miRTarBase - #MIRT439727


—
pre-miRNA Information
pre-miRNA hsa-mir-544a   
Genomic Coordinates chr14: 101048658 - 101048748
Description Homo sapiens miR-544a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-544a
Sequence 55| AUUCUGCAUUUUUAGCAAGUUC |76
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1286637864 5 dbSNP
rs1394789797 9 dbSNP
rs1172200176 17 dbSNP
Putative Targets

Gene Information
Gene Symbol RPS6   
Synonyms S6
Description ribosomal protein S6
Transcript NM_001010   
Expression
Putative miRNA Targets on RPS6
3'UTR of RPS6
(miRNA target sites are highlighted)		 
>RPS6|NM_001010|3'UTR
   1 GATTTTTTGAGTAACAAATAAATAAGATCAGACTCTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26993339 1 COSMIC
COSN30152106 1 COSMIC
COSN8892665 9 COSMIC
COSN31511629 26 COSMIC
COSN14386693 29 COSMIC
COSN31591789 31 COSMIC
COSN30157218 35 COSMIC
COSN22734571 42 COSMIC
COSN28191719 124 COSMIC
COSN2314926 334 COSMIC
rs67906804 33 GWAS
rs67710536 36 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1012019872 1 dbSNP
rs1439605729 2 dbSNP
rs553421652 3 dbSNP
rs777831669 4 dbSNP
rs760802711 11 dbSNP
rs773586781 12 dbSNP
rs772673878 14 dbSNP
rs562946854 15 dbSNP
rs768929394 16 dbSNP
rs1442525977 17 dbSNP
rs1291097398 18 dbSNP
rs745442351 22 dbSNP
rs757445661 26 dbSNP
rs758470032 26 dbSNP
rs933881985 27 dbSNP
rs369681273 29 dbSNP
rs765126928 29 dbSNP
rs67906804 33 dbSNP
rs759052038 33 dbSNP
rs1055228895 34 dbSNP
rs781008957 35 dbSNP
rs67710536 36 dbSNP
rs1234635351 37 dbSNP
rs746587364 37 dbSNP
rs1279298293 38 dbSNP
rs1375985279 39 dbSNP
rs1351922977 45 dbSNP
rs758411939 46 dbSNP
rs1417604031 47 dbSNP
rs1429241953 48 dbSNP
rs753550645 49 dbSNP
rs994439195 51 dbSNP
rs367650988 52 dbSNP
rs754802484 56 dbSNP
rs1208072462 70 dbSNP
rs1269573310 73 dbSNP
rs1452058270 74 dbSNP
rs897066932 75 dbSNP
rs937704805 77 dbSNP
rs1038272670 81 dbSNP
rs1441291397 83 dbSNP
rs1159089489 85 dbSNP
rs1255495801 85 dbSNP
rs1384216855 86 dbSNP
rs927621630 87 dbSNP
rs1294726789 89 dbSNP
rs1390868355 92 dbSNP
rs1390357309 97 dbSNP
rs1328745030 105 dbSNP
rs1340687170 106 dbSNP
rs1187439551 109 dbSNP
rs1242765949 114 dbSNP
rs1358920419 115 dbSNP
rs562166683 115 dbSNP
rs1242908398 117 dbSNP
rs941353754 118 dbSNP
rs889798806 122 dbSNP
rs1049779861 124 dbSNP
rs115304926 126 dbSNP
rs1202824643 127 dbSNP
rs113373506 135 dbSNP
rs10119465 147 dbSNP
rs934865885 151 dbSNP
rs1216837257 154 dbSNP
rs926208062 156 dbSNP
rs979020644 157 dbSNP
rs1398660865 158 dbSNP
rs967681458 160 dbSNP
rs1332402807 168 dbSNP
rs775195856 178 dbSNP
rs1394691346 180 dbSNP
rs1315075995 183 dbSNP
rs1292163893 184 dbSNP
rs1017707206 185 dbSNP
rs1256240157 189 dbSNP
rs1356942707 192 dbSNP
rs1199230587 193 dbSNP
rs1296162029 196 dbSNP
rs540173060 197 dbSNP
rs371528908 202 dbSNP
rs1172360367 203 dbSNP
rs1035218830 205 dbSNP
rs1256421748 206 dbSNP
rs1415704671 206 dbSNP
rs551722797 207 dbSNP
rs1190807194 214 dbSNP
rs1425173569 233 dbSNP
rs1467604176 233 dbSNP
rs1171966994 239 dbSNP
rs879137949 243 dbSNP
rs368590261 245 dbSNP
rs1359142444 249 dbSNP
rs1475597670 250 dbSNP
rs897007007 252 dbSNP
rs1464846593 255 dbSNP
rs1030336018 264 dbSNP
rs1380074304 265 dbSNP
rs1399642597 268 dbSNP
rs1276341842 272 dbSNP
rs1016780099 273 dbSNP
rs1342420346 273 dbSNP
rs181741745 274 dbSNP
rs1282546685 275 dbSNP
rs557594963 281 dbSNP
rs1211899946 282 dbSNP
rs897083085 284 dbSNP
rs1485314572 288 dbSNP
rs188634227 291 dbSNP
rs1264929962 292 dbSNP
rs1477847125 295 dbSNP
rs1198132240 296 dbSNP
rs1425074872 296 dbSNP
rs764338890 298 dbSNP
rs1233852284 305 dbSNP
rs1178610260 307 dbSNP
rs914836359 308 dbSNP
rs1207185187 318 dbSNP
rs888261335 318 dbSNP
rs1296559464 320 dbSNP
rs1467513018 325 dbSNP
rs1273156931 326 dbSNP
rs1054912828 328 dbSNP
rs1362755831 328 dbSNP
rs1293024488 329 dbSNP
rs566896294 333 dbSNP
rs1220899449 339 dbSNP
rs3198076 342 dbSNP
rs1352670780 346 dbSNP
rs1237747270 348 dbSNP
rs183996616 348 dbSNP
rs1336385933 353 dbSNP
rs927670712 356 dbSNP
rs981743864 357 dbSNP
rs1244490212 359 dbSNP
rs1373737077 360 dbSNP
rs1487762693 361 dbSNP
rs1299687129 362 dbSNP
rs986828411 368 dbSNP
rs1049727917 370 dbSNP
rs958254007 375 dbSNP
rs1382334052 376 dbSNP
rs138886167 379 dbSNP
rs901255266 382 dbSNP
rs1053637990 383 dbSNP
rs1462015386 384 dbSNP
rs1438748527 385 dbSNP
rs1294014481 387 dbSNP
rs934833989 388 dbSNP
rs1311190175 389 dbSNP
rs1157146060 390 dbSNP
rs1353902107 390 dbSNP
rs1227405687 391 dbSNP
rs1287079283 392 dbSNP
rs1418746860 392 dbSNP
rs954780604 393 dbSNP
rs1221740072 398 dbSNP
rs1254170395 399 dbSNP
rs1457716412 403 dbSNP
rs1177102070 405 dbSNP
rs1240443583 406 dbSNP
rs540996275 410 dbSNP
rs764824143 411 dbSNP
rs1030388263 413 dbSNP
rs1409057516 413 dbSNP
rs993510830 413 dbSNP
rs1165649596 416 dbSNP
rs1399368405 419 dbSNP
rs1464011127 425 dbSNP
rs1043290018 426 dbSNP
rs1333059701 426 dbSNP
rs1447080777 433 dbSNP
rs1180870345 435 dbSNP
rs1282054847 436 dbSNP
rs1380973738 437 dbSNP
rs948957695 441 dbSNP
rs866888528 442 dbSNP
rs566684166 443 dbSNP
rs41270109 444 dbSNP
rs1252906425 447 dbSNP
rs990480599 450 dbSNP
rs1054880829 451 dbSNP
rs1438727287 453 dbSNP
rs71496816 453 dbSNP
rs796408109 453 dbSNP
rs953648286 460 dbSNP
rs1214879338 461 dbSNP
rs1235937493 463 dbSNP
rs1046100822 465 dbSNP
rs1182462007 471 dbSNP
rs1423035745 473 dbSNP
rs1463962185 475 dbSNP
rs1172691306 476 dbSNP
rs1469365482 482 dbSNP
rs1258467397 485 dbSNP
rs1401016774 487 dbSNP
rs1413697687 489 dbSNP
rs960674071 490 dbSNP
rs765854116 492 dbSNP
rs1317115817 496 dbSNP
rs927720701 498 dbSNP
rs1231795821 499 dbSNP
rs1276979924 503 dbSNP
rs1337733490 504 dbSNP
rs1370048551 504 dbSNP
rs972909235 505 dbSNP
rs1054070475 507 dbSNP
rs533298373 511 dbSNP
rs1340764672 512 dbSNP
rs1392913653 521 dbSNP
rs1276963125 523 dbSNP
rs1287171029 528 dbSNP
rs569066805 530 dbSNP
rs1211904718 532 dbSNP
rs761400368 533 dbSNP
rs1453201116 535 dbSNP
rs986306897 536 dbSNP
rs143324464 540 dbSNP
rs923368321 542 dbSNP
rs1477665661 543 dbSNP
rs953957290 543 dbSNP
rs1427048755 548 dbSNP
rs371789176 548 dbSNP
rs1297181075 549 dbSNP
rs1016672226 554 dbSNP
rs548423959 554 dbSNP
rs998179747 555 dbSNP
rs1298278209 557 dbSNP
rs1433185131 558 dbSNP
rs1273399884 559 dbSNP
rs1394863213 559 dbSNP
rs1235536708 561 dbSNP
rs1347537695 561 dbSNP
rs1285575628 565 dbSNP
rs562048924 566 dbSNP
rs1435444381 568 dbSNP
rs1218812121 577 dbSNP
rs1005508191 579 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
139 hsa-miR-544a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053511 BMI1 BMI1 proto-oncogene, polycomb ring finger 4 1
MIRT054802 CDH1 cadherin 1 3 2
MIRT075814 ZCCHC14 zinc finger CCHC-type containing 14 2 3
MIRT125570 SCD stearoyl-CoA desaturase 1 1
MIRT246745 SF1 splicing factor 1 2 2
MIRT259487 TXLNG taxilin gamma 2 2
MIRT307650 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 2 2
MIRT377046 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT386936 STAT3 signal transducer and activator of transcription 3 3 1
MIRT394127 UBQLN1 ubiquilin 1 1 1
MIRT439199 ZNF483 zinc finger protein 483 1 1
MIRT439207 ZNF33A zinc finger protein 33A 1 1
MIRT439262 ZBTB17 zinc finger and BTB domain containing 17 1 1
MIRT439263 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT439281 XAB2 XPA binding protein 2 1 1
MIRT439314 VAT1 vesicle amine transport 1 1 1
MIRT439380 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT439397 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT439419 TMOD1 tropomodulin 1 1 1
MIRT439491 SYT5 synaptotagmin 5 1 1
MIRT439511 STXBP1 syntaxin binding protein 1 1 1
MIRT439586 SMAD7 SMAD family member 7 1 1
MIRT439727 RPS6 ribosomal protein S6 1 1
MIRT439768 RLIM ring finger protein, LIM domain interacting 1 1
MIRT439828 RAD50 RAD50 double strand break repair protein 1 1
MIRT439840 RAB21 RAB21, member RAS oncogene family 1 1
MIRT439846 RAB14 RAB14, member RAS oncogene family 1 1
MIRT439975 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT440031 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT440135 NCOA2 nuclear receptor coactivator 2 1 1
MIRT440173 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT440222 MMP2 matrix metallopeptidase 2 1 1
MIRT440433 IQGAP1 IQ motif containing GTPase activating protein 1 1 1
MIRT440443 INTS3 integrator complex subunit 3 1 1
MIRT440449 INS insulin 1 1
MIRT440512 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440534 GPR56 adhesion G protein-coupled receptor G1 1 1
MIRT440540 GOLGB1 golgin B1 1 1
MIRT440580 GEM GTP binding protein overexpressed in skeletal muscle 1 1
MIRT440629 FNDC3A fibronectin type III domain containing 3A 1 1
MIRT440667 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440680 CCSER1 coiled-coil serine rich protein 1 1 1
MIRT440696 FADS1 fatty acid desaturase 1 1 1
MIRT440761 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT440764 DUSP26 dual specificity phosphatase 26 1 1
MIRT440769 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT440774 DSP desmoplakin 1 1
MIRT440792 DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 1 1
MIRT440801 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 1 1
MIRT440888 CPE carboxypeptidase E 1 1
MIRT440923 CLTC clathrin heavy chain 1 1
MIRT440950 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT440993 CC2D2A coiled-coil and C2 domain containing 2A 1 1
MIRT441014 CAPN3 calpain 3 1 1
MIRT441106 BRD4 bromodomain containing 4 1 1
MIRT441144 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT441173 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT441258 ADM adrenomedullin 1 1
MIRT441279 ACTB actin beta 2 5
MIRT441298 ACACB acetyl-CoA carboxylase beta 1 1
MIRT443751 SLC7A14 solute carrier family 7 member 14 2 2
MIRT450469 TRMT5 tRNA methyltransferase 5 2 4
MIRT450852 HMGN2 high mobility group nucleosomal binding domain 2 2 6
MIRT454152 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT465705 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT466121 TMEM170A transmembrane protein 170A 2 2
MIRT471376 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 2 2
MIRT477475 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT481660 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT502469 FAM98A family with sequence similarity 98 member A 2 8
MIRT503952 ZNF180 zinc finger protein 180 2 6
MIRT505585 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 6
MIRT529936 SYNGR1 synaptogyrin 1 2 2
MIRT530626 PPIC peptidylprolyl isomerase C 2 4
MIRT536883 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT546847 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT548448 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT557130 HOXA13 homeobox A13 2 2
MIRT560089 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT560984 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT566340 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567838 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT609236 SERPINA4 serpin family A member 4 2 2
MIRT611452 ZWILCH zwilch kinetochore protein 2 2
MIRT612058 PDGFRA platelet derived growth factor receptor alpha 2 2
MIRT612783 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT615116 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT616572 C1orf56 chromosome 1 open reading frame 56 2 2
MIRT616690 LPL lipoprotein lipase 2 2
MIRT616986 COL19A1 collagen type XIX alpha 1 chain 2 2
MIRT619427 CYB5R3 cytochrome b5 reductase 3 2 2
MIRT623320 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT626897 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT637554 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT639473 SLC6A4 solute carrier family 6 member 4 2 2
MIRT639753 GPR45 G protein-coupled receptor 45 2 2
MIRT640703 MRS2 MRS2, magnesium transporter 2 2
MIRT642489 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT644578 SPOP speckle type BTB/POZ protein 2 2
MIRT645009 NGRN neugrin, neurite outgrowth associated 2 2
MIRT646533 KLK2 kallikrein related peptidase 2 2 2
MIRT648625 LEMD2 LEM domain containing 2 2 2
MIRT650235 ERI1 exoribonuclease 1 2 2
MIRT651932 UBN1 ubinuclein 1 2 2
MIRT652960 SVEP1 sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 2 2
MIRT654842 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT656142 MSH5 mutS homolog 5 2 2
MIRT656730 LMBRD2 LMBR1 domain containing 2 2 2
MIRT657340 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT658991 DLGAP2 DLG associated protein 2 2 2
MIRT660714 AMER1 APC membrane recruitment protein 1 2 2
MIRT666591 RFX3 regulatory factor X3 2 2
MIRT667201 NKX2-3 NK2 homeobox 3 2 2
MIRT668732 DIO2 iodothyronine deiodinase 2 2 2
MIRT669479 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT681083 GSTO2 glutathione S-transferase omega 2 2 2
MIRT686736 STX16 syntaxin 16 2 2
MIRT687432 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT689887 SOD2 superoxide dismutase 2 2 2
MIRT695759 WDR35 WD repeat domain 35 2 2
MIRT698346 TMEM127 transmembrane protein 127 2 2
MIRT702752 IGF1R insulin like growth factor 1 receptor 2 2
MIRT703137 GPR137C G protein-coupled receptor 137C 2 2
MIRT705063 C4orf32 family with sequence similarity 241 member A 2 2
MIRT709597 IFT74 intraflagellar transport 74 2 2
MIRT709997 TXNDC12 thioredoxin domain containing 12 2 2
MIRT710463 ASTN2 astrotactin 2 2 2
MIRT710468 CDH5 cadherin 5 2 2
MIRT715625 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720091 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721054 DCC DCC netrin 1 receptor 2 2
MIRT721961 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT722122 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT722538 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 2 2
MIRT723325 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT725330 NEUROD1 neuronal differentiation 1 2 2
MIRT731556 HOXA10 homeobox A10 2 1
MIRT732380 BCL6 B-cell CLL/lymphoma 6 3 1
MIRT736700 E2F5 E2F transcription factor 5 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-544a Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE450, TE-1)
hsa-miR-544a Trastuzumab sensitive High Breast Cancer cell line (SKBR3)
hsa-mir-544a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-544a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-544a Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-544a Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-544a Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-544a Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-544a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-544a Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission