miRTarBase - #MIRT439728


—
pre-miRNA Information
pre-miRNA hsa-mir-539   
Genomic Coordinates chr14: 101047321 - 101047398
Synonyms MIRN539, hsa-mir-539, MIR539
Description Homo sapiens miR-539 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-539-5p
Sequence 9| GGAGAAAUUAUCCUUGGUGUGU |30
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 10 14 + 101047338 22499667, 26449202, 27229138, 28550310, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs920592001 1 dbSNP
rs949143380 2 dbSNP
rs1037241141 4 dbSNP
rs1261686093 10 dbSNP
rs747290147 19 dbSNP
rs1397145918 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPS4X   
Synonyms CCG2, DXS306, RPS4, S4, SCAR, SCR10
Description ribosomal protein S4, X-linked
Transcript NM_001007   
Expression
Putative miRNA Targets on RPS4X
3'UTR of RPS4X
(miRNA target sites are highlighted)		 
>RPS4X|NM_001007|3'UTR
   1 AATGGGTCCCTGGGTGACATGTCAGATCTTTGTACGTAATTAAAAATATTGTGGCAGGATTAATAGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguguGGUUCCUAU--UAAAGagg 5'
               ||  ||:|:  || ||   
Target 5' tgggtCCCTGGGTGACATGTCaga 3'
 3 - 26 79.00 -9.10
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755197506 5 dbSNP
rs373139828 11 dbSNP
rs780058676 13 dbSNP
rs779367864 14 dbSNP
rs12564 15 dbSNP
rs1051137585 21 dbSNP
rs376839099 35 dbSNP
rs750393551 36 dbSNP
rs1198818814 37 dbSNP
rs997366738 38 dbSNP
rs767368222 46 dbSNP
rs761674944 49 dbSNP
rs1393727492 50 dbSNP
rs1361897380 51 dbSNP
rs904190589 59 dbSNP
rs1238173404 63 dbSNP
rs113927316 69 dbSNP
rs111354545 70 dbSNP
rs1333916867 87 dbSNP
rs1250045113 88 dbSNP
rs747826302 89 dbSNP
rs900311156 89 dbSNP
rs189512872 97 dbSNP
rs1169179926 98 dbSNP
rs1451413063 98 dbSNP
rs767848530 98 dbSNP
rs941983223 98 dbSNP
rs183857827 110 dbSNP
rs191773447 112 dbSNP
rs765922668 113 dbSNP
rs1300438474 114 dbSNP
rs1300951706 124 dbSNP
rs1262599145 128 dbSNP
rs762312428 133 dbSNP
rs1426195180 138 dbSNP
rs1365606200 147 dbSNP
rs1231075500 151 dbSNP
rs773305995 152 dbSNP
rs1343033242 153 dbSNP
rs1204693581 169 dbSNP
rs1272805247 172 dbSNP
rs372262584 173 dbSNP
rs1490937282 175 dbSNP
rs1210834157 186 dbSNP
rs113969908 187 dbSNP
rs777512684 192 dbSNP
rs1431954048 205 dbSNP
rs928932275 208 dbSNP
rs1390243543 210 dbSNP
rs1448424870 214 dbSNP
rs1184406470 223 dbSNP
rs1166304927 239 dbSNP
rs1386728686 248 dbSNP
rs1425013094 251 dbSNP
rs186492391 266 dbSNP
rs147232979 267 dbSNP
rs1383838593 268 dbSNP
rs1042395501 274 dbSNP
rs45624642 275 dbSNP
rs1197480449 282 dbSNP
rs746106061 284 dbSNP
rs750360329 285 dbSNP
rs1361902533 295 dbSNP
rs1245904797 307 dbSNP
rs1490907116 309 dbSNP
rs767238882 323 dbSNP
rs1054300696 325 dbSNP
rs1269619211 329 dbSNP
rs917669189 333 dbSNP
rs1249239510 358 dbSNP
rs991846873 362 dbSNP
rs1186156947 380 dbSNP
rs1424041826 391 dbSNP
rs959101459 392 dbSNP
rs778945237 397 dbSNP
rs926817251 410 dbSNP
rs771061648 412 dbSNP
rs1204698035 428 dbSNP
rs1348438991 435 dbSNP
rs980005433 448 dbSNP
rs749322433 454 dbSNP
rs1434414544 468 dbSNP
rs1318628286 469 dbSNP
rs1021589226 472 dbSNP
rs1009571018 484 dbSNP
rs139329263 492 dbSNP
rs955531122 507 dbSNP
rs756660698 508 dbSNP
rs753191702 512 dbSNP
rs1241649353 523 dbSNP
rs147040310 529 dbSNP
rs1329078765 537 dbSNP
rs918276449 543 dbSNP
rs755234680 548 dbSNP
rs1244429971 551 dbSNP
rs972365177 552 dbSNP
rs1317010639 556 dbSNP
rs1180890756 557 dbSNP
rs1253700281 559 dbSNP
rs1380081279 559 dbSNP
rs962940278 560 dbSNP
rs1182670592 562 dbSNP
rs751238816 573 dbSNP
rs765899999 577 dbSNP
rs1455592396 578 dbSNP
rs762556722 578 dbSNP
rs150851120 585 dbSNP
rs991023251 591 dbSNP
rs1428961550 593 dbSNP
rs1174740178 597 dbSNP
rs1466655044 604 dbSNP
rs959778282 613 dbSNP
rs761570398 618 dbSNP
rs1035183234 628 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.724 3.2e-5 0.367 3.9e-2 24 Click to see details
GSE28544 Breast cancer -0.571 1.8e-3 -0.596 1.1e-3 24 Click to see details
GSE38226 Liver fibrosis 0.56 4.1e-3 0.448 2.1e-2 21 Click to see details
GSE32688 Pancreatic cancer -0.403 1.1e-2 -0.453 4.6e-3 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.376 3.2e-2 0.357 4.0e-2 25 Click to see details
GSE19783 ER- ER- breast cancer 0.176 6.0e-2 0.205 3.5e-2 79 Click to see details
GSE28260 Renal cortex and medulla -0.404 8.5e-2 -0.319 1.4e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.252 1.1e-1 0.193 1.8e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.281 1.2e-1 -0.304 9.6e-2 20 Click to see details
GSE21032 Prostate cancer 0.126 1.3e-1 0.095 2.0e-1 83 Click to see details
GSE14794 Lymphoblastoid cells 0.11 1.5e-1 0.036 3.7e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.239 1.6e-1 0.411 3.6e-2 20 Click to see details
GSE17306 Multiple myeloma -0.127 1.9e-1 -0.075 3.0e-1 49 Click to see details
GSE21849 B cell lymphoma -0.138 2.4e-1 -0.107 2.9e-1 29 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.358 2.4e-1 0.543 1.3e-1 6 Click to see details
GSE27834 Pluripotent stem cells 0.179 2.5e-1 0.171 2.6e-1 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.116 3.0e-1 0.048 4.1e-1 23 Click to see details
GSE19536 Breast cancer 0.039 3.5e-1 0.098 1.7e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.049 3.5e-1 0.166 9.5e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.047 4.4e-1 0.049 4.4e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.35 0 0.362 0 66 Click to see details
LIHC 0.38 0 0.485 0 48 Click to see details
HNSC -0.21 0.09 -0.297 0.03 42 Click to see details
CESC 0.935 0.12 0.500 0.33 3 Click to see details
STAD -0.212 0.13 -0.291 0.06 31 Click to see details
THCA 0.149 0.15 0.100 0.24 50 Click to see details
LUAD 0.38 0.2 0.321 0.24 7 Click to see details
ESCA 0.267 0.21 0.045 0.45 11 Click to see details
COAD 0.328 0.21 0.167 0.35 8 Click to see details
LUSC 0.131 0.22 0.165 0.16 37 Click to see details
CHOL 0.265 0.25 0.350 0.18 9 Click to see details
PCPG -0.704 0.25 -0.500 0.33 3 Click to see details
PAAD -0.454 0.27 -0.400 0.3 4 Click to see details
KICH 0.091 0.34 0.081 0.36 23 Click to see details
BRCA 0.043 0.35 0.007 0.47 84 Click to see details
PRAD -0.057 0.35 -0.028 0.43 47 Click to see details
KIRP -0.071 0.35 -0.014 0.47 30 Click to see details
BLCA -0.085 0.37 -0.055 0.41 18 Click to see details
UCEC -0.042 0.43 0.153 0.27 19 Click to see details
UCEC -0.042 0.43 0.153 0.27 19 Click to see details
UCEC -0.042 0.43 0.153 0.27 19 Click to see details
193 hsa-miR-539-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053510 TWIST1 twist family bHLH transcription factor 1 4 1
MIRT053516 ZEB1 zinc finger E-box binding homeobox 1 4 1
MIRT057687 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT066722 CCT2 chaperonin containing TCP1 subunit 2 2 6
MIRT071515 CALM1 calmodulin 1 1 1
MIRT084964 BACH1 BTB domain and CNC homolog 1 2 2
MIRT096759 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT099799 SOX4 SRY-box 4 2 2
MIRT126502 OTUD1 OTU deubiquitinase 1 2 2
MIRT163869 WDR1 WD repeat domain 1 2 2
MIRT176316 DDX3Y DEAD-box helicase 3, Y-linked 2 2
MIRT182188 POU2F1 POU class 2 homeobox 1 2 4
MIRT234348 MSL1 male specific lethal 1 homolog 2 8
MIRT244630 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 4
MIRT262597 ZNF37A zinc finger protein 37A 2 2
MIRT282630 IGF1R insulin like growth factor 1 receptor 2 2
MIRT287286 PSME3 proteasome activator subunit 3 2 2
MIRT310569 DCK deoxycytidine kinase 2 4
MIRT335358 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT367797 PRRG4 proline rich and Gla domain 4 2 2
MIRT439294 WASF3 WAS protein family member 3 2 3
MIRT439373 TULP3 tubby like protein 3 1 1
MIRT439515 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT439603 SLC39A6 solute carrier family 39 member 6 1 1
MIRT439659 SFMBT2 Scm like with four mbt domains 2 1 1
MIRT439661 SF3B1 splicing factor 3b subunit 1 1 1
MIRT439664 SETX senataxin 1 1
MIRT439728 RPS4X ribosomal protein S4, X-linked 1 1
MIRT440082 NUCB2 nucleobindin 2 1 1
MIRT440321 LOC728392 uncharacterized LOC728392 1 1
MIRT440354 KLHL2 kelch like family member 2 1 1
MIRT440371 KIF21A kinesin family member 21A 1 1
MIRT440412 KAT2B lysine acetyltransferase 2B 1 1
MIRT440606 FXR2 FMR1 autosomal homolog 2 1 1
MIRT440789 DNMT3A DNA methyltransferase 3 alpha 1 1
MIRT440803 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 1 1
MIRT440919 CNOT4 CCR4-NOT transcription complex subunit 4 1 1
MIRT440975 CDC27 cell division cycle 27 1 1
MIRT441206 ARFGEF2 ADP ribosylation factor guanine nucleotide exchange factor 2 1 1
MIRT441291 ACPP acid phosphatase, prostate 1 1
MIRT441634 KDM5A lysine demethylase 5A 2 2
MIRT442560 CAB39 calcium binding protein 39 2 2
MIRT443087 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT443454 CLIC5 chloride intracellular channel 5 2 2
MIRT443721 TAF1B TATA-box binding protein associated factor, RNA polymerase I subunit B 2 2
MIRT443772 STS steroid sulfatase 2 2
MIRT444081 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT444548 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT444564 TRA2B transformer 2 beta homolog 2 2
MIRT444723 LAMA2 laminin subunit alpha 2 2 2
MIRT444958 ADAM22 ADAM metallopeptidase domain 22 2 2
MIRT445051 SLC16A9 solute carrier family 16 member 9 2 2
MIRT445143 IKBIP IKBKB interacting protein 2 2
MIRT445415 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT445620 CLIC4 chloride intracellular channel 4 2 2
MIRT445967 IKZF5 IKAROS family zinc finger 5 2 2
MIRT446159 RPL12 ribosomal protein L12 2 2
MIRT446231 C17orf80 chromosome 17 open reading frame 80 2 2
MIRT446392 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT446944 ZMAT3 zinc finger matrin-type 3 2 2
MIRT447194 CDCP1 CUB domain containing protein 1 2 2
MIRT447360 FAM161B family with sequence similarity 161 member B 2 2
MIRT447793 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT447830 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448123 CCDC80 coiled-coil domain containing 80 2 2
MIRT448401 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT448720 ITGA2 integrin subunit alpha 2 2 2
MIRT448800 GLIS3 GLIS family zinc finger 3 2 2
MIRT449070 CNDP2 carnosine dipeptidase 2 2 2
MIRT449122 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT449412 TRIM5 tripartite motif containing 5 2 2
MIRT449712 TSPYL1 TSPY like 1 2 2
MIRT449845 BCL2L13 BCL2 like 13 2 2
MIRT449944 IGF1 insulin like growth factor 1 2 2
MIRT450088 OR2A4 olfactory receptor family 2 subfamily A member 4 2 2
MIRT450808 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT451876 SOD2 superoxide dismutase 2 2 8
MIRT452003 FKBP5 FK506 binding protein 5 2 2
MIRT452244 TRAM1 translocation associated membrane protein 1 2 2
MIRT453892 DUSP18 dual specificity phosphatase 18 2 2
MIRT457507 SLC35F6 solute carrier family 35 member F6 2 2
MIRT458522 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT459799 POTED POTE ankyrin domain family member D 2 10
MIRT459869 KIAA1191 KIAA1191 2 2
MIRT460004 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT464765 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT464933 TXLNA taxilin alpha 2 2
MIRT465140 TSC22D2 TSC22 domain family member 2 2 2
MIRT469364 REST RE1 silencing transcription factor 2 6
MIRT474820 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475668 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT476144 GPR137C G protein-coupled receptor 137C 2 8
MIRT478054 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 8
MIRT478588 CTDSPL2 CTD small phosphatase like 2 2 2
MIRT478805 CRTAP cartilage associated protein 2 2
MIRT479295 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT481480 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484232 IER2 immediate early response 2 2 2
MIRT485424 LDLR low density lipoprotein receptor 2 6
MIRT486920 CSTF2 cleavage stimulation factor subunit 2 2 4
MIRT488396 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT488426 COPA coatomer protein complex subunit alpha 2 2
MIRT489553 SOX11 SRY-box 11 2 6
MIRT493068 MTCH1 mitochondrial carrier 1 2 2
MIRT494096 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT497894 STRN striatin 2 2
MIRT498084 SETD5 SET domain containing 5 2 2
MIRT499923 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT501618 PISD phosphatidylserine decarboxylase 2 2
MIRT501835 NCOA2 nuclear receptor coactivator 2 2 2
MIRT502043 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 6
MIRT502255 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT502327 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT502991 CCDC71L coiled-coil domain containing 71 like 2 8
MIRT505415 TCF7L2 transcription factor 7 like 2 2 4
MIRT505694 SESN3 sestrin 3 2 2
MIRT506325 ONECUT2 one cut homeobox 2 2 2
MIRT506331 NUPL2 nucleoporin like 2 2 4
MIRT506877 KIAA0101 PCNA clamp associated factor 2 6
MIRT508237 ZNF121 zinc finger protein 121 2 4
MIRT509849 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT510002 UCP1 uncoupling protein 1 2 6
MIRT510324 SLC2A3 solute carrier family 2 member 3 2 4
MIRT511449 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 6
MIRT512379 PHB2 prohibitin 2 2 2
MIRT513672 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 4
MIRT516479 RAB32 RAB32, member RAS oncogene family 2 4
MIRT517589 ZNF579 zinc finger protein 579 2 4
MIRT520501 TRAM2 translocation associated membrane protein 2 2 6
MIRT521656 PRKD3 protein kinase D3 2 2
MIRT524646 C4orf32 family with sequence similarity 241 member A 2 2
MIRT528365 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT530455 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT537168 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT537761 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT537959 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT539317 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT539610 SHISA9 shisa family member 9 2 2
MIRT539641 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540335 OPHN1 oligophrenin 1 2 2
MIRT543806 COCH cochlin 2 2
MIRT544135 GLO1 glyoxalase I 2 4
MIRT544497 SLC25A46 solute carrier family 25 member 46 2 2
MIRT544792 ZKSCAN8 zinc finger with KRAB and SCAN domains 8 2 2
MIRT545832 ZNF367 zinc finger protein 367 2 4
MIRT546461 SLC39A14 solute carrier family 39 member 14 2 2
MIRT546578 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT548379 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549858 MCM4 minichromosome maintenance complex component 4 2 2
MIRT550705 TP53RK TP53 regulating kinase 2 4
MIRT550839 ABRACL ABRA C-terminal like 2 2
MIRT551955 RNF157 ring finger protein 157 2 2
MIRT552508 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT553922 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT555151 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT555348 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT559946 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT560145 RNPS1 RNA binding protein with serine rich domain 1 2 2
MIRT560848 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561238 ZNF652 zinc finger protein 652 2 2
MIRT562248 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT563485 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT563872 BASP1 brain abundant membrane attached signal protein 1 2 2
MIRT568196 CBX6 chromobox 6 2 2
MIRT571648 SF1 splicing factor 1 2 2
MIRT574107 SPINT2 serine peptidase inhibitor, Kunitz type 2 2 2
MIRT608237 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT609337 HRASLS5 HRAS like suppressor family member 5 2 2
MIRT612010 COX17 COX17, cytochrome c oxidase copper chaperone 2 2
MIRT612278 ZNF226 zinc finger protein 226 2 2
MIRT612726 NFAM1 NFAT activating protein with ITAM motif 1 2 4
MIRT623647 HS3ST5 heparan sulfate-glucosamine 3-sulfotransferase 5 2 2
MIRT644590 SPOP speckle type BTB/POZ protein 2 2
MIRT647567 ZNF660 zinc finger protein 660 2 2
MIRT649818 PSMC1 proteasome 26S subunit, ATPase 1 2 2
MIRT650882 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT654470 RANBP2 RAN binding protein 2 2 2
MIRT662531 PTCD2 pentatricopeptide repeat domain 2 2 2
MIRT667796 JHDM1D lysine demethylase 7A 1 1
MIRT668978 CLCN3 chloride voltage-gated channel 3 2 2
MIRT696546 HIST1H3B histone cluster 1 H3 family member b 2 2
MIRT697819 UBQLN1 ubiquilin 1 2 2
MIRT704048 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT705514 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 2
MIRT715899 SIPA1L1 signal induced proliferation associated 1 like 1 2 2
MIRT716350 C10orf105 chromosome 10 open reading frame 105 2 2
MIRT716638 DPY19L4 dpy-19 like 4 2 2
MIRT721205 PUS7L pseudouridylate synthase 7 like 2 2
MIRT732106 CDK4 cyclin dependent kinase 4 3 1
MIRT732127 CARD11 caspase recruitment domain family member 11 3 1
MIRT736678 TRIAP1 TP53 regulated inhibitor of apoptosis 1 3 0
MIRT755656 SLC11A2 solute carrier family 11 member 2 3 1
MIRT755660 Irak3 interleukin-1 receptor-associated kinase 3 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-539 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-539 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-539 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-539 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 up-regulated
miR-539 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-539-5p Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-539 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-539 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-539 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-539-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-539-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-539-5p (2Z)-2-(tert-butylhydrazinylidene)-N-(3-chloro-1,4-dioxonaphthalen-2-yl)-3-(3,7,12-trioxo-4H-naphtho[2,3-h]quinoxalin-2-yl)propanamide 5479912 NSC649574 resistant
hsa-miR-539-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-539-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-539-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-539-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-539-5p (E)-N-ethyl-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enamide 5388754 NSC638409 sensitive
hsa-miR-539-5p (Z)-3-[5-[3,5-bis(trifluoromethyl)phenyl]furan-2-yl]prop-2-enenitrile 5468615 NSC672868 sensitive
hsa-miR-539-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-(2-methylphenyl)propanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hepta 383478 NSC671870 sensitive
hsa-miR-539-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-539-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-539-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-539-5p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-539-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-539-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-539-5p 1-(benzenesulfonyl)-2-[1-(benzenesulfonyl)-3-methylindol-2-yl]-3-methylindole 396901 NSC704080 resistant
hsa-miR-539-5p 1-[10-[4-(dimethylamino)-2-methylquinolin-1-ium-1-yl]decyl]-N,N,2-trimethylquinolin-1-ium-4-amine;perchlorate 387883 NSC682095 sensitive
hsa-miR-539-5p 1-[2-(3-chloropropyl)phenyl]-3,4-dihydroisoquinoline;hydrochloride 390024 NSC686940 sensitive
hsa-miR-539-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 sensitive
hsa-miR-539-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-539-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-539-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-539-5p 10-methyl-2-[(3,4,5-trimethoxyphenyl)methyl]phenothiazine-1-carbonitrile 374832 NSC653255 sensitive
hsa-miR-539-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-539-5p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-539-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-539-5p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-539-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-539-5p 2-(trifluoromethyl)benzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383194 NSC671313 sensitive
hsa-miR-539-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-539-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-539-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-539-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-539-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-539-5p 2-ethyl-n-phenyl-5,6,7,8-tetrahydrothieno[2,3-b]quinolin-4-amine 365483 NSC633116 sensitive
hsa-miR-539-5p 2-methyl-1-[10-[(2-methylquinolin-4-yl)amino]decyl]quinolin-1-ium-4-amine;chloride;hydrochloride 387885 NSC682096 sensitive
hsa-miR-539-5p 2-methyl-4,4-diphenyl-1,4-benzoxaphosphinin-4-ium;bromide 24199840 NSC346098 sensitive
hsa-miR-539-5p 2-n-[3-(diethylaminomethyl)-4-methoxyphenyl]-4-n-[4-(dimethylamino)cyclohexyl]quinazoline-2,4-diamine;hydrochloride 54610390 NSC174030 sensitive
hsa-miR-539-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-539-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-539-5p 2,3-dibenzoyloxy-4-hydroxy-4-oxobutanoate;(2,5-dimethylphenyl)-(4-methylphenyl)-phenylsulfanium 5351228 NSC116693 sensitive
hsa-miR-539-5p 2,5-dibenzyl-2-undecyloctahydro-1h-pyrrolo[3,4-c]pyridin-2-ium bromide 378731 NSC661832 sensitive
hsa-miR-539-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-539-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-539-5p 3-(3-fluorophenyl)-n-pyridin-3-yl-2h-pyrazolo[3,4-d][1,3]thiazol-5-amine 60147811 NSC752461 sensitive
hsa-miR-539-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-539-5p 3-amino-4-(1,3-benzothiazol-2-yl)-7-nitro-2-(1-phenylethyl)isoquinolin-1-one 391659 NSC691201 sensitive
hsa-miR-539-5p 3-nitro-5-oxo-7h-benzimidazolo[1,2-a]quinoline-6-carbonitrile 391674 NSC691216 sensitive
hsa-miR-539-5p 3,3'-diethyl-9-methylthiacarbocyanine iodide 5351210 NSC96932 sensitive
hsa-miR-539-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-539-5p 3,4,7-trichloro-n,n-bis(2-chloroethyl)-11-oxobenzo[d][1,3,6,2]benzodioxathiaphosphocin-11-amine 382835 NSC670664 sensitive
hsa-miR-539-5p 4-(3h-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl acetate 384820 NSC675272 sensitive
hsa-miR-539-5p 4-(4-carbazol-9-ylbutanoylamino)-n-[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 406397 NSC724462 sensitive
hsa-miR-539-5p 4-(5-(4-(hydroxy(oxido)amino)phenyl)-2-furyl)-2-(4-toluidino)-1,3-thiazole 367868 NSC638034 sensitive
hsa-miR-539-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-539-5p 4-[(13R)-13-hydroxy-13-[(2S,5S)-5-[(2S,5S)-5-[1-hydroxy-13-[(2S)-2-methyl-5-oxo-2H-furan-4-yl]tridecyl]oxolan-2-yl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one 374064 NSC651320 sensitive
hsa-miR-539-5p 4-[(2z)-2-[3-butyl-4-(4-chlorophenyl)-1,3-thiazolidin-2-ylidene]hydrazinyl]-2h-phthalazin-1-one 9572675 NSC724117 sensitive
hsa-miR-539-5p 4-[(e)-2-[3-(4-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613025 NSC750038 sensitive
hsa-miR-539-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-539-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-539-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-539-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-539-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-539-5p 5-(4-chlorophenyl)-3-[3-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]phenyl]-1H-imidazol-2-one 46919707 NSC748559 resistant
hsa-miR-539-5p 5-[(5s,8ar)-5-(4-fluoroanilino)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-3-methoxycyclohexa-3,5-diene-1,2-dione 369957 NSC642324 sensitive
hsa-miR-539-5p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-539-5p 5-chroman-6-yl-2-(4-pyridyl)oxazole 380226 NSC665702 sensitive
hsa-miR-539-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-539-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-539-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-539-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-539-5p 7-[(3-fluorophenyl)methoxy]-9-[(3-fluorophenyl)methyl]-2-[(4-fluorophenyl)methyl]-1-methylpyrido[3,4-b]indol-2-ium 54766740 NSC760181 sensitive
hsa-miR-539-5p 7-epi-3,4-bis-nor-dolastatin 11 396354 NSC702158 sensitive
hsa-miR-539-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-539-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-539-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-539-5p 8-benzyl-12-[2-(4-chloroanilino)-2-oxoethyl]sulfanyl-5-methyl-7-oxo-3-thia-1,8,10,11-tetrazatricyclo[7.3.0.02,6]dodeca-2(6),4,9,11-tetraene-4-carboxamide 155805059 NSC762858 sensitive
hsa-miR-539-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-539-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-539-5p 9-bromo-2,3-dimethoxy-7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-6-one 395805 NSC700693 resistant
hsa-miR-539-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-539-5p Baccharin 5358645 NSC269757 sensitive
hsa-miR-539-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-539-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-539-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-539-5p C12h8n2o2s 3838042 NSC675587 sensitive
hsa-miR-539-5p C22h12f6o6s2 389883 NSC686511 sensitive
hsa-miR-539-5p Carbon monoxide; cyclopentane; 1-ethoxy-3a-methyl-azulen-4-one; iron 499038 NSC649307 sensitive
hsa-miR-539-5p Cuspidatin c 5459164 NSC636859 sensitive
hsa-miR-539-5p Cytovaricin 5477715 NSC349622 sensitive
hsa-miR-539-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-539-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-539-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-539-5p Dimethyl (1s,7s,8s,9s,10s,12s)-9,10-diacetyloxy-11-[tert-butyl(dimethyl)silyl]oxy-7-phenylmethoxy-2-oxa-3-azatricyclo[6.3.1.04,12]dodec-3-ene-1,12-dicarboxylate 360859 NSC623520 sensitive
hsa-miR-539-5p Ethyl (E)-3-(6-methoxy-1-thiophen-3-yl-3,4-dihydronaphthalen-2-yl)prop-2-enoate 24205739 NSC736553 sensitive
hsa-miR-539-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-539-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-539-5p Indanthren corinth rk 5351878 NSC74702 sensitive
hsa-miR-539-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-539-5p Inostamycin 368135 NSC638478 sensitive
hsa-miR-539-5p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-539-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-539-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-539-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-539-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-539-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-539-5p Leucinostatine d 5459065 NSC608984 sensitive
hsa-miR-539-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-539-5p Methyl (1r,2s,3r,6r,13s,15r,17s)-10,15,16-trihydroxy-9,13-dimethyl-4,11-dioxo-3-[(z)-4,4,4-trifluoro-3-phenylbut-2-enoyl]oxy-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-17-carboxylate 5467619 NSC656901 sensitive
hsa-miR-539-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-539-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-539-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-539-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-539-5p Ncimech_000253 366144 NSC634471 sensitive
hsa-miR-539-5p NSC644919 NSC644919 sensitive
hsa-miR-539-5p NSC699071 NSC699071 sensitive
hsa-miR-539-5p NSC751830 NSC751830 resistant
hsa-miR-539-5p Oxidanium;1,3-diphenylpropane-1,3-dione;neodymium(3+);hydroxide 24202397 NSC647042 sensitive
hsa-miR-539-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-539-5p Propan-2-yl (3z)-4-benzyl-2,5-dioxo-6-[(2,4,5-trimethoxy-3-methylphenyl)methyl]-3-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]piperazine-1-carboxylate 5387228 NSC622070 sensitive
hsa-miR-539-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-539-5p Propyl gallate 4947 NSC2626 resistant
hsa-miR-539-5p Pyrazolanthrone 8515 NSC75890 resistant
hsa-miR-539-5p Pyrimido[5,4-g]pteridine-2,4,6,8(1h,3h,7h,9h)-tetrone, 1,9-bis(methoxymethyl)-3,7-dimethyl-, 5-oxide 385097 NSC676032 sensitive
hsa-miR-539-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-539-5p Sb-236687 17892742 NSC756422 resistant
hsa-miR-539-5p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-539-5p Stk366297 242249 NSC50648 sensitive
hsa-miR-539-5p Stl361983 256661 NSC83715 resistant
hsa-miR-539-5p Tetraoxo[?]dione 388215 NSC682809 sensitive
hsa-miR-539-5p Tris(1,10-phenanthroline)cerium(iii)-trithiocyanate 24202209 NSC632734 resistant
hsa-miR-539-5p Ursa-11,13(18)-dien-28-oic acid-3.beta.-ol 378695 NSC661747 sensitive
hsa-miR-539-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-539-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-539-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-539-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-539-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-539-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-539-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-539-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-539-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-539-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-539-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-539-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission