miRTarBase - #MIRT439928


—
pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol POU2AF1   
Synonyms BOB1, OBF-1, OBF1, OCAB
Description POU class 2 associating factor 1
Transcript NM_006235   
Expression
Putative miRNA Targets on POU2AF1
3'UTR of POU2AF1
(miRNA target sites are highlighted)		 
>POU2AF1|NM_006235|3'UTR
   1 GCGTGGCTCCCACCTGAGTCCTGTTCCCTGAAACTGGGATTTTAAAATGAGCCTGGAATTGAGCCCCAGGTTCATGCTTG
  81 TTTGGAGTAGTCATTTCATGACTACACTTTCTACGCACAGCTAGAATTGTAGACCTGTAAACCTTCCTTCCCTTCTTCCT
 161 TCCCCTCCCTCCCTCACTTCCTCCCTCTCCCCCATCCTTCCATTCTTCCCCTCCCTCCCTTCTTCCTTTCCAACCCCTTC
 241 CTTCCTTTTCCTCCCTCCCTTCCTTCCCTCCTTCCCTTCTCCCTTTCCAACCCCTTCCTTCCTTTTCCTCCCTCCCTTCC
 321 TTCCCTCCTTCCCTTCTCCCTTTCCTTCTTTACCTCCCTCCCTCCCTCGCTTCTTCTCTCTTTCTTACTTCTTTTTTCAA
 401 TTCTGTTCCATTTTGGGAGGTAATTATAGGGATTTTAGCAATAACATTTTATGTCAAATGTTGCCAAGTCTGTGGTCCAT
 481 GGGCTTTCATTTCTGTCACATTTCATTTCTTGGAAAAGGCCTCCTTCCTCCAGTGCCTGCTGAACCATCTTAGGGTCACT
 561 CACACCCTCTGTAATTTTAAGATGTATGTGGTGGCCGGCGGGAAGACCAGCCCCGACAGCACCTCCTGAGAAAGTCAGCC
 641 AAGGGCCTACCCTGATGCCAGAGTCCTTGAGCTGTCAGTTCCCACAGTTGCTCCTTTGTTTGCTCTTCTCAGCCTCGGCC
 721 AGATTTACAGTCCAGGCAGCAAAATCTCAAGGCCTGGGGCTCAGAGTAGTAAGGGGTGGGAAGTGGGTGGCAGGGAGAAA
 801 AGAACATCAGGGTGGGTGGGGACAGGCCAGTGACGAAGAGAGGGACAGAGGAGGGATGGGAACAGGCTGTGCATCTTAGT
 881 TGGAGAGAGGGGTGTGGGAGGAAGCTTGAGTTTGATGCAGGGAGGAGGAAGGCTGAGGAATGACTTGGCTCCAGATTACT
 961 TGGTTATTAAGAAGAACAATAAACTAAAGGAAAGCATTGCTTGAAGAGATGGTTTTGCTGCTCTCCTTGAGGATACGTGC
1041 AAGGGAAGTTGGGCTGTTGTAAACAGGGTGAAGGGTGTGTTTGGTCGGCCATTTCTGTCTCACCTCTAGGCCCTCTGCTG
1121 GTGCTGTGGAGGCCAAGACCCCATTAAGCCTAAAGGTGATGGGTCCTCGCCTAGGCTTAGTGCTACCATGTGGGTTTTGT
1201 TTCTTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCTTTCCTTCCTTCC
1281 TTCCTTCCTTCCTTCCTCTCTCTTTCTTTCTTTTTTTTGGTTTTTTTTGGGACGGAGTCTCACTCCATTGCCCAGGCTGG
1361 AGTACAATGGTGCGATCTTGGCTCACTGCACCTCTGTCTCCCAAGTTCAAGTGATTCTCCTGCCTGAGCCTCCCGAGTAG
1441 CTGGGATTACAGGTGCATGCCACCATGCCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGCCAG
1521 GCTGGTCTCGAACTCCTGACCTTGTGATCCGCCCGCCTCAGCCTCTCAGAGTGCTGGGATCACAGGCGTGAGCCACCGCA
1601 CCCAGCCTTTTACCATGTGGGTTTCTTTAGTGTCTTAAAAGCGTCCATAAGCCACCATTCTGTGGAACCAAGGCCCCCTC
1681 CACGCAAACACCCTCCCTCCTGGGGACCTCTGGAGCCTCAGCCAGAAGTACCATTAGGTTTAATTTTAATTTGTTTTGCT
1761 GGAGAAACATCAGGTTTGTAGGAGACTGAGTTGTTAGCAGGTGTGCTTAGCTCTTGATAGTGAACGTGTACCTTGGGAAC
1841 TGGCTCACCCACCTGCTAATAGCACCATCGTCACTATTAAGCAGACATTTCAGTTGGTAGAATCCATGTAGAAGTCATGG
1921 ACTTTTCTGGGAAATGACTTTTCTGGGAAATGACAGTTTCTTTGACATATTTTCTTTGCCCACTTTAAATAAAAACTCTG
2001 GAGAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agucgGCGACAGUGUGCGUGUc 5'
               | || || :||||||| 
Target 5' gactaCACTTTC-TACGCACAg 3'
 100 - 120 152.00 -16.50
2 
miRNA  3' aguCGGCGACAG-------UGUGCGUGUc 5'
             ||:||| ||       |:|||::|| 
Target 5' tttGCTGCTCTCCTTGAGGATACGTGCAa 3'
 1014 - 1042 127.00 -16.70
3 
miRNA  3' agUCGGCGACAGUGUGCGUGUc 5'
            || | |  || |||||| | 
Target 5' caAGGCCCCCTC-CACGCAAAc 3'
 1669 - 1689 123.00 -13.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30116496 3 COSMIC
COSN30163688 13 COSMIC
COSN31505543 28 COSMIC
COSN26989947 35 COSMIC
COSN26989944 36 COSMIC
COSN30538971 38 COSMIC
COSN24303871 40 COSMIC
COSN30193192 53 COSMIC
COSN26554152 73 COSMIC
COSN30760012 97 COSMIC
COSN28740238 111 COSMIC
COSN30100594 111 COSMIC
COSN20077242 115 COSMIC
COSN28523955 202 COSMIC
COSN26254560 265 COSMIC
COSN26372029 272 COSMIC
COSN9030053 281 COSMIC
COSN30105016 350 COSMIC
COSN5894765 523 COSMIC
COSN25701011 550 COSMIC
COSN25721711 777 COSMIC
COSN20092426 893 COSMIC
COSN26051805 927 COSMIC
COSN32064073 1168 COSMIC
COSN15596788 1260 COSMIC
COSN23897426 1264 COSMIC
COSN28932578 1268 COSMIC
COSN26329884 1304 COSMIC
COSN22243391 1435 COSMIC
COSN6985232 1543 COSMIC
rs12417556 1541 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1224056135 2 dbSNP
rs754227419 3 dbSNP
rs764646023 6 dbSNP
rs1308722974 7 dbSNP
rs1205466083 9 dbSNP
rs1344695906 12 dbSNP
rs376007107 15 dbSNP
rs1398528614 16 dbSNP
rs896057457 17 dbSNP
rs767549504 23 dbSNP
rs1368908151 24 dbSNP
rs374236313 26 dbSNP
rs1458834285 27 dbSNP
rs35577660 29 dbSNP
rs1160555492 37 dbSNP
rs1403114341 42 dbSNP
rs1161459332 49 dbSNP
rs762712399 51 dbSNP
rs1207513016 56 dbSNP
rs1025718722 68 dbSNP
rs571649581 74 dbSNP
rs550344568 75 dbSNP
rs965367000 78 dbSNP
rs1018247874 79 dbSNP
rs1007066152 91 dbSNP
rs1229773255 92 dbSNP
rs1288414571 94 dbSNP
rs1355616289 100 dbSNP
rs1398692714 101 dbSNP
rs116351295 106 dbSNP
rs539159649 114 dbSNP
rs768085498 125 dbSNP
rs561477520 126 dbSNP
rs891968829 131 dbSNP
rs1056844980 139 dbSNP
rs1255504960 143 dbSNP
rs1181282590 144 dbSNP
rs1183054353 147 dbSNP
rs1048523834 152 dbSNP
rs1472116102 158 dbSNP
rs1165460547 159 dbSNP
rs1414998748 164 dbSNP
rs929743472 173 dbSNP
rs896871714 175 dbSNP
rs1486497146 176 dbSNP
rs1262964842 177 dbSNP
rs905499903 185 dbSNP
rs1339329080 190 dbSNP
rs1044074075 192 dbSNP
rs1285821381 193 dbSNP
rs1356792178 194 dbSNP
rs1316665975 196 dbSNP
rs1272191557 200 dbSNP
rs1484185390 202 dbSNP
rs1267177595 212 dbSNP
rs1233510474 213 dbSNP
rs569930907 215 dbSNP
rs1440718752 216 dbSNP
rs1190231151 222 dbSNP
rs550123689 224 dbSNP
rs1475367448 232 dbSNP
rs1167159159 236 dbSNP
rs1392384208 237 dbSNP
rs1431285444 245 dbSNP
rs941702273 255 dbSNP
rs1393724137 259 dbSNP
rs982549418 262 dbSNP
rs1335612717 265 dbSNP
rs55677441 272 dbSNP
rs1434249114 275 dbSNP
rs1295176409 278 dbSNP
rs12807432 281 dbSNP
rs1362604710 283 dbSNP
rs1229431584 287 dbSNP
rs943680413 288 dbSNP
rs1202309473 289 dbSNP
rs1256927380 290 dbSNP
rs1290537820 294 dbSNP
rs1187182687 297 dbSNP
rs1428436340 301 dbSNP
rs1387616854 307 dbSNP
rs1450414114 309 dbSNP
rs1165302501 314 dbSNP
rs1463211148 316 dbSNP
rs1188808831 318 dbSNP
rs1376780600 319 dbSNP
rs909124440 321 dbSNP
rs983806025 323 dbSNP
rs1402252255 326 dbSNP
rs1318396489 335 dbSNP
rs1456666512 335 dbSNP
rs1367103316 336 dbSNP
rs1435634883 338 dbSNP
rs1329617937 340 dbSNP
rs755900929 346 dbSNP
rs527997389 351 dbSNP
rs1164199513 352 dbSNP
rs560803919 354 dbSNP
rs1207402242 355 dbSNP
rs985411360 356 dbSNP
rs936562034 366 dbSNP
rs923099373 368 dbSNP
rs1264527935 369 dbSNP
rs188157878 369 dbSNP
rs1185282259 384 dbSNP
rs976839145 385 dbSNP
rs1464775608 391 dbSNP
rs1200495985 403 dbSNP
rs745792737 405 dbSNP
rs775139360 424 dbSNP
rs1156317527 426 dbSNP
rs1390824039 427 dbSNP
rs781332064 430 dbSNP
rs576455551 441 dbSNP
rs1388262706 442 dbSNP
rs967882048 445 dbSNP
rs184667768 447 dbSNP
rs1254037484 461 dbSNP
rs1215873728 468 dbSNP
rs117535785 479 dbSNP
rs1226721113 491 dbSNP
rs193082983 494 dbSNP
rs1010908587 504 dbSNP
rs891940319 509 dbSNP
rs1264082622 521 dbSNP
rs1034748677 525 dbSNP
rs1003073334 528 dbSNP
rs1269243456 530 dbSNP
rs1482518930 539 dbSNP
rs1001762211 563 dbSNP
rs888674840 567 dbSNP
rs1419632805 582 dbSNP
rs1027122569 584 dbSNP
rs1212747885 592 dbSNP
rs189188715 595 dbSNP
rs994260417 596 dbSNP
rs941667563 597 dbSNP
rs887447113 599 dbSNP
rs1370251190 600 dbSNP
rs1392614560 607 dbSNP
rs1309975489 610 dbSNP
rs896902112 613 dbSNP
rs183334145 614 dbSNP
rs943778493 615 dbSNP
rs79466577 617 dbSNP
rs1374852880 643 dbSNP
rs1246066732 656 dbSNP
rs889489814 657 dbSNP
rs1049407791 663 dbSNP
rs1482547516 664 dbSNP
rs929232425 675 dbSNP
rs1253374292 698 dbSNP
rs374236436 700 dbSNP
rs572134053 716 dbSNP
rs977928865 717 dbSNP
rs554065976 718 dbSNP
rs1164029083 719 dbSNP
rs1389281810 724 dbSNP
rs923099200 726 dbSNP
rs1195922513 727 dbSNP
rs1355196580 731 dbSNP
rs752826175 732 dbSNP
rs1301157293 737 dbSNP
rs943228635 738 dbSNP
rs917732816 746 dbSNP
rs1397094158 759 dbSNP
rs765501530 762 dbSNP
rs1340421536 763 dbSNP
rs1225743570 774 dbSNP
rs1276252868 775 dbSNP
rs755253882 776 dbSNP
rs992953156 783 dbSNP
rs960378741 784 dbSNP
rs1208886914 786 dbSNP
rs192227233 790 dbSNP
rs968652388 791 dbSNP
rs78415994 794 dbSNP
rs989051043 795 dbSNP
rs6589223 797 dbSNP
rs1035972000 798 dbSNP
rs1420568254 799 dbSNP
rs538346739 806 dbSNP
rs770664501 810 dbSNP
rs994825838 811 dbSNP
rs766739103 815 dbSNP
rs1304038365 819 dbSNP
rs1360925399 824 dbSNP
rs1470602229 825 dbSNP
rs1020188716 827 dbSNP
rs1320404686 830 dbSNP
rs140573641 834 dbSNP
rs1437806200 835 dbSNP
rs760995868 843 dbSNP
rs1362282123 851 dbSNP
rs1218246695 852 dbSNP
rs1300914891 859 dbSNP
rs1392197038 866 dbSNP
rs1313386150 871 dbSNP
rs1049437962 873 dbSNP
rs1204232227 889 dbSNP
rs1398827388 893 dbSNP
rs1267350213 896 dbSNP
rs1463480989 897 dbSNP
rs1296556377 900 dbSNP
rs1429136158 907 dbSNP
rs1022685225 913 dbSNP
rs1005977114 918 dbSNP
rs887425445 920 dbSNP
rs1376651660 925 dbSNP
rs1189644498 926 dbSNP
rs1000501184 937 dbSNP
rs1480767637 955 dbSNP
rs1158517705 956 dbSNP
rs1387165897 960 dbSNP
rs1459263694 965 dbSNP
rs903776671 968 dbSNP
rs1319438177 974 dbSNP
rs1349617948 976 dbSNP
rs549326787 977 dbSNP
rs1272654670 979 dbSNP
rs1346851994 994 dbSNP
rs1453041102 994 dbSNP
rs1287136619 995 dbSNP
rs575957947 996 dbSNP
rs1040331052 999 dbSNP
rs943172907 1000 dbSNP
rs910387990 1005 dbSNP
rs1219653164 1007 dbSNP
rs1419333032 1012 dbSNP
rs746758059 1023 dbSNP
rs945270796 1036 dbSNP
rs1490570560 1037 dbSNP
rs917779295 1043 dbSNP
rs1252164754 1044 dbSNP
rs1181611761 1046 dbSNP
rs947488292 1048 dbSNP
rs1473875872 1049 dbSNP
rs527920126 1064 dbSNP
rs914692757 1068 dbSNP
rs938792626 1069 dbSNP
rs927346896 1073 dbSNP
rs1159599779 1075 dbSNP
rs151169138 1078 dbSNP
rs1413537061 1082 dbSNP
rs1403885173 1083 dbSNP
rs1325934210 1086 dbSNP
rs1367107109 1091 dbSNP
rs989201738 1096 dbSNP
rs1306910755 1097 dbSNP
rs1348040887 1106 dbSNP
rs980073696 1107 dbSNP
rs1280000740 1112 dbSNP
rs1295950774 1114 dbSNP
rs1281034109 1119 dbSNP
rs1355555782 1127 dbSNP
rs1226457041 1129 dbSNP
rs1293641575 1132 dbSNP
rs956107342 1133 dbSNP
rs1212917717 1141 dbSNP
rs1249737317 1149 dbSNP
rs952754678 1152 dbSNP
rs928875196 1156 dbSNP
rs1342716491 1159 dbSNP
rs919920704 1160 dbSNP
rs973038780 1168 dbSNP
rs1239452907 1169 dbSNP
rs1337778526 1171 dbSNP
rs981696785 1173 dbSNP
rs552096430 1176 dbSNP
rs970171929 1179 dbSNP
rs1023156401 1187 dbSNP
rs1005944433 1192 dbSNP
rs866266252 1199 dbSNP
rs1328935572 1203 dbSNP
rs533434754 1203 dbSNP
rs7949774 1204 dbSNP
rs1315435016 1205 dbSNP
rs542966361 1208 dbSNP
rs1446511374 1215 dbSNP
rs1383192435 1216 dbSNP
rs867362914 1216 dbSNP
rs1272662667 1218 dbSNP
rs1000607638 1220 dbSNP
rs1159530674 1220 dbSNP
rs903547864 1221 dbSNP
rs1443379217 1225 dbSNP
rs575749416 1230 dbSNP
rs1042054870 1232 dbSNP
rs1009502437 1236 dbSNP
rs1190166651 1237 dbSNP
rs1182548103 1238 dbSNP
rs1387107436 1239 dbSNP
rs1455648254 1240 dbSNP
rs372231337 1240 dbSNP
rs1256375622 1243 dbSNP
rs1365223467 1244 dbSNP
rs370825947 1244 dbSNP
rs1199564399 1247 dbSNP
rs376428762 1248 dbSNP
rs926454254 1251 dbSNP
rs76426485 1252 dbSNP
rs1472011852 1254 dbSNP
rs1410302681 1255 dbSNP
rs1168029493 1256 dbSNP
rs1412706764 1256 dbSNP
rs866217614 1256 dbSNP
rs1257616157 1257 dbSNP
rs867536460 1258 dbSNP
rs867016668 1259 dbSNP
rs138762227 1260 dbSNP
rs1491517257 1260 dbSNP
rs1491098544 1261 dbSNP
rs1440662178 1263 dbSNP
rs1228378245 1264 dbSNP
rs58425211 1264 dbSNP
rs376505494 1266 dbSNP
rs1264382017 1267 dbSNP
rs1342890106 1267 dbSNP
rs1193388265 1268 dbSNP
rs1207283375 1268 dbSNP
rs1264262132 1268 dbSNP
rs1358694160 1268 dbSNP
rs1376585381 1268 dbSNP
rs1429958893 1268 dbSNP
rs1464833613 1268 dbSNP
rs1476717354 1268 dbSNP
rs7949746 1268 dbSNP
rs1255327836 1269 dbSNP
rs1205553378 1270 dbSNP
rs1352539082 1271 dbSNP
rs1491282660 1272 dbSNP
rs533490239 1272 dbSNP
rs868364828 1272 dbSNP
rs1491276410 1273 dbSNP
rs1228007493 1274 dbSNP
rs1225496504 1276 dbSNP
rs1227051220 1276 dbSNP
rs879190537 1276 dbSNP
rs1335634922 1277 dbSNP
rs1295229646 1278 dbSNP
rs1445848329 1279 dbSNP
rs145282012 1280 dbSNP
rs1486362804 1280 dbSNP
rs1491152846 1280 dbSNP
rs1491357522 1281 dbSNP
rs1319519102 1282 dbSNP
rs1384340665 1283 dbSNP
rs1201016790 1284 dbSNP
rs1386893308 1284 dbSNP
rs1429332249 1285 dbSNP
rs1158813967 1286 dbSNP
rs1472237824 1287 dbSNP
rs1365328172 1288 dbSNP
rs1456383103 1288 dbSNP
rs1418075265 1289 dbSNP
rs1166499307 1290 dbSNP
rs532262103 1291 dbSNP
rs1471511756 1292 dbSNP
rs1367863268 1293 dbSNP
rs1406963174 1295 dbSNP
rs1193808611 1296 dbSNP
rs1448582742 1297 dbSNP
rs1187817196 1298 dbSNP
rs1244589822 1298 dbSNP
rs1248020492 1298 dbSNP
rs1264024540 1298 dbSNP
rs1309695727 1298 dbSNP
rs1318042076 1298 dbSNP
rs1349892070 1298 dbSNP
rs1356875246 1298 dbSNP
rs1408546894 1298 dbSNP
rs973121429 1298 dbSNP
rs1245981624 1300 dbSNP
rs1163864297 1304 dbSNP
rs1207831337 1304 dbSNP
rs1419581952 1304 dbSNP
rs1383112779 1305 dbSNP
rs961665871 1306 dbSNP
rs1164384873 1307 dbSNP
rs1370029480 1319 dbSNP
rs993567299 1319 dbSNP
rs187016132 1320 dbSNP
rs901517176 1321 dbSNP
rs912774079 1327 dbSNP
rs1247723147 1329 dbSNP
rs1385367173 1329 dbSNP
rs117629020 1330 dbSNP
rs1007450551 1332 dbSNP
rs148482878 1333 dbSNP
rs778020947 1334 dbSNP
rs1442036952 1335 dbSNP
rs1480938289 1341 dbSNP
rs1043529298 1353 dbSNP
rs1394827092 1354 dbSNP
rs373530594 1360 dbSNP
rs538945332 1362 dbSNP
rs979197320 1373 dbSNP
rs563260616 1374 dbSNP
rs1426937711 1376 dbSNP
rs1476367390 1393 dbSNP
rs1355146418 1397 dbSNP
rs1465993259 1400 dbSNP
rs1335238326 1408 dbSNP
rs1388189563 1411 dbSNP
rs1453911463 1422 dbSNP
rs1020629617 1427 dbSNP
rs934621399 1429 dbSNP
rs1009613250 1430 dbSNP
rs1364064498 1434 dbSNP
rs1187749411 1435 dbSNP
rs1398726313 1454 dbSNP
rs1297132317 1455 dbSNP
rs1308647141 1456 dbSNP
rs556616777 1457 dbSNP
rs896405795 1459 dbSNP
rs1454524591 1466 dbSNP
rs1209337672 1468 dbSNP
rs11825875 1470 dbSNP
rs1002067959 1471 dbSNP
rs981665814 1473 dbSNP
rs1247149964 1484 dbSNP
rs905063977 1485 dbSNP
rs376028044 1490 dbSNP
rs1048863036 1491 dbSNP
rs182691807 1498 dbSNP
rs898559785 1499 dbSNP
rs1388807832 1501 dbSNP
rs1470574166 1510 dbSNP
rs549484667 1511 dbSNP
rs939978909 1529 dbSNP
rs912563947 1530 dbSNP
rs1340690490 1535 dbSNP
rs12417556 1541 dbSNP
rs1235529928 1549 dbSNP
rs932869430 1550 dbSNP
rs567092271 1551 dbSNP
rs1126884 1553 dbSNP
rs376831999 1554 dbSNP
rs1433873179 1555 dbSNP
rs1267282995 1558 dbSNP
rs1445001060 1561 dbSNP
rs1348874660 1566 dbSNP
rs773871828 1567 dbSNP
rs1328970433 1569 dbSNP
rs971843560 1570 dbSNP
rs768152431 1571 dbSNP
rs1197417972 1579 dbSNP
rs1271096007 1580 dbSNP
rs11213847 1581 dbSNP
rs1406242153 1585 dbSNP
rs540969032 1587 dbSNP
rs1021084025 1588 dbSNP
rs987904521 1592 dbSNP
rs1022209741 1593 dbSNP
rs571896302 1594 dbSNP
rs960685400 1596 dbSNP
rs1346793084 1597 dbSNP
rs775053279 1606 dbSNP
rs1405495313 1611 dbSNP
rs1278959075 1618 dbSNP
rs1348438913 1619 dbSNP
rs1002100859 1620 dbSNP
rs1321386088 1621 dbSNP
rs1220477459 1625 dbSNP
rs1294063139 1630 dbSNP
rs905095117 1642 dbSNP
rs769613656 1643 dbSNP
rs1181541693 1646 dbSNP
rs1231728406 1649 dbSNP
rs1189176412 1651 dbSNP
rs994597722 1653 dbSNP
rs1233619957 1655 dbSNP
rs745714530 1664 dbSNP
rs1178180713 1665 dbSNP
rs898585626 1669 dbSNP
rs1413472976 1672 dbSNP
rs190440023 1673 dbSNP
rs934778412 1678 dbSNP
rs1424813924 1679 dbSNP
rs907172912 1679 dbSNP
rs775391731 1681 dbSNP
rs538362100 1683 dbSNP
rs891141951 1684 dbSNP
rs1274636815 1685 dbSNP
rs1051079540 1690 dbSNP
rs1279951756 1696 dbSNP
rs932900286 1699 dbSNP
rs757276225 1700 dbSNP
rs1381702137 1715 dbSNP
rs1244066131 1717 dbSNP
rs1294302259 1725 dbSNP
rs1212211867 1734 dbSNP
rs921479598 1746 dbSNP
rs1204582240 1753 dbSNP
rs1350613262 1757 dbSNP
rs1270928342 1762 dbSNP
rs1276958122 1765 dbSNP
rs979598074 1766 dbSNP
rs531237435 1774 dbSNP
rs1237278330 1781 dbSNP
rs1443090237 1784 dbSNP
rs558747054 1789 dbSNP
rs1386758325 1803 dbSNP
rs916162542 1810 dbSNP
rs1279736977 1811 dbSNP
rs560721736 1811 dbSNP
rs1411194137 1825 dbSNP
rs985075276 1826 dbSNP
rs1411606201 1827 dbSNP
rs988324628 1831 dbSNP
rs1405253542 1840 dbSNP
rs1450252439 1846 dbSNP
rs1306809937 1856 dbSNP
rs919452105 1857 dbSNP
rs960469563 1860 dbSNP
rs1268514844 1862 dbSNP
rs185929147 1868 dbSNP
rs1341487663 1869 dbSNP
rs1215669473 1870 dbSNP
rs927638290 1873 dbSNP
rs1042752 1875 dbSNP
rs1415327314 1881 dbSNP
rs1360784722 1885 dbSNP
rs1244087919 1886 dbSNP
rs969286767 1891 dbSNP
rs1018675476 1896 dbSNP
rs1191957027 1899 dbSNP
rs12272263 1900 dbSNP
rs1370852333 1911 dbSNP
rs1476148890 1914 dbSNP
rs985759462 1921 dbSNP
rs1409043148 1934 dbSNP
rs953085647 1935 dbSNP
rs1468136106 1946 dbSNP
rs1471686401 1955 dbSNP
rs1251194722 1960 dbSNP
rs779169258 1962 dbSNP
rs1381874684 1966 dbSNP
rs994712198 1967 dbSNP
rs1328420181 1969 dbSNP
rs755056661 1977 dbSNP
rs1126886 1982 dbSNP
rs1010824019 1983 dbSNP
rs1014740115 1986 dbSNP
rs1225841531 1990 dbSNP
rs892269338 1990 dbSNP
rs1236203525 1997 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.399 0 -0.373 0 68 Click to see details
HNSC -0.432 0 -0.333 0.02 42 Click to see details
LIHC -0.303 0.02 -0.304 0.02 49 Click to see details
ESCA 0.535 0.04 0.555 0.04 11 Click to see details
CHOL -0.578 0.05 -0.583 0.05 9 Click to see details
KIRP -0.287 0.06 -0.348 0.03 32 Click to see details
LUAD 0.376 0.11 0.301 0.17 12 Click to see details
CESC -0.933 0.12 -0.500 0.33 3 Click to see details
LUSC -0.184 0.13 -0.172 0.15 38 Click to see details
STAD 0.191 0.15 0.161 0.19 32 Click to see details
PRAD -0.138 0.17 -0.098 0.25 50 Click to see details
BLCA -0.234 0.18 -0.298 0.11 18 Click to see details
COAD -0.376 0.18 -0.667 0.04 8 Click to see details
UCEC -0.211 0.19 -0.121 0.31 19 Click to see details
BRCA -0.088 0.21 -0.105 0.17 84 Click to see details
PCPG 0.688 0.26 0.500 0.33 3 Click to see details
KICH -0.084 0.34 -0.095 0.33 25 Click to see details
THCA -0.05 0.35 -0.021 0.44 59 Click to see details
PAAD 0.015 0.49 -0.200 0.4 4 Click to see details
PAAD 0.015 0.49 -0.200 0.4 4 Click to see details
PAAD 0.015 0.49 -0.200 0.4 4 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission