs901993366 1898 dbSNP
rs1218099157 1899 dbSNP
rs1040568509 1903 dbSNP
rs979163689 1906 dbSNP
rs1320653705 1909 dbSNP
rs547513168 1912 dbSNP
rs766885048 1913 dbSNP
rs1021736890 1919 dbSNP
rs150735651 1922 dbSNP
rs892067537 1923 dbSNP
rs1269167691 1926 dbSNP
rs1334036630 1937 dbSNP
rs1035920198 1938 dbSNP
rs1003293503 1939 dbSNP
rs565154567 1940 dbSNP
rs1477169652 1943 dbSNP
rs919607228 1945 dbSNP
rs186102999 1948 dbSNP
rs973047978 1951 dbSNP
rs1475684778 1952 dbSNP
rs770290076 1963 dbSNP
rs141162914 1964 dbSNP
rs1406894878 1966 dbSNP
rs1280373498 1969 dbSNP
rs1044915927 1970 dbSNP
rs1366464143 1972 dbSNP
rs1399428872 1975 dbSNP
rs1276361468 1980 dbSNP
rs1238584528 1988 dbSNP
rs942087200 1996 dbSNP
rs1228787522 1997 dbSNP
rs1284185020 2003 dbSNP
rs754686827 2009 dbSNP
rs1212006163 2021 dbSNP
rs1291997503 2026 dbSNP
rs917739325 2026 dbSNP
rs992038686 2029 dbSNP
rs1325904105 2030 dbSNP
rs1264705693 2031 dbSNP
rs536642668 2032 dbSNP
rs1394420100 2036 dbSNP
rs1186683167 2041 dbSNP
rs1047575618 2044 dbSNP
rs1458367424 2046 dbSNP
rs1387213425 2048 dbSNP
rs1408006590 2048 dbSNP
rs1033724194 2050 dbSNP
rs556085475 2052 dbSNP
rs180711735 2053 dbSNP
rs1248557776 2055 dbSNP
rs979529144 2058 dbSNP
rs1316139456 2061 dbSNP
rs1353526842 2064 dbSNP
rs190002288 2070 dbSNP
rs1468279978 2077 dbSNP
rs1350686962 2084 dbSNP
rs968010235 2085 dbSNP
rs1194007617 2095 dbSNP
rs537446734 2098 dbSNP
rs975988324 2108 dbSNP
rs1020981273 2117 dbSNP
rs1210449670 2119 dbSNP
rs1184179178 2124 dbSNP
rs943029775 2133 dbSNP
rs1437654139 2141 dbSNP
rs1157020459 2144 dbSNP
rs1365763632 2148 dbSNP
rs910214828 2151 dbSNP
rs569124776 2153 dbSNP
rs967753901 2157 dbSNP
rs913631770 2162 dbSNP
rs988954159 2165 dbSNP
rs766209773 2173 dbSNP
rs1019625457 2178 dbSNP
rs1455020219 2178 dbSNP
rs138541719 2181 dbSNP
rs1317167192 2182 dbSNP
rs1235514601 2183 dbSNP
rs577876091 2189 dbSNP
rs762793399 2190 dbSNP
rs970497852 2192 dbSNP
rs1437889506 2195 dbSNP
rs556413869 2199 dbSNP
rs1257362059 2202 dbSNP
rs1456227333 2205 dbSNP
rs1006332207 2210 dbSNP
rs1252861946 2213 dbSNP
rs184746310 2215 dbSNP
rs1047813828 2223 dbSNP
rs111639964 2227 dbSNP
rs772986086 2229 dbSNP
rs1398645942 2230 dbSNP
rs1471006566 2234 dbSNP
rs939924817 2241 dbSNP
rs1403936601 2243 dbSNP
rs917808548 2244 dbSNP
rs1300243438 2248 dbSNP
rs1056786310 2255 dbSNP
rs937803411 2259 dbSNP
rs765209405 2262 dbSNP
rs1385873331 2276 dbSNP
rs926453946 2298 dbSNP
rs144596264 2299 dbSNP
rs1223597221 2301 dbSNP
rs761690239 2303 dbSNP
rs1380154326 2308 dbSNP
rs1277439545 2310 dbSNP
rs901634830 2314 dbSNP
rs776724078 2317 dbSNP
rs768551412 2327 dbSNP
rs1316010400 2330 dbSNP
rs1206593644 2337 dbSNP
rs1251640375 2341 dbSNP
rs1488071941 2342 dbSNP
rs1040730902 2343 dbSNP
rs1209409848 2348 dbSNP
rs1265544221 2358 dbSNP
rs1481438969 2360 dbSNP
rs943291021 2363 dbSNP
rs968146635 2365 dbSNP
rs910235611 2368 dbSNP
rs747273019 2369 dbSNP
rs913887307 2375 dbSNP
rs988127930 2376 dbSNP
rs1291360601 2377 dbSNP
rs536631534 2378 dbSNP
rs557623370 2379 dbSNP
rs1337824129 2383 dbSNP
rs1445310806 2383 dbSNP
rs1282741024 2385 dbSNP
rs1216248370 2389 dbSNP
rs1296228695 2390 dbSNP
rs1320824527 2395 dbSNP
rs1242386412 2396 dbSNP
rs1019171660 2406 dbSNP
rs946358911 2412 dbSNP
rs1347692377 2419 dbSNP
rs1223555548 2427 dbSNP
rs1262564486 2436 dbSNP
rs568300170 2436 dbSNP
rs1188743716 2437 dbSNP
rs1420853413 2438 dbSNP
rs1231314252 2440 dbSNP
rs1131738 2441 dbSNP
rs1423560239 2442 dbSNP
rs1363246709 2451 dbSNP
rs913664276 2452 dbSNP
rs565974844 2453 dbSNP
rs1270078611 2465 dbSNP
rs1424862620 2468 dbSNP
rs1428078022 2471 dbSNP
rs547452156 2474 dbSNP
rs778257096 2487 dbSNP
rs956444231 2491 dbSNP
rs371358131 2493 dbSNP
rs898278143 2496 dbSNP
rs1394273178 2500 dbSNP
rs982131170 2502 dbSNP
rs970316805 2504 dbSNP
rs1023198883 2506 dbSNP
rs1373438937 2508 dbSNP
rs1037196867 2509 dbSNP
rs1246974394 2509 dbSNP
rs1006238937 2512 dbSNP
rs1285593518 2512 dbSNP
rs1315133550 2523 dbSNP
rs1218077888 2526 dbSNP
rs1170223919 2527 dbSNP
rs1243150784 2527 dbSNP
rs951992378 2529 dbSNP
rs1003841997 2534 dbSNP
rs1410271742 2537 dbSNP
rs1026400790 2538 dbSNP
rs1157608259 2543 dbSNP
rs1378134133 2545 dbSNP
rs993576422 2554 dbSNP
rs371419213 2563 dbSNP
rs1358113115 2569 dbSNP
rs550789810 2575 dbSNP
rs1445727323 2576 dbSNP
rs1338686582 2583 dbSNP
rs1056364987 2588 dbSNP
rs1445776728 2589 dbSNP
rs16967090 2591 dbSNP
rs901705718 2594 dbSNP
rs1371481340 2596 dbSNP
rs926422690 2597 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.623 0 -0.664 0 18 Click to see details
LUSC 0.296 0.04 0.402 0.01 38 Click to see details
BRCA -0.179 0.05 -0.185 0.05 84 Click to see details
THCA 0.202 0.06 0.228 0.04 59 Click to see details
LIHC 0.208 0.08 0.161 0.13 49 Click to see details
PRAD 0.204 0.08 0.122 0.2 50 Click to see details
LUAD -0.301 0.17 -0.392 0.1 12 Click to see details
PCPG 0.823 0.19 1.000 0.5 3 Click to see details
ESCA -0.271 0.21 -0.200 0.28 11 Click to see details
STAD -0.119 0.26 -0.096 0.3 32 Click to see details
PAAD 0.48 0.26 0.000 0.5 4 Click to see details
COAD -0.268 0.26 -0.429 0.14 8 Click to see details
HNSC -0.096 0.27 -0.060 0.35 42 Click to see details
KIRC 0.051 0.34 0.038 0.38 68 Click to see details
UCEC 0.082 0.37 0.119 0.31 19 Click to see details
CHOL 0.101 0.4 0.033 0.47 9 Click to see details
CESC -0.314 0.4 -0.500 0.33 3 Click to see details
KICH 0.048 0.41 0.011 0.48 25 Click to see details
KIRP 0.012 0.47 -0.098 0.3 32 Click to see details
KIRP 0.012 0.47 -0.098 0.3 32 Click to see details
KIRP 0.012 0.47 -0.098 0.3 32 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission