miRTarBase - #MIRT440028


—
pre-miRNA Information
pre-miRNA hsa-mir-136   
Genomic Coordinates chr14: 100884702 - 100884783
Description Homo sapiens miR-136 stem-loop
Comment miR-136 was first identified by cloning studies in mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-136-5p
Sequence 15| ACUCCAUUUGUUUUGAUGAUGGA |37
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM3493815 4 COSMIC
COSM9594993 10 COSMIC
COSM5381857 13 COSMIC
COSM5381858 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265741270 12 dbSNP
rs1469776734 13 dbSNP
rs747068235 15 dbSNP
rs757383513 18 dbSNP
rs1465430581 19 dbSNP
rs1190567087 21 dbSNP
rs1386524981 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PCLO   
Synonyms ACZ, PCH3
Description piccolo presynaptic cytomatrix protein
Transcript NM_033026   
Other Transcripts NM_014510   
Expression
Putative miRNA Targets on PCLO
3'UTR of PCLO
(miRNA target sites are highlighted)		 
>PCLO|NM_033026|3'UTR
   1 AGAAACATGTCTTCTCAGGGTATAGAAACTGCTCTAAATAGCCTCACATCAAGACTATAGTTGAATACTATTGTACAAAG
  81 CTAAGTTTTGAGAGGCAAACATAAGAGTGGGAACAACAAGCAAAAACATACTTAAGACCTTGTACATTTATTGTTGTGGA
 161 TCACACAAAGATATTCAACTGAAAAAGTTCACATACTGAAAACAAGAAGAATGGAGTTCTGAGACCTTGAATTTCCCATG
 241 GCTGTGAAGAGAAACTGTGAAACAAATTTTGATTACTTAAGACAATAATCTTTGAGTAGAGTTGAGCTATAGCTTAAGAC
 321 AGGCTCAAAGATTAATGTGGTTTTCATGCAGCACAAAGGTAATTCTTTATGCAAAGGAGCCTTGGTTGAAAGGAAAGGAC
 401 TGATGTAACAAATCTCAGTTTTCAAAACTTCAAAAATCTTCCTTCATCGTCTTCTATTCAGACAACTTGCTGCTTTCAGA
 481 TTCTGACATAAGATATACCTACAGTATGTGTCCAGGGCTGGAAGTGAGGTGGCTGTGTTCTTAGGGAAAATGGAAGAGGA
 561 GATGTAGAAATTGTGGCTTTCAGGCCATATTTTACCAGTTTTCTCTGTGTCTAAATGTTACAAGCATATACAACACTGAC
 641 TTTGGAATCCATGTGGTAAAAGCACATTTGTTTCTGTATCATTTGAAACAAGGTAGAGTGAAGATAATACTCAGTAGAAA
 721 TAAAATTGAATTTATCTAGAAATAAAACTATGACTGGCTAACAAAGAAGAATGTTGCCCCATAAAATATTGGAATTTTGG
 801 TTGAAACCATCAAAATCTTCATAATTTACCATTAAGCCAAGACATCTTCAGTCTATGTACCAAAGGACCTAGAGTAAACT
 881 GATATGTTCTAGGAAGCATGATAACTTACTCTTTGTGAAACTGCAAATAAATGTATTATCCTGCACATTTCCTTTCTGTT
 961 GAGCGATGCATTGACAGAGAAAGAAAATTCTTTCTCTGGCAAACAAACCATATTAATCTTGTGACATTGATTAATTAAAT
1041 GGATCCTCATTTCATAATATTTTATGCTTTTTTCCTTAATGACTTAATTCATTTACTGATTGTATCATGAAAACATGACA
1121 CTAAACTCGAGTTCTCTCTAGTGCTCTATTTTCTTACTTTAGTGACAGTATCACAGTGATCAAGTTCATCAATGTTGGGA
1201 AAATATGTGAAAAGTCAACATTTACCTGAGATTAAAATATACTTTGAGCTATTTTAATAATAATGAATAAAACAACTAAT
1281 GTCCAAGTCTTAAAATGAAGCACCCTCTTCTCTATCAGCATTATTAATTAAGGAAGTAACGTGAAGTTGTGGAAAAAACA
1361 CTCAGCAGGGAATAAAAGCCTGTCTTCTGGTCTTAGTTCTACCACTGACTGTGTCACTTTGCACATGTCACTTACACTCA
1441 CTTTACCCCAGTTTTCTTATCTATAGGATAAAAACAATTATATATTCTTAACCTTCCAAATGAGATGTTGTGATGATAAA
1521 TCAATGATCCATGAAAGATGAAAGCACATTTCCAAATATAGTTTTATACACAGAAGTGAGGAATAATTATTACATATCTT
1601 TTTAATTCTCAAATTTTATATGTGAAAAACATCATCTAAACCAATGGCAAGGATTGACATGGATAAAAGCAGTAAATTAG
1681 CCACAAAACTTATTTTTTATTTAAAATATAAACTTTAACCTGACTAAAGGTGAAGAATTACATGAAAATGCAAATTTTGC
1761 TATCCCAAATTAAATGAATAATGCTGGTCTTACCCTAGTCCTATATTCCACCCAAAAGAAATAAATCAAATTGCTTCTCA
1841 GAGCATTCTGAGCTTAAAACCTGCTGCTTTATTTAAGGGTGAAGTGTTAGTGGAATTAGAGAAAACCAACTCTAGATATT
1921 GGTTGGATATTGAATTTTCTCATTTTTAAAGAAAAAATGCTCTAAATTTGAGAGGACTGTAAAGCACTAAAAATAAGAGA
2001 ATTTCTAATATATCCCAGGATATATATATATATATATGACTTCAGAATACAAATTCGATCTTCCCCAAACTGAGAAAGAT
2081 AACCATAACTTTTCTTCCCTCTATTTTTTAATCCCCCTCCACTGACAATACAATGTCATTTACCATTGACATTGCTCTCA
2161 AATGAGCATGGGAGAGTGGAATCATCAAAGACATTATATTGCTAGTATTTTATTTTTAGAAACTATTAGATCTGCTGATG
2241 GTTGCCATGGATATTTCCAGCAGAAGCTAGCACTTGAAGAAGCCTATAATCATCACTCATAATTGGGGAAGAAAAGGTCC
2321 AAGGAGATCTCCTTCTGACATAAAAAGGCTCTGGTATTTGCCCTTAAAAGAAAACCCTGACTCATCTCTGATCCTCTTTT
2401 GCAGCCACTCATATCCATAGGTATGCATGAGAGTTTGTATGACCAGTTAGCTTTCTTCATTCCAGTTGCAATTTCTTTTA
2481 GAATAATATAAATGGAGGGATCACCAAAACAAAGATTATCTCTTTGGTAGCTATTTAACCTGAAAGCGTAGGAGTCTTTC
2561 CATTATAGAAGCCCCTCCGTTCCAAGGAACTAGCGATGGGGCTAGGTCAATCAGCAGAGTTGACAACAGGGCTTCTTTTT
2641 GTGCACCAGCATTCCCCTTCAGAGAGCATAAGATCCTGCCAGTGTGCCAAGTTTGCAGCTGACCAAACTTCTAGGTTGTA
2721 CTGGAATTATTCTATGCAACACTGATCCTTATATGAATGCGTTTCTTCTGAATGATGTTGACTACCCTTCTTACAACAAA
2801 ACTGTTTCTTTTTTATTGCAAATAGGGCTCTTGGTGTTTTTTACTTTTTTGTACATATCACAGTACATGGTTTTTCACTC
2881 TTTAGTTTATTTCATTTTATTGGAATTAACTTTTTTTTATTCTAATACTGACAGAGTTTGTAATCTCTATATAATACGTA
2961 ATTACTCCAATTACAGCACTTTTACCTTGAAGAGCATCTCAGTTTTTCCCACAATTTCATTGAGTCATCAGAGACTGATG
3041 TTGCTTCTTGGTTTCAAATTTGGTCCTAAAGAAACTTTCGGCTGTAGAAACAAAAGCACAGAGTGAATTTTTTACAAAAG
3121 ACAGGGAATATAGAATAGTCATTACAGACACAAATAACCCTAGTAGCACGAAGTTGGTGTTTTCTCTGTTTTTACTTAAG
3201 ATTAAGAAGATTTTTGGTGACTCTGAACTCTTTATTTATATTTCAGTTTAAAATATCAAGACTAAGGGGCATCAGTTATC
3281 TTTACTCTTTAATATTGCCCATATTTTAATAAATTACACTAATTAAACGCATATTTTCAGCATACCAGTGGAATTAATTT
3361 TGTGGATCACACACATTTAAATAGTCATATTGTGGGAATATTATAGCTGGTAACCAGCTGATATTGATTCTTATTATAGG
3441 AATGACTGTAATGATAGTGGTGGTAGCAGTAGTGATATTAGCGGTGGTGGTGATGTGAAGTAAAATAAAAGTATATATTA
3521 TATTGTGCCCAATTTATTAGAAATTATTTGATCAATGCTTCATTTCATTAAAATATCATAAAGATGTTTATAGTATTTTT
3601 TTACTTTATTATTTAAATCATAACTAACAATATTTTTAAAAACTTATTTTCATTGCTACAATGTCAAATATTCCAAAATC
3681 AGCCAACTACAGCTATATATGTGTTATGTGTGACAGAAGTGATCTTCCTTCCCTCTTTTTGAGCTTGACATGAAAGTGAA
3761 AGAAGACTCAATGAATAATTATGAGCTATTTATTTAATAATTACTTGCCTTGGGTGTAATACAGTAATGAATGAGTGAAA
3841 CAAATATTCTCATTGAATATGATACAATGCTGTTTTCTGTATGTTTCATGTTCTATTATTAAAGGTATCCATTAGGCCAA
3921 AATTATTTAATCAAATTCTTTATCTGATAGGTAGATTGAGAGCATTTTCTTAATGCATTACCTTGTACATAAGTATACAC
4001 TTGGTAAAGTAGACGAAGTTGAAATATTAATTTCATTTGGCATTTAGCATGTGAATATGATTATTGTTTGATTGTGTCTG
4081 TATATTTGTTTGGTGACGTGCTCAGGTGCTCCCACTACTGATTAATGTGTGTGCTAATATCCTAAAAACACATATGAGGT
4161 TTAAGAAAAAATTTTCTTGTCTGAAAACATAAACATCTTAATAAAACTGATTTTGAAATAAAAACTAAAGTACTTGAAGA
4241 TATGTCTTGTTTCTAACTATATGTTGCATGCCATGTTGGTGATTTGCTAATGTGTTTTTTTGTTTGTTTGTTTTACCCAA
4321 ATCCCTTTGGAAAATCTAATGGACAAATGCAAATTCTTGGACTAAGGACTGTATAAATTGACCTGAAAATACATGAGAGT
4401 TGCATTTAAAAAAAAATGCTTGTAAATCCGTCTTGAGTTTTACTCTATGTAAAAATATGTCTTGGTTTTGTGATTGTATA
4481 CAAGATGTATCTTGATAACTTATGTAAACTGTGCCGTATAAAGGCTGTTGCCTCAGCCTTACTAATAAATACTGAAAATA
4561 TCACCTTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGUAGUAGUUUUGU-----UUACCUCa 5'
            |||  | ||||||     ||||||| 
Target 5' caCATACTGAAAACAAGAAGAATGGAGt 3'
 190 - 217 165.00 -14.40
2 
miRNA  3' agguagUAGUUUUGUUUACCUCa 5'
                | :|| |:|||||||| 
Target 5' ttttagAATAATATAAATGGAGg 3'
 2476 - 2498 161.00 -11.80
3 
miRNA  3' agGUAGUAGUUUUGUUUACCuca 5'
            ||||||| |||| |||||   
Target 5' aaCATCATCTAAACCAATGGcaa 3'
 1628 - 1650 149.00 -17.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN509962 1 COSMIC
COSN15625765 2 COSMIC
COSN26988231 9 COSMIC
COSN26988229 11 COSMIC
COSN19669405 21 COSMIC
COSN31483228 25 COSMIC
COSN26988230 26 COSMIC
COSN30164459 34 COSMIC
COSN30181824 41 COSMIC
COSN30186366 47 COSMIC
COSN31609197 53 COSMIC
COSN21635421 66 COSMIC
COSN30187617 70 COSMIC
COSN30524519 76 COSMIC
COSN30495248 84 COSMIC
COSN26988232 85 COSMIC
COSN30103515 86 COSMIC
COSN30479315 87 COSMIC
COSN30528210 94 COSMIC
COSN30189543 95 COSMIC
COSN30187551 96 COSMIC
COSN1354356 116 COSMIC
COSN18719491 120 COSMIC
COSN30100499 128 COSMIC
COSN30102676 131 COSMIC
COSN30169459 138 COSMIC
COSN8517755 145 COSMIC
COSN2237770 153 COSMIC
COSN30181921 155 COSMIC
COSN30461041 170 COSMIC
COSN509961 186 COSMIC
COSN30475906 213 COSMIC
COSN30469628 229 COSMIC
COSN30115333 290 COSMIC
COSN27354764 349 COSMIC
COSN8572228 382 COSMIC
COSN6517160 428 COSMIC
COSN23158223 459 COSMIC
COSN6894088 465 COSMIC
COSN28834702 466 COSMIC
COSN4872484 500 COSMIC
COSN5664160 506 COSMIC
COSN20091631 757 COSMIC
COSN25276571 1027 COSMIC
COSN8572227 1055 COSMIC
COSN16821782 1098 COSMIC
COSN2237769 1115 COSMIC
COSN25429248 1338 COSMIC
COSN9772197 1375 COSMIC
COSN22205554 1384 COSMIC
COSN28411408 1395 COSMIC
COSN2485085 1405 COSMIC
COSN19360730 1581 COSMIC
COSN25977632 1602 COSMIC
COSN8805670 1690 COSMIC
COSN20446718 1809 COSMIC
COSN5228648 1848 COSMIC
COSN14699786 1856 COSMIC
COSN32056705 1932 COSMIC
COSN20104397 2020 COSMIC
COSN2237768 2020 COSMIC
COSN20537073 2031 COSMIC
COSN15966894 2115 COSMIC
COSN30220471 2276 COSMIC
COSN5664159 2351 COSMIC
COSN19449462 2456 COSMIC
COSN25456766 2460 COSMIC
COSN15151925 2670 COSMIC
COSN26384432 2760 COSMIC
COSN9511811 2958 COSMIC
COSN26285421 2967 COSMIC
COSN2237767 3167 COSMIC
COSN2237766 3231 COSMIC
COSN15752282 3847 COSMIC
COSN20874241 3901 COSMIC
COSN9317491 3977 COSMIC
COSN19286308 4172 COSMIC
COSN6894087 4339 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1490866688 1 dbSNP
rs182941938 6 dbSNP
rs759141350 7 dbSNP
rs1430695785 11 dbSNP
rs1355482621 15 dbSNP
rs751371189 16 dbSNP
rs917073917 18 dbSNP
rs1053629983 19 dbSNP
rs41358550 20 dbSNP
rs1277158129 21 dbSNP
rs762864508 23 dbSNP
rs773186218 25 dbSNP
rs1323573211 31 dbSNP
rs1232797470 32 dbSNP
rs1405309835 45 dbSNP
rs764128307 47 dbSNP
rs760775659 48 dbSNP
rs981312125 52 dbSNP
rs1428161403 63 dbSNP
rs969955761 67 dbSNP
rs915859919 68 dbSNP
rs1261457378 70 dbSNP
rs1219485192 71 dbSNP
rs570671445 76 dbSNP
rs1352028173 81 dbSNP
rs767923608 88 dbSNP
rs1344701477 92 dbSNP
rs190701568 94 dbSNP
rs200527093 100 dbSNP
rs1234978232 101 dbSNP
rs1313371325 106 dbSNP
rs983789313 107 dbSNP
rs1283559839 111 dbSNP
rs1026036355 118 dbSNP
rs952472825 120 dbSNP
rs568087686 125 dbSNP
rs1189825882 131 dbSNP
rs993663933 132 dbSNP
rs961526067 134 dbSNP
rs1455069989 137 dbSNP
rs186704081 139 dbSNP
rs1008383288 144 dbSNP
rs528500916 146 dbSNP
rs890022424 169 dbSNP
rs1398460105 177 dbSNP
rs181160645 179 dbSNP
rs1011552749 195 dbSNP
rs893138794 196 dbSNP
rs1053176169 200 dbSNP
rs1323608987 201 dbSNP
rs1370040720 204 dbSNP
rs552883495 212 dbSNP
rs775553161 221 dbSNP
rs1045578673 226 dbSNP
rs948560161 235 dbSNP
rs76257165 239 dbSNP
rs563918602 244 dbSNP
rs544288431 247 dbSNP
rs984720787 248 dbSNP
rs575431343 261 dbSNP
rs1219710267 265 dbSNP
rs951714318 271 dbSNP
rs918923482 283 dbSNP
rs971793079 287 dbSNP
rs1195980206 302 dbSNP
rs561791039 302 dbSNP
rs1440783728 307 dbSNP
rs1408130463 309 dbSNP
rs1018677163 310 dbSNP
rs1162375804 311 dbSNP
rs917146723 313 dbSNP
rs1461772267 314 dbSNP
rs1195763838 322 dbSNP
rs1327764862 324 dbSNP
rs1333889318 325 dbSNP
rs1056915737 329 dbSNP
rs1280176921 331 dbSNP
rs1008330971 337 dbSNP
rs954229580 341 dbSNP
rs1447885482 346 dbSNP
rs550049312 348 dbSNP
rs1215927573 350 dbSNP
rs1012250366 355 dbSNP
rs190682330 365 dbSNP
rs1199203346 370 dbSNP
rs1483959259 378 dbSNP
rs893096976 378 dbSNP
rs983841782 379 dbSNP
rs745627628 380 dbSNP
rs1185259960 384 dbSNP
rs4141336 398 dbSNP
rs907269450 400 dbSNP
rs1166816622 410 dbSNP
rs144451857 411 dbSNP
rs962636521 414 dbSNP
rs1329499240 418 dbSNP
rs1356290376 433 dbSNP
rs1413031916 437 dbSNP
rs1315674055 441 dbSNP
rs770503394 448 dbSNP
rs894323195 449 dbSNP
rs185879325 456 dbSNP
rs1019190009 457 dbSNP
rs1268768141 483 dbSNP
rs1339162626 485 dbSNP
rs987677945 488 dbSNP
rs1275727396 490 dbSNP
rs1483716869 505 dbSNP
rs953519680 506 dbSNP
rs1256269259 507 dbSNP
rs748905566 508 dbSNP
rs1189246337 517 dbSNP
rs148689698 528 dbSNP
rs1000693273 546 dbSNP
rs1397694518 558 dbSNP
rs1168370963 564 dbSNP
rs777217639 565 dbSNP
rs1432859785 566 dbSNP
rs1337465440 571 dbSNP
rs1465355689 572 dbSNP
rs1398396035 573 dbSNP
rs930550482 579 dbSNP
rs919213504 582 dbSNP
rs755609576 596 dbSNP
rs1272346845 597 dbSNP
rs895774945 603 dbSNP
rs944409843 609 dbSNP
rs1368206670 616 dbSNP
rs113185502 619 dbSNP
rs548123741 620 dbSNP
rs374635106 625 dbSNP
rs985855665 631 dbSNP
rs954176979 633 dbSNP
rs1440041038 640 dbSNP
rs1249706206 650 dbSNP
rs937223898 654 dbSNP
rs1172962974 658 dbSNP
rs536875077 660 dbSNP
rs1436664471 664 dbSNP
rs1156985620 666 dbSNP
rs1384509437 684 dbSNP
rs1048198061 692 dbSNP
rs1369301999 697 dbSNP
rs780509724 698 dbSNP
rs1304819245 702 dbSNP
rs990367512 704 dbSNP
rs1234770978 705 dbSNP
rs145120758 709 dbSNP
rs1258509942 710 dbSNP
rs1349466387 712 dbSNP
rs1269735201 726 dbSNP
rs1466996329 728 dbSNP
rs1192856376 752 dbSNP
rs957844306 757 dbSNP
rs1434895371 758 dbSNP
rs1179744962 769 dbSNP
rs1259594163 772 dbSNP
rs12671252 789 dbSNP
rs374332456 795 dbSNP
rs1282185718 799 dbSNP
rs1246993944 809 dbSNP
rs1392683731 812 dbSNP
rs999239174 815 dbSNP
rs1461263592 821 dbSNP
rs1327066670 822 dbSNP
rs74774497 842 dbSNP
rs1390208175 843 dbSNP
rs972839484 849 dbSNP
rs1024363163 853 dbSNP
rs1013010517 855 dbSNP
rs894606067 856 dbSNP
rs545726919 858 dbSNP
rs1410721600 861 dbSNP
rs1212822904 872 dbSNP
rs930521115 882 dbSNP
rs953575271 886 dbSNP
rs1489402902 888 dbSNP
rs897715956 893 dbSNP
rs1036298860 897 dbSNP
rs1161818607 900 dbSNP
rs1419776866 901 dbSNP
rs566070328 904 dbSNP
rs1386423316 905 dbSNP
rs1475043819 908 dbSNP
rs1166072242 914 dbSNP
rs1178493541 915 dbSNP
rs1352032304 916 dbSNP
rs765576193 917 dbSNP
rs1460874818 929 dbSNP
rs1173005962 931 dbSNP
rs1298137389 945 dbSNP
rs552556242 946 dbSNP
rs978926592 960 dbSNP
rs985803809 961 dbSNP
rs969228780 964 dbSNP
rs149873736 965 dbSNP
rs915025672 967 dbSNP
rs990705368 968 dbSNP
rs1293652713 977 dbSNP
rs957580275 982 dbSNP
rs1225100193 990 dbSNP
rs1032312823 1005 dbSNP
rs1250693648 1005 dbSNP
rs1207378350 1008 dbSNP
rs563608084 1009 dbSNP
rs570119225 1010 dbSNP
rs1188953566 1011 dbSNP
rs1287543914 1014 dbSNP
rs971350520 1025 dbSNP
rs1170289861 1027 dbSNP
rs1374125656 1037 dbSNP
rs1432238591 1037 dbSNP
rs1359807422 1039 dbSNP
rs1373143518 1039 dbSNP
rs1413735051 1043 dbSNP
rs550374850 1046 dbSNP
rs1001421677 1053 dbSNP
rs905765987 1057 dbSNP
rs1294677407 1067 dbSNP
rs1024310889 1078 dbSNP
rs1230580848 1081 dbSNP
rs1278227731 1091 dbSNP
rs543754657 1092 dbSNP
rs1443283718 1093 dbSNP
rs1239447428 1096 dbSNP
rs896931571 1097 dbSNP
rs6971394 1099 dbSNP
rs943728769 1106 dbSNP
rs541587629 1107 dbSNP
rs764323872 1128 dbSNP
rs985094847 1129 dbSNP
rs1407150126 1139 dbSNP
rs1433564203 1148 dbSNP
rs1366538584 1153 dbSNP
rs1360535090 1167 dbSNP
rs932237905 1176 dbSNP
rs922158439 1180 dbSNP
rs1365693970 1184 dbSNP
rs1437144799 1190 dbSNP
rs541991257 1191 dbSNP
rs62465930 1204 dbSNP
rs1418377091 1207 dbSNP
rs968913475 1213 dbSNP
rs913353813 1216 dbSNP
rs1280904116 1218 dbSNP
rs1315315611 1220 dbSNP
rs988921798 1225 dbSNP
rs897669535 1228 dbSNP
rs1158628193 1230 dbSNP
rs1466553017 1231 dbSNP
rs1192232010 1243 dbSNP
rs1477377625 1249 dbSNP
rs1455137725 1257 dbSNP
rs1191238346 1273 dbSNP
rs554667627 1273 dbSNP
rs781114060 1275 dbSNP
rs1035673376 1277 dbSNP
rs1157961130 1279 dbSNP
rs1389024833 1283 dbSNP
rs1008772342 1284 dbSNP
rs890412115 1286 dbSNP
rs1050037169 1289 dbSNP
rs1201089535 1301 dbSNP
rs181383028 1305 dbSNP
rs1371299617 1307 dbSNP
rs969977437 1310 dbSNP
rs146199514 1311 dbSNP
rs1331599795 1313 dbSNP
rs1262172948 1319 dbSNP
rs1272993999 1328 dbSNP
rs1469288864 1340 dbSNP
rs914950944 1341 dbSNP
rs1247909723 1352 dbSNP
rs1468163313 1359 dbSNP
rs1318647973 1362 dbSNP
rs1053552873 1364 dbSNP
rs936132458 1367 dbSNP
rs1162486794 1368 dbSNP
rs757205482 1372 dbSNP
rs1224419905 1385 dbSNP
rs924804679 1394 dbSNP
rs977623423 1395 dbSNP
rs1344315721 1400 dbSNP
rs995785367 1402 dbSNP
rs190688771 1411 dbSNP
rs746804487 1417 dbSNP
rs6963266 1418 dbSNP
rs1352767172 1422 dbSNP
rs1007992772 1425 dbSNP
rs890853984 1429 dbSNP
rs1231742142 1430 dbSNP
rs1049444884 1437 dbSNP
rs917535681 1439 dbSNP
rs1230465978 1441 dbSNP
rs1398759937 1443 dbSNP
rs559003312 1446 dbSNP
rs958754368 1448 dbSNP
rs1437822495 1460 dbSNP
rs1203809174 1477 dbSNP
rs1251955029 1479 dbSNP
rs1483818066 1483 dbSNP
rs1185370137 1484 dbSNP
rs1416842218 1487 dbSNP
rs1028126274 1492 dbSNP
rs1319486186 1502 dbSNP
rs543205518 1505 dbSNP
rs994940187 1513 dbSNP
rs1417277498 1514 dbSNP
rs759467408 1526 dbSNP
rs1409371850 1532 dbSNP
rs1308692238 1536 dbSNP
rs932290203 1538 dbSNP
rs1422389951 1539 dbSNP
rs754077110 1544 dbSNP
rs1312504477 1547 dbSNP
rs1178202852 1558 dbSNP
rs1480540106 1559 dbSNP
rs141649437 1560 dbSNP
rs1268861262 1571 dbSNP
rs1191214240 1573 dbSNP
rs1229845607 1584 dbSNP
rs1274661642 1589 dbSNP
rs947594270 1591 dbSNP
rs1208197792 1593 dbSNP
rs56302843 1594 dbSNP
rs748953635 1595 dbSNP
rs988916702 1597 dbSNP
rs1050322253 1598 dbSNP
rs1242636332 1600 dbSNP
rs1475016329 1604 dbSNP
rs1169176820 1607 dbSNP
rs960139219 1613 dbSNP
rs1432960662 1614 dbSNP
rs138419154 1618 dbSNP
rs1403179013 1631 dbSNP
rs1416422593 1634 dbSNP
rs980106478 1635 dbSNP
rs1326229615 1637 dbSNP
rs1436404346 1637 dbSNP
rs970029668 1642 dbSNP
rs995768379 1647 dbSNP
rs1205889566 1649 dbSNP
rs777463044 1659 dbSNP
rs1053906081 1681 dbSNP
rs1324521822 1696 dbSNP
rs935090724 1699 dbSNP
rs923717338 1717 dbSNP
rs769336985 1719 dbSNP
rs950223413 1730 dbSNP
rs1271312391 1731 dbSNP
rs1447919796 1741 dbSNP
rs1356967862 1743 dbSNP
rs1338123037 1746 dbSNP
rs535131088 1749 dbSNP
rs1015444648 1751 dbSNP
rs6979945 1766 dbSNP
rs991755431 1773 dbSNP
rs958924474 1787 dbSNP
rs920610322 1790 dbSNP
rs1430117675 1801 dbSNP
rs1419904165 1808 dbSNP
rs10486985 1809 dbSNP
rs1384613453 1810 dbSNP
rs750475413 1812 dbSNP
rs1222171947 1818 dbSNP
rs1049495904 1821 dbSNP
rs1323036801 1823 dbSNP
rs1392911232 1831 dbSNP
rs962145130 1833 dbSNP
rs1299933539 1835 dbSNP
rs1014986164 1840 dbSNP
rs1008661140 1843 dbSNP
rs1241426367 1848 dbSNP
rs954557052 1849 dbSNP
rs1028832119 1852 dbSNP
rs538682722 1855 dbSNP
rs570346044 1860 dbSNP
rs1234879636 1863 dbSNP
rs1277424334 1864 dbSNP
rs768066161 1866 dbSNP
rs996561182 1867 dbSNP
rs903528545 1875 dbSNP
rs996051129 1881 dbSNP
rs1269832273 1883 dbSNP
rs1043758752 1897 dbSNP
rs758916269 1904 dbSNP
rs879504594 1905 dbSNP
rs1434982069 1907 dbSNP
rs1257705810 1908 dbSNP
rs1202638264 1910 dbSNP
rs1179846594 1912 dbSNP
rs1031996699 1915 dbSNP
rs947683569 1922 dbSNP
rs913456959 1930 dbSNP
rs1473080084 1941 dbSNP
rs1161784884 1948 dbSNP
rs1053245464 1949 dbSNP
rs187064863 1961 dbSNP
rs79422781 1966 dbSNP
rs1196276412 1968 dbSNP
rs1294638528 1972 dbSNP
rs1387998042 1975 dbSNP
rs1326362824 1980 dbSNP
rs1381205862 1984 dbSNP
rs1228685200 1997 dbSNP
rs902244986 1998 dbSNP
rs1452733049 1999 dbSNP
rs1375466837 2007 dbSNP
rs1046200123 2014 dbSNP
rs1296113892 2017 dbSNP
rs760086406 2019 dbSNP
rs867918196 2021 dbSNP
rs530313511 2023 dbSNP
rs948779495 2028 dbSNP
rs199679908 2030 dbSNP
rs201762313 2031 dbSNP
rs200367971 2032 dbSNP
rs113126131 2038 dbSNP
rs1423611718 2038 dbSNP
rs755952795 2038 dbSNP
rs75819913 2038 dbSNP
rs769061687 2038 dbSNP
rs1056020017 2045 dbSNP
rs1370701969 2050 dbSNP
rs974454901 2051 dbSNP
rs1403332514 2052 dbSNP
rs961340237 2054 dbSNP
rs937606134 2056 dbSNP
rs920880943 2057 dbSNP
rs1369429172 2058 dbSNP
rs1015910844 2064 dbSNP
rs1309477982 2067 dbSNP
rs1387019563 2068 dbSNP
rs1184091608 2072 dbSNP
rs986663180 2073 dbSNP
rs1445344080 2103 dbSNP
rs1313243380 2105 dbSNP
rs370078299 2106 dbSNP
rs1323396813 2109 dbSNP
rs181002947 2114 dbSNP
rs547935256 2116 dbSNP
rs1237619342 2117 dbSNP
rs1273947414 2118 dbSNP
rs1342970529 2118 dbSNP
rs1175744753 2119 dbSNP
rs1255655444 2124 dbSNP
rs1481736313 2128 dbSNP
rs1028128246 2129 dbSNP
rs940705402 2146 dbSNP
rs139887015 2155 dbSNP
rs1427212708 2158 dbSNP
rs1859174 2159 dbSNP
rs545769194 2165 dbSNP
rs1388936936 2167 dbSNP
rs1021985937 2169 dbSNP
rs1357651001 2174 dbSNP
rs754055962 2176 dbSNP
rs954505062 2179 dbSNP
rs892082846 2192 dbSNP
rs1465268239 2193 dbSNP
rs1028779724 2195 dbSNP
rs1053298028 2197 dbSNP
rs1294624430 2199 dbSNP
rs1247288980 2201 dbSNP
rs1352400474 2203 dbSNP
rs938896874 2206 dbSNP
rs907389247 2208 dbSNP
rs1296800232 2215 dbSNP
rs764378824 2216 dbSNP
rs532052285 2220 dbSNP
rs373321667 2229 dbSNP
rs1278339976 2233 dbSNP
rs1311808365 2249 dbSNP
rs1392832523 2250 dbSNP
rs1032694160 2258 dbSNP
rs563239631 2270 dbSNP
rs940006623 2271 dbSNP
rs999179019 2273 dbSNP
rs1249171943 2276 dbSNP
rs543317707 2280 dbSNP
rs902195751 2282 dbSNP
rs574254884 2283 dbSNP
rs77984596 2291 dbSNP
rs760939040 2296 dbSNP
rs894937667 2298 dbSNP
rs62465929 2299 dbSNP
rs1271340839 2303 dbSNP
rs1164189527 2307 dbSNP
rs572477953 2312 dbSNP
rs1319722179 2315 dbSNP
rs1859173 2316 dbSNP
rs899390813 2320 dbSNP
rs1363362566 2321 dbSNP
rs1367041294 2331 dbSNP
rs775066274 2341 dbSNP
rs1038372761 2346 dbSNP
rs967853788 2348 dbSNP
rs1022455581 2355 dbSNP
rs1327412564 2360 dbSNP
rs1208487735 2362 dbSNP
rs539011955 2363 dbSNP
rs1466620337 2369 dbSNP
rs1420893012 2370 dbSNP
rs1408986108 2371 dbSNP
rs759459402 2376 dbSNP
rs1191328487 2383 dbSNP
rs552233566 2387 dbSNP
rs189141358 2388 dbSNP
rs1158122155 2390 dbSNP
rs1412468773 2393 dbSNP
rs1458716525 2399 dbSNP
rs1321516717 2405 dbSNP
rs1190788147 2410 dbSNP
rs532211484 2414 dbSNP
rs987470557 2428 dbSNP
rs933397699 2451 dbSNP
rs1271466556 2462 dbSNP
rs1228066024 2472 dbSNP
rs892128695 2478 dbSNP
rs922047107 2479 dbSNP
rs556847064 2481 dbSNP
rs1331695415 2488 dbSNP
rs1034614830 2491 dbSNP
rs1488243216 2504 dbSNP
rs974582645 2505 dbSNP
rs1240568773 2508 dbSNP
rs536954788 2511 dbSNP
rs907440315 2514 dbSNP
rs1300196710 2531 dbSNP
rs1221285743 2546 dbSNP
rs1481843385 2547 dbSNP
rs958132239 2548 dbSNP
rs1252195806 2549 dbSNP
rs948885900 2563 dbSNP
rs1032233475 2565 dbSNP
rs898611827 2566 dbSNP
rs978424067 2573 dbSNP
rs567825184 2578 dbSNP
rs547949449 2579 dbSNP
rs1166972888 2587 dbSNP
rs966329978 2594 dbSNP
rs908560270 2595 dbSNP
rs1024645916 2600 dbSNP
rs1051071998 2604 dbSNP
rs1290486289 2606 dbSNP
rs1013293034 2610 dbSNP
rs1364406617 2612 dbSNP
rs1176039452 2613 dbSNP
rs1446273461 2616 dbSNP
rs146122383 2617 dbSNP
rs1033870614 2620 dbSNP
rs565759757 2635 dbSNP
rs866844897 2641 dbSNP
rs1293274795 2644 dbSNP
rs1001681673 2649 dbSNP
rs563494007 2656 dbSNP
rs1203929739 2660 dbSNP
rs142987828 2667 dbSNP
rs1439259320 2668 dbSNP
rs1185099852 2670 dbSNP
rs1236729207 2675 dbSNP
rs1473056183 2678 dbSNP
rs1183557670 2682 dbSNP
rs1260300789 2689 dbSNP
rs899336987 2693 dbSNP
rs1169381023 2697 dbSNP
rs117865726 2699 dbSNP
rs1005541470 2702 dbSNP
rs1254876972 2718 dbSNP
rs1450733674 2725 dbSNP
rs1296066615 2732 dbSNP
rs1201462500 2738 dbSNP
rs886725061 2742 dbSNP
rs956427114 2749 dbSNP
rs1297738653 2752 dbSNP
rs762781502 2755 dbSNP
rs1051701050 2760 dbSNP
rs933345342 2761 dbSNP
rs921994761 2765 dbSNP
rs148163513 2778 dbSNP
rs936486095 2786 dbSNP
rs1297664958 2793 dbSNP
rs1392128951 2798 dbSNP
rs140439520 2806 dbSNP
rs1023629598 2811 dbSNP
rs1013122030 2815 dbSNP
rs1416510661 2819 dbSNP
rs1319036849 2821 dbSNP
rs1336155913 2826 dbSNP
rs1468245207 2830 dbSNP
rs925112728 2834 dbSNP
rs977991480 2838 dbSNP
rs1327711962 2839 dbSNP
rs898660207 2842 dbSNP
rs1038510246 2843 dbSNP
rs574792522 2853 dbSNP
rs966611006 2855 dbSNP
rs917869591 2861 dbSNP
rs1461817145 2867 dbSNP
rs549632694 2873 dbSNP
rs887174445 2880 dbSNP
rs1209314937 2884 dbSNP
rs1196012186 2886 dbSNP
rs1263865734 2889 dbSNP
rs1449955622 2889 dbSNP
rs1051126151 2890 dbSNP
rs1242056046 2891 dbSNP
rs959040318 2903 dbSNP
rs529962112 2910 dbSNP
rs533199976 2919 dbSNP
rs933971781 2919 dbSNP
rs1462213567 2929 dbSNP
rs995666212 2933 dbSNP
rs1474016422 2934 dbSNP
rs1279204301 2942 dbSNP
rs560874136 2957 dbSNP
rs111366767 2958 dbSNP
rs1005036019 2961 dbSNP
rs1337259354 2980 dbSNP
rs915072462 2983 dbSNP
rs369848448 2985 dbSNP
rs1252822043 2994 dbSNP
rs769463736 3001 dbSNP
rs1328232332 3002 dbSNP
rs1228145954 3011 dbSNP
rs1262412249 3018 dbSNP
rs112104928 3020 dbSNP
rs1209279330 3027 dbSNP
rs1051982984 3049 dbSNP
rs927703080 3057 dbSNP
rs981775155 3062 dbSNP
rs369793613 3063 dbSNP
rs541111447 3068 dbSNP
rs1450584565 3072 dbSNP
rs1473130329 3075 dbSNP
rs900512166 3079 dbSNP
rs1013601007 3080 dbSNP
rs149342498 3081 dbSNP
rs776119702 3091 dbSNP
rs1457886068 3092 dbSNP
rs1337698687 3094 dbSNP
rs1162075811 3100 dbSNP
rs1365695271 3101 dbSNP
rs1039079775 3107 dbSNP
rs962971397 3110 dbSNP
rs185079729 3117 dbSNP
rs1349562467 3121 dbSNP
rs1169997608 3123 dbSNP
rs191801159 3124 dbSNP
rs188527672 3125 dbSNP
rs558648200 3126 dbSNP
rs1243999553 3128 dbSNP
rs998231007 3131 dbSNP
rs1243193780 3136 dbSNP
rs1203211806 3144 dbSNP
rs1180695327 3158 dbSNP
rs1483543167 3160 dbSNP
rs574372664 3161 dbSNP
rs1254537065 3163 dbSNP
rs1423703785 3164 dbSNP
rs1039679200 3165 dbSNP
rs1385252322 3169 dbSNP
rs1252473334 3170 dbSNP
rs1166249544 3173 dbSNP
rs1369518338 3176 dbSNP
rs1196166479 3179 dbSNP
rs1355330667 3190 dbSNP
rs1299624874 3195 dbSNP
rs1289533152 3200 dbSNP
rs1248053265 3206 dbSNP
rs1399841467 3218 dbSNP
rs1361738319 3222 dbSNP
rs1315821031 3231 dbSNP
rs1395320666 3242 dbSNP
rs946644662 3246 dbSNP
rs992084573 3252 dbSNP
rs1441834430 3256 dbSNP
rs1334219565 3257 dbSNP
rs1052726408 3260 dbSNP
rs1331056158 3260 dbSNP
rs779450692 3262 dbSNP
rs866309927 3269 dbSNP
rs937621737 3271 dbSNP
rs554208322 3272 dbSNP
rs1483135159 3284 dbSNP
rs981827274 3297 dbSNP
rs1245502958 3300 dbSNP
rs111312990 3301 dbSNP
rs571752580 3302 dbSNP
rs1301885741 3304 dbSNP
rs962761550 3316 dbSNP
rs1015366138 3324 dbSNP
rs1172100132 3325 dbSNP
rs552211193 3328 dbSNP
rs950897040 3329 dbSNP
rs1408168271 3330 dbSNP
rs17156625 3331 dbSNP
rs1319925755 3335 dbSNP
rs1157467630 3345 dbSNP
rs569285138 3347 dbSNP
rs1362754315 3348 dbSNP
rs778233364 3350 dbSNP
rs900794254 3354 dbSNP
rs1299446036 3360 dbSNP
rs1468104144 3361 dbSNP
rs1365216645 3371 dbSNP
rs1182022263 3377 dbSNP
rs1311896538 3381 dbSNP
rs1490139539 3382 dbSNP
rs951530216 3383 dbSNP
rs1265436968 3388 dbSNP
rs184595601 3389 dbSNP
rs1208689395 3392 dbSNP
rs529673211 3398 dbSNP
rs574214003 3401 dbSNP
rs903917943 3404 dbSNP
rs1187824912 3411 dbSNP
rs998283158 3415 dbSNP
rs1042513829 3419 dbSNP
rs192045293 3423 dbSNP
rs1432276768 3425 dbSNP
rs1223300751 3433 dbSNP
rs1431202208 3438 dbSNP
rs1455512522 3441 dbSNP
rs79283508 3451 dbSNP
rs1018713688 3452 dbSNP
rs1239999420 3458 dbSNP
rs1010892794 3461 dbSNP
rs1291897430 3462 dbSNP
rs1367140372 3466 dbSNP
rs767764600 3467 dbSNP
rs564939306 3470 dbSNP
rs1285544434 3474 dbSNP
rs893747221 3482 dbSNP
rs1301671448 3483 dbSNP
rs1407361031 3485 dbSNP
rs545484577 3487 dbSNP
rs1056349840 3488 dbSNP
rs1319326142 3489 dbSNP
rs935208229 3494 dbSNP
rs576631683 3500 dbSNP
rs189172360 3514 dbSNP
rs1244526723 3524 dbSNP
rs1199703460 3525 dbSNP
rs906381358 3525 dbSNP
rs937917191 3529 dbSNP
rs1046193722 3530 dbSNP
rs755065792 3531 dbSNP
rs1366748975 3542 dbSNP
rs974127846 3544 dbSNP
rs941703072 3547 dbSNP
rs1349406576 3551 dbSNP
rs183809562 3553 dbSNP
rs751494952 3554 dbSNP
rs908257855 3558 dbSNP
rs983040768 3562 dbSNP
rs982505710 3570 dbSNP
rs1386470414 3578 dbSNP
rs552614451 3583 dbSNP
rs1030455220 3591 dbSNP
rs1280549561 3596 dbSNP
rs1376139401 3596 dbSNP
rs536439985 3603 dbSNP
rs976256620 3603 dbSNP
rs1479905374 3621 dbSNP
rs1358123943 3638 dbSNP
rs1029854276 3644 dbSNP
rs567912953 3645 dbSNP
rs1481890763 3646 dbSNP
rs1181158337 3651 dbSNP
rs976899569 3651 dbSNP
rs1471095102 3657 dbSNP
rs554399303 3661 dbSNP
rs1201339461 3668 dbSNP
rs1480604743 3685 dbSNP
rs965318626 3686 dbSNP
rs1241475480 3691 dbSNP
rs1413098465 3694 dbSNP
rs1445306041 3701 dbSNP
rs1165625610 3703 dbSNP
rs1017880778 3705 dbSNP
rs1018351903 3707 dbSNP
rs1329908029 3715 dbSNP
rs1001250245 3728 dbSNP
rs540581762 3732 dbSNP
rs376050838 3741 dbSNP
rs1021011512 3746 dbSNP
rs1246029219 3750 dbSNP
rs1323070425 3753 dbSNP
rs1009653175 3755 dbSNP
rs1194901012 3756 dbSNP
rs1281550229 3760 dbSNP
rs762755232 3765 dbSNP
rs1273370942 3769 dbSNP
rs1439361496 3772 dbSNP
rs1207833201 3779 dbSNP
rs999410220 3784 dbSNP
rs1368688398 3793 dbSNP
rs578099469 3804 dbSNP
rs1056296270 3807 dbSNP
rs906443605 3808 dbSNP
rs1046246399 3814 dbSNP
rs1012076182 3816 dbSNP
rs894930037 3817 dbSNP
rs548047669 3831 dbSNP
rs1333967922 3832 dbSNP
rs1407445422 3853 dbSNP
rs558093649 3867 dbSNP
rs1455073010 3868 dbSNP
rs1338076803 3879 dbSNP
rs1318393803 3880 dbSNP
rs941741658 3881 dbSNP
rs907549987 3883 dbSNP
rs1270401452 3885 dbSNP
rs1047405996 3891 dbSNP
rs930233889 3905 dbSNP
rs534355447 3911 dbSNP
rs1038300939 3915 dbSNP
rs565685143 3923 dbSNP
rs964240656 3942 dbSNP
rs1446488308 3948 dbSNP
rs1194074329 3951 dbSNP
rs764940724 3956 dbSNP
rs1470140493 3957 dbSNP
rs911338632 3962 dbSNP
rs1418498447 3964 dbSNP
rs989586914 3968 dbSNP
rs1430462165 3970 dbSNP
rs1471202486 3980 dbSNP
rs958332187 3988 dbSNP
rs1388627815 3992 dbSNP
rs555877224 3994 dbSNP
rs535839397 3999 dbSNP
rs1243973263 4010 dbSNP
rs1046756726 4013 dbSNP
rs761516342 4014 dbSNP
rs933735694 4015 dbSNP
rs1205783417 4019 dbSNP
rs1266160927 4022 dbSNP
rs1349918968 4031 dbSNP
rs1205765442 4039 dbSNP
rs776249523 4040 dbSNP
rs1230242017 4046 dbSNP
rs1313196506 4047 dbSNP
rs1198966356 4048 dbSNP
rs1269972442 4053 dbSNP
rs976204085 4067 dbSNP
rs75443649 4073 dbSNP
rs910766617 4077 dbSNP
rs979709814 4085 dbSNP
rs547628091 4087 dbSNP
rs562085118 4088 dbSNP
rs527604627 4093 dbSNP
rs1005989069 4097 dbSNP
rs886171180 4098 dbSNP
rs866217063 4099 dbSNP
rs1020957811 4100 dbSNP
rs1009599346 4103 dbSNP
rs1047457878 4105 dbSNP
rs960761707 4107 dbSNP
rs932964656 4111 dbSNP
rs1451323916 4117 dbSNP
rs552174738 4118 dbSNP
rs1239716482 4128 dbSNP
rs1281285244 4133 dbSNP
rs1221922582 4139 dbSNP
rs1354346409 4139 dbSNP
rs1041300219 4142 dbSNP
rs1490914201 4148 dbSNP
rs1338348015 4154 dbSNP
rs1250285962 4156 dbSNP
rs1002415293 4158 dbSNP
rs905030876 4160 dbSNP
rs1184608361 4176 dbSNP
rs1364967100 4190 dbSNP
rs1038658219 4197 dbSNP
rs746495862 4198 dbSNP
rs1365784810 4206 dbSNP
rs887060663 4208 dbSNP
rs1046702660 4218 dbSNP
rs990029821 4226 dbSNP
rs958179142 4232 dbSNP
rs933681786 4244 dbSNP
rs978104876 4245 dbSNP
rs1411389057 4249 dbSNP
rs970707175 4259 dbSNP
rs1338701956 4267 dbSNP
rs1245304400 4286 dbSNP
rs1315885436 4292 dbSNP
rs774820320 4301 dbSNP
rs1361800937 4302 dbSNP
rs1420147137 4302 dbSNP
rs1251045520 4314 dbSNP
rs1481172765 4323 dbSNP
rs1162807091 4336 dbSNP
rs1039468748 4340 dbSNP
rs771491027 4341 dbSNP
rs1461303416 4343 dbSNP
rs1182387825 4348 dbSNP
rs1385344874 4358 dbSNP
rs6956122 4360 dbSNP
rs569726953 4373 dbSNP
rs959528543 4382 dbSNP
rs531578700 4389 dbSNP
rs910718194 4394 dbSNP
rs1016122674 4399 dbSNP
rs1299710309 4402 dbSNP
rs562967663 4407 dbSNP
rs1451857605 4408 dbSNP
rs1337425912 4415 dbSNP
rs1385092047 4416 dbSNP
rs1026066456 4417 dbSNP
rs886223668 4417 dbSNP
rs550038913 4419 dbSNP
rs543147709 4421 dbSNP
rs878868349 4427 dbSNP
rs1230040330 4429 dbSNP
rs529893833 4430 dbSNP
rs914180076 4433 dbSNP
rs1323400511 4446 dbSNP
rs1202872760 4454 dbSNP
rs1204865791 4460 dbSNP
rs1243153855 4465 dbSNP
rs901514860 4474 dbSNP
rs1309595127 4481 dbSNP
rs1039079414 4484 dbSNP
rs1428800666 4485 dbSNP
rs942983300 4487 dbSNP
rs1245849994 4489 dbSNP
rs560303181 4502 dbSNP
rs1426983819 4509 dbSNP
rs1469170099 4514 dbSNP
rs6955913 4516 dbSNP
rs1408286395 4527 dbSNP
rs1316526744 4530 dbSNP
rs1228587389 4532 dbSNP
rs1372172065 4535 dbSNP
rs541300258 4537 dbSNP
rs960709348 4550 dbSNP
rs1288413023 4561 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.869 3.7e-8 0.650 3.9e-4 23 Click to see details
GSE28544 Breast cancer -0.695 8.2e-5 -0.648 3.1e-4 24 Click to see details
GSE19350 CNS germ cell tumors -0.585 2.3e-2 -0.378 1.1e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.366 3.6e-2 -0.173 2.0e-1 25 Click to see details
GSE17306 Multiple myeloma -0.241 4.8e-2 -0.200 8.4e-2 49 Click to see details
GSE28260 Renal cortex and medulla 0.453 6.0e-2 0.379 1.0e-1 13 Click to see details
GSE21032 Prostate cancer -0.132 1.2e-1 -0.058 3.0e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.202 1.7e-1 -0.115 2.9e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.119 1.7e-1 -0.024 4.3e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.201 2.0e-1 0.197 2.0e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.138 2.3e-1 0.079 3.3e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.084 2.3e-1 0.104 1.8e-1 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.157 2.5e-1 -0.395 4.2e-2 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.217 2.9e-1 0.150 3.5e-1 9 Click to see details
GSE17498 Multiple myeloma -0.052 3.7e-1 -0.088 2.9e-1 40 Click to see details
GSE19536 Breast cancer 0.009 4.6e-1 0.103 1.5e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.641 0.03 -0.567 0.06 9 Click to see details
PCPG 0.972 0.08 1.000 0.5 3 Click to see details
KIRP -0.208 0.13 -0.159 0.19 32 Click to see details
ESCA 0.368 0.13 0.336 0.16 11 Click to see details
THCA 0.144 0.14 0.058 0.33 57 Click to see details
UCEC 0.233 0.17 0.330 0.08 19 Click to see details
STAD -0.129 0.24 -0.143 0.22 32 Click to see details
KICH -0.144 0.25 0.140 0.25 25 Click to see details
LUAD 0.201 0.27 0.182 0.29 12 Click to see details
BLCA 0.128 0.31 0.133 0.3 18 Click to see details
PRAD -0.069 0.32 0.107 0.23 50 Click to see details
HNSC -0.073 0.32 -0.078 0.31 42 Click to see details
BRCA -0.041 0.36 -0.072 0.26 84 Click to see details
COAD -0.19 0.41 -0.800 0.1 4 Click to see details
PAAD -0.145 0.43 -0.400 0.3 4 Click to see details
LIHC 0.024 0.43 0.086 0.28 49 Click to see details
KIRC -0.014 0.45 0.059 0.32 68 Click to see details
CESC -0.055 0.48 -0.500 0.33 3 Click to see details
LUSC -0.002 0.5 -0.017 0.46 38 Click to see details
LUSC -0.002 0.5 -0.017 0.46 38 Click to see details
LUSC -0.002 0.5 -0.017 0.46 38 Click to see details
154 hsa-miR-136-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006867 MTDH metadherin 3 1
MIRT006868 BCL2 BCL2, apoptosis regulator 1 1
MIRT104077 RAC1 Rac family small GTPase 1 2 10
MIRT213511 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT387257 SOX9 SRY-box 9 2 2
MIRT404278 PURB purine rich element binding protein B 2 2
MIRT438060 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 3 1
MIRT439203 ZNF429 zinc finger protein 429 1 1
MIRT439242 ZCRB1 zinc finger CCHC-type and RNA binding motif containing 1 1 1
MIRT439351 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT439353 UBQLN1 ubiquilin 1 1 1
MIRT439365 UBE2D3 ubiquitin conjugating enzyme E2 D3 1 1
MIRT439431 TMEM30A transmembrane protein 30A 1 1
MIRT439468 TFRC transferrin receptor 1 1
MIRT439530 STAG2 stromal antigen 2 1 1
MIRT439572 SNX13 sorting nexin 13 1 1
MIRT439576 SNAP25 synaptosome associated protein 25 1 1
MIRT439701 SCARB2 scavenger receptor class B member 2 1 1
MIRT439754 RNF6 ring finger protein 6 1 1
MIRT439841 RAB21 RAB21, member RAS oncogene family 1 1
MIRT439946 PLOD2 procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 1 1
MIRT439948 PLEKHA6 pleckstrin homology domain containing A6 1 1
MIRT439990 PHACTR2 phosphatase and actin regulator 2 1 1
MIRT440001 PERP PERP, TP53 apoptosis effector 1 1
MIRT440028 PCLO piccolo presynaptic cytomatrix protein 1 1
MIRT440077 NUDT3 nudix hydrolase 3 1 1
MIRT440079 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 1
MIRT440107 NIPBL NIPBL, cohesin loading factor 1 1
MIRT440148 NARS asparaginyl-tRNA synthetase 1 1
MIRT440196 MTPN myotrophin 1 1
MIRT440203 MTMR4 myotubularin related protein 4 1 1
MIRT440295 MADD MAP kinase activating death domain 1 1
MIRT440302 LUZP6 leucine zipper protein 6 1 1
MIRT440330 LGALS8 galectin 8 1 1
MIRT440344 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 1
MIRT440398 KDM5A lysine demethylase 5A 1 1
MIRT440502 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 1 1
MIRT440527 H2AFV H2A histone family member V 1 1
MIRT440553 GNAS GNAS complex locus 1 1
MIRT440574 GGA1 golgi associated, gamma adaptin ear containing, ARF binding protein 1 1 1
MIRT440623 FNIP1 folliculin interacting protein 1 1 1
MIRT440690 FAM105A family with sequence similarity 105 member A 1 1
MIRT440731 EIF4G3 eukaryotic translation initiation factor 4 gamma 3 1 1
MIRT440772 DST dystonin 1 1
MIRT441008 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441027 CACNA1D calcium voltage-gated channel subunit alpha1 D 1 1
MIRT441172 ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 1 1
MIRT441303 ABI2 abl interactor 2 1 1
MIRT441310 ABCC8 ATP binding cassette subfamily C member 8 1 1
MIRT454544 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT457253 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT463197 ZNF148 zinc finger protein 148 2 4
MIRT465732 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT476922 FBLIM1 filamin binding LIM protein 1 2 2
MIRT477708 EFHD2 EF-hand domain family member D2 2 2
MIRT506318 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT507922 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT513679 SLC38A1 solute carrier family 38 member 1 2 2
MIRT528015 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528780 FCGR3B Fc fragment of IgG receptor IIIb 2 2
MIRT529636 ZNF621 zinc finger protein 621 2 2
MIRT532161 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT532745 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT534214 SLC37A3 solute carrier family 37 member 3 2 4
MIRT544778 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT553854 SYDE2 synapse defective Rho GTPase homolog 2 2 2
MIRT554051 SOCS7 suppressor of cytokine signaling 7 2 2
MIRT557741 FUT4 fucosyltransferase 4 2 2
MIRT558903 CCDC58 coiled-coil domain containing 58 2 2
MIRT562347 EXOSC2 exosome component 2 2 2
MIRT562614 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT566322 POTEM POTE ankyrin domain family member M 2 2
MIRT566333 POTEG POTE ankyrin domain family member G 2 2
MIRT570178 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT570833 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT571888 MSL2 MSL complex subunit 2 2 2
MIRT615151 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 2
MIRT619071 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619559 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT621353 GUCA1B guanylate cyclase activator 1B 2 2
MIRT624082 DR1 down-regulator of transcription 1 2 2
MIRT624263 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT625027 ZNF730 zinc finger protein 730 2 2
MIRT625283 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT630596 C2CD2 C2 calcium dependent domain containing 2 2 2
MIRT634452 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT641251 CENPN centromere protein N 2 2
MIRT641398 NUBPL nucleotide binding protein like 2 2
MIRT643485 DISC1 disrupted in schizophrenia 1 2 2
MIRT644642 ICA1L islet cell autoantigen 1 like 2 2
MIRT644655 SNX9 sorting nexin 9 2 2
MIRT644833 SEC14L4 SEC14 like lipid binding 4 2 2
MIRT645323 GPR158 G protein-coupled receptor 158 2 2
MIRT646107 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT647885 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT648026 ZDHHC24 zinc finger DHHC-type containing 24 2 2
MIRT648537 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT648550 CCDC140 coiled-coil domain containing 140 2 2
MIRT649220 ZNF614 zinc finger protein 614 2 2
MIRT649561 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT650886 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT651191 ZNF281 zinc finger protein 281 2 2
MIRT652501 TMEM170A transmembrane protein 170A 2 2
MIRT653960 SEPN1 selenoprotein N 2 2
MIRT654316 RBM8A RNA binding motif protein 8A 2 2
MIRT654379 RBM12B RNA binding motif protein 12B 2 2
MIRT654396 RBFOX2 RNA binding protein, fox-1 homolog 2 2 2
MIRT655282 PER1 period circadian clock 1 2 2
MIRT655498 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT656307 METTL1 methyltransferase like 1 2 2
MIRT656396 MCU mitochondrial calcium uniporter 2 2
MIRT657954 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658453 FAM13B family with sequence similarity 13 member B 2 2
MIRT659145 DDHD1 DDHD domain containing 1 2 2
MIRT660427 ATXN1 ataxin 1 2 2
MIRT660880 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT661004 ABHD10 abhydrolase domain containing 10 2 2
MIRT663678 CCDC18 coiled-coil domain containing 18 2 2
MIRT682290 RLIM ring finger protein, LIM domain interacting 2 2
MIRT688370 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT707382 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708271 EGLN2 egl-9 family hypoxia inducible factor 2 2 2
MIRT708509 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT708611 CCDC71L coiled-coil domain containing 71 like 2 2
MIRT708654 LYRM7 LYR motif containing 7 2 2
MIRT708970 SLC12A3 solute carrier family 12 member 3 2 2
MIRT709252 CENPM centromere protein M 2 2
MIRT710540 SERINC1 serine incorporator 1 2 2
MIRT712085 UNC13A unc-13 homolog A 2 2
MIRT712466 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712940 GALP galanin like peptide 2 2
MIRT715227 NPVF neuropeptide VF precursor 2 2
MIRT715853 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT716111 GMPS guanine monophosphate synthase 2 2
MIRT716486 SAMD7 sterile alpha motif domain containing 7 2 2
MIRT717245 HLA-DRB5 major histocompatibility complex, class II, DR beta 5 2 2
MIRT718155 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT720260 FAM83F family with sequence similarity 83 member F 2 2
MIRT720584 FAM9C family with sequence similarity 9 member C 2 2
MIRT720912 PILRB paired immunoglobin-like type 2 receptor beta 2 2
MIRT721989 FAM214B family with sequence similarity 214 member B 2 2
MIRT722365 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT722912 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT724442 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT724490 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT724632 NR1H2 nuclear receptor subfamily 1 group H member 2 2 2
MIRT725504 GANAB glucosidase II alpha subunit 2 2
MIRT725525 FAM229B family with sequence similarity 229 member B 2 2
MIRT732668 ROCK1 Rho associated coiled-coil containing protein kinase 1 3 0
MIRT737244 CRNDE colorectal neoplasia differentially expressed 3 0
MIRT737313 TLK1 tousled like kinase 1 4 0
MIRT737314 CBX4 chromobox 4 4 0
MIRT755884 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 3 1
MIRT756000 TWSG1 twisted gastrulation BMP signaling modulator 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-136 Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 up-regulated
miR-136 Valproate approved 3121 Microarray rat hippocampus 18704095 2009 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-136-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-136-5p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 resistant
hsa-miR-136-5p (1Z)-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-(2-methylanilino)-2-oxoethanimidoyl cyanide 5466280 NSC683608 resistant
hsa-miR-136-5p (2,4-dinitrophenyl)methyl carbamimidothioate;chloride 24183838 NSC30637 resistant
hsa-miR-136-5p (2e)-2-[(4-chloroanilino)methylidene]-3-methyl-1-oxopyrido[1,2-a]benzimidazole-4-carbonitrile 5456998 NSC712423 sensitive
hsa-miR-136-5p (2E)-2-[(4-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988775 NSC639512 resistant
hsa-miR-136-5p (2E)-2-benzylidene-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468410 NSC669732 resistant
hsa-miR-136-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-136-5p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 resistant
hsa-miR-136-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-136-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-136-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-136-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-136-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-136-5p (3s,8r,9s,10r,13s,14s,16e,17s)-10,13-dimethyl-16-(pyridin-3-ylmethylidene)-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthrene-3,17-diol 5472448 NSC718809 sensitive
hsa-miR-136-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-136-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-136-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-136-5p (4e)-2-(2-hydroxybenzoyl)-5-methyl-4-[(3-nitrophenyl)methylene]pyrazol-3-one NSC652176 sensitive
hsa-miR-136-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-136-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-136-5p (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-136-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-136-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-136-5p (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-136-5p (5s,8ar)-5-[2-(dimethylamino)ethylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374337 NSC651861 sensitive
hsa-miR-136-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 374326 NSC651850 sensitive
hsa-miR-136-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374327 NSC651851 sensitive
hsa-miR-136-5p (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-136-5p (5s,8r,8ar)-5-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[5,6-f][1,3]benzodioxol-8-ol 378226 NSC660029 sensitive
hsa-miR-136-5p (6aS)-3-[5-[[(6aS)-8-fluoro-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]pentoxy]-8-fluoro-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 24203387 NSC727729 sensitive
hsa-miR-136-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-136-5p (9S)-9-acetyl-7-(3-fluoro-4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-8,10-dihydro-7H-tetracene-5,12-dione 6712215 NSC659948 sensitive
hsa-miR-136-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 resistant
hsa-miR-136-5p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 sensitive
hsa-miR-136-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-136-5p (E)-3-(3,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 53362837 NSC750054 resistant
hsa-miR-136-5p (E)-4-methyl-1-[(E)-4-methyl-3-oxopent-1-enyl]sulfanylpent-1-en-3-one 5473097 NSC723655 resistant
hsa-miR-136-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-136-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-136-5p (Z)-1-(4-bromophenyl)-2-(morpholin-4-ylmethyl)-3-phenylprop-2-en-1-one;hydrobromide 24193247 NSC150311 resistant
hsa-miR-136-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-136-5p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 resistant
hsa-miR-136-5p [(3S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-4,5-dioxo-3-(1-phenylprop-2-enyl)oxolan-3-yl] acetate 386050 NSC677617 resistant
hsa-miR-136-5p [(3S,8R,9S,10R,13S,14S,16Z,17E)-16-benzylidene-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 9572078 NSC701570 resistant
hsa-miR-136-5p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 resistant
hsa-miR-136-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-136-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-136-5p [(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl] 1H-indole-2-carboxylate 396302 NSC702015 resistant
hsa-miR-136-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-136-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-136-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-136-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-(4-cyanophenyl)carbamate 5466030 NSC672058 resistant
hsa-miR-136-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-136-5p [(E)-1-chloropropylideneamino] N-(4-methoxyphenyl)carbamate 5466263 NSC682833 resistant
hsa-miR-136-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(3,4-dichlorophenyl)carbamate 9556246 NSC682823 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-136-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(5-chloro-2-methoxyphenyl)carbamate 9556260 NSC682838 resistant
hsa-miR-136-5p [(z)-[4-(2,4-dichloroanilino)-2-oxo-1-naphthylidene]amino]thiourea 3000994 NSC657676 sensitive
hsa-miR-136-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-136-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-136-5p [2-(4-methoxyphenyl)quinolin-4-yl]-piperidin-2-ylmethanol;dihydrochloride 91885392 NSC23925 resistant
hsa-miR-136-5p [3-[5-[3,5-dihydroxy-4-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-3-hydroxy-6-methyl-4-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl] (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[4,5-dihydroxy-6-(hydroxymethyl)-3-[3,4,5-trihydroxy-6-(hydr 385523 NSC676775 resistant
hsa-miR-136-5p [3,4-dihydroxy-5-[4-(octadecylamino)-2-oxopyrimidin-1-yl]oxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 392613 NSC693169 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-6-(4-methoxyphenyl)-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383442 NSC671809 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-6-phenyl-2-sulfanyl-4H-pyridin-1-yl]oxan-2-yl]methyl acetate 381302 NSC667739 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-136-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-4-phenyl-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383439 NSC671806 sensitive
hsa-miR-136-5p [4-[[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]methyl]phenyl]-phenylmethanone;(Z)-but-2-enedioic acid 5351430 NSC676963 resistant
hsa-miR-136-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-136-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-136-5p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 resistant
hsa-miR-136-5p 1-((2-(4-chlorophenyl)-4-methylene-5-oxotetrahydro-2-furanyl)methyl)-2,4(1h,3h)-pyrimidinedione 381498 NSC668254 resistant
hsa-miR-136-5p 1-(2-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465914 NSC668323 resistant
hsa-miR-136-5p 1-(2-hydroxybenzoyl)-3-methyl-4-(4-methoxybenzylidene)-1h-pyrazole-5(4h)-one 5351408 NSC652174 sensitive
hsa-miR-136-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-136-5p 1-(3-diethylarsino-3-thio-2-methyl-1-oxopropyl)-l-proline 24203225 NSC727224 resistant
hsa-miR-136-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-136-5p 1-[(2r,4s,10r,12s)-3,11-dioxahexacyclo[7.7.2.02,4.05,18.010,12.013,17]octadeca-1(16),5,7,9(18),13(17),14-hexaen-6-yl]ethanone 397369 NSC705022 resistant
hsa-miR-136-5p 1-[(E)-1-[4-[methyl(phenyl)sulfamoyl]phenyl]ethylideneamino]-3-propylthiourea 5466445 NSC691415 sensitive
hsa-miR-136-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-136-5p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 sensitive
hsa-miR-136-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methoxyphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155810023 NSC762555 sensitive
hsa-miR-136-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-136-5p 1-[4-(4-nitrophenyl)-1,3-dithiol-2-ylidene]piperidin-1-ium 431958 NSC301189 sensitive
hsa-miR-136-5p 1-adamantyl(3-(4-hydroxyphenyl)-2-oxiranyl)methanone 386287 NSC678044 resistant
hsa-miR-136-5p 1-azido-2-formyl-benzo[ij]quinolizin-3-one 381901 NSC669158 resistant
hsa-miR-136-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-136-5p 10,11-dibromo-5h-dibenzo(a,d)cyclohepten-5-one 339483 NSC366220 resistant
hsa-miR-136-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-136-5p 15-[(11-oxo-3,10-diazapentacyclo[10.7.1.02,10.04,9.016,20]icosa-1(19),2,4,6,8,12(20),13,15,17-nonaen-15-yl)sulfonyl]-3,10-diazapentacyclo[10.7.1.02,10.04,9.016,20]icosa-1(19),2,4,6,8,12(20),13,15,17-n 341016 NSC372364 sensitive
hsa-miR-136-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-136-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-136-5p 18,20-dioxa-3,11,24-triazahexacyclo[12.10.0.02,11.04,9.015,23.017,21]tetracosa-1(14),2,4,6,8,15,17(21),22-octaen-10-one 378229 NSC660032 sensitive
hsa-miR-136-5p 1h-pyrazole-1-ethanol, 4,4'-azoxybis(3,5-dimethyl- 301772 NSC179945 resistant
hsa-miR-136-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-136-5p 2-((1,4-dimethoxy-9-acridinyl)thio)-n,n-diethylethanamine 362326 NSC625985 resistant
hsa-miR-136-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-136-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-136-5p 2-(2-chloro-4,5-dimethoxyphenyl)-1-(1h-indol-3-yl)ethanone 266625 NSC105348 sensitive
hsa-miR-136-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-136-5p 2-(5-bromo-6-formyl-3-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2h)-yl)ethyl nitrate 383812 NSC672424 resistant
hsa-miR-136-5p 2-(7-amino-[1,2]thiazolo[4,5-d]pyrimidin-3-yl)-5-(hydroxymethyl)oxolane-3,4-diol 385012 NSC675865 resistant
hsa-miR-136-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-136-5p 2-(hydroxymethyl)-5-[6-[(2Z)-2-(pyridin-2-ylmethylidene)hydrazinyl]purin-9-yl]oxolane-3,4-diol 60147746 NSC752331 resistant
hsa-miR-136-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-136-5p 2-[(4-fluorophenyl)diazenyl]-1-oxo-3-phenyl-5h-pyrido[1,2-a]benzimidazole-4-carbonitrile 395420 NSC699956 resistant
hsa-miR-136-5p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 resistant
hsa-miR-136-5p 2-[(dimethylamino)methyl]-4-(phenylazo)phenol 384361 NSC674071 resistant
hsa-miR-136-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-136-5p 2-[2-[4-(3-chloro-1,4-dihydroxy-5,8-dioxonaphthalen-2-yl)piperazin-1-yl]ethoxy]ethyl acetate 378769 NSC661939 resistant
hsa-miR-136-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-136-5p 2-[4-(acridin-9-ylmethylamino)phenyl]sulfonylguanidine 335981 NSC348894 sensitive
hsa-miR-136-5p 2-acetamido-N-(4-chloro-3-oxo-1-phenylbutan-2-yl)-4-methylpentanamide 299926 NSC173905 resistant
hsa-miR-136-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-136-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-136-5p 2-bromo-6-(5-(4-methoxyphenyl)-3-isoxazolyl)-4-methylphenol 355054 NSC607993 sensitive
hsa-miR-136-5p 2-chloro-3-(1-(4-methyl)piperazino)naphthazarin 378627 NSC661420 resistant
hsa-miR-136-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-136-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-136-5p 2-imidazolidinethione, 1,3-bis(pentafluorobenzoyl)- 383506 NSC671891 resistant
hsa-miR-136-5p 2-methoxy-5,7,8,13,13a,14-hexahydroisoquino[3,2-b][3]benzazepine 392606 NSC693146 resistant
hsa-miR-136-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-136-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-136-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-136-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-136-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-136-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-136-5p 2,3-bis(4,5-dimethyl-3,6-dioxo-cyclohexa-1,4-dien-1-yl)-5,6-dimethyl-1,4-benzoquinone 394545 NSC698090 resistant
hsa-miR-136-5p 2,3,4a,8,12b-pentahydroxy-3-methyl-2,4-dihydrobenzo[a]anthracene-1,7,12-trione 43854 NSC368697 resistant
hsa-miR-136-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-136-5p 2,4,6-trichloro-n-(pyridin-3-ylmethyl)-n-[pyridin-3-ylmethyl-(2,4,6-trichlorobenzoyl)carbamothioyl]benzamide 401373 NSC714685 resistant
hsa-miR-136-5p 2,5-bis[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368963 NSC131233 resistant
hsa-miR-136-5p 2,5-dibenzyl-2-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 368538 NSC639617 resistant
hsa-miR-136-5p 2,5-dichloro-3,6-bis-propionylamino-[1,4]benzoquinone 323616 NSC285233 resistant
hsa-miR-136-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-136-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-136-5p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 resistant
hsa-miR-136-5p 2,8-bis(3,4,5-trimethoxyphenyl)pyrano[3,2-g]chromene-4,6-dione 386069 NSC677640 sensitive
hsa-miR-136-5p 2,9-bis(bromomethyl)-1,10-phenanthroline 353741 NSC602850 resistant
hsa-miR-136-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-136-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-136-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-136-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-136-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-136-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-136-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-136-5p 3-[3,5-bis(trifluoromethyl)phenyl]-6-(4-fluorophenyl)-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazole 155809975 NSC756619 sensitive
hsa-miR-136-5p 3-bromo-2,4,6-trinitrotoluene 219376 NSC596 resistant
hsa-miR-136-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-136-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-136-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-136-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-136-5p 3-methyl-1-[5-(3-methyl-2,5-dioxopyrrol-1-yl)naphthalen-1-yl]pyrrole-2,5-dione 250323 NSC69577 resistant
hsa-miR-136-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-136-5p 3-N',5-N'-bis(2-hydroxybenzoyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarbohydrazide 377030 NSC658247 sensitive
hsa-miR-136-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-136-5p 3-piperidino-2-phenylpropiophenone 89341 NSC33568 resistant
hsa-miR-136-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-136-5p 3,4-dichlorocoumarin 282447 NSC135925 resistant
hsa-miR-136-5p 3,5,12,14-tetraethyl-7,8,9,10-tetrathia-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-dithione 365480 NSC633113 resistant
hsa-miR-136-5p 3h-xanthen-3-one, 2,6,7-trihydroxy-9-(o-hydroxy-phenyl)- 72722 NSC9037 sensitive
hsa-miR-136-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-136-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-136-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-136-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-136-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-136-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-136-5p 4-[(6-iodo-2-thiophen-2-ylquinazolin-4-yl)amino]-N-(1,3-thiazol-2-yl)benzenesulfonamide 404801 NSC721319 resistant
hsa-miR-136-5p 4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-3-phenyl-1h-1,2,4-triazol-5-one 9556349 NSC698058 resistant
hsa-miR-136-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-136-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-136-5p 4-[[4-[benzenesulfonyl(2-cyanoethyl)amino]-2-methylphenyl]methylideneamino]benzoic acid 369351 NSC641106 resistant
hsa-miR-136-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-136-5p 4-[4-(4-chlorophenyl)piperazin-1-yl]-6-(4-methoxyphenyl)-2-oxo-2h-pyran-3-carbonitrile 360621 NSC622926 sensitive
hsa-miR-136-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-136-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-136-5p 4-amino-6-(4-chlorophenyl)-14-nitro-3-oxatricyclo[9.4.0.02,7]pentadeca-1(11),2(7),4,12,14-pentaene-5-carbonitrile 401106 NSC714000 resistant
hsa-miR-136-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-136-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-136-5p 4-nitro-9h-thioxanthen-9-one 10,10-dioxide 378894 NSC662302 resistant
hsa-miR-136-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-136-5p 4-piperidinone, 1-methyl-2,6-bis[(2-nitrophenyl)methylene]- 5468197 NSC673650 resistant
hsa-miR-136-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-136-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-136-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-136-5p 5-(2-methylsulfonylpyrimidin-4-yl)-6-(3-phenylmethoxyphenyl)imidazo[2,1-b][1,3]thiazole 155804973 NSC763231 resistant
hsa-miR-136-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-136-5p 5-[(5s,8ar)-5-(4-fluoroanilino)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-3-methoxycyclohexa-3,5-diene-1,2-dione 369957 NSC642324 sensitive
hsa-miR-136-5p 5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(4-methoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374707 NSC759016 resistant
hsa-miR-136-5p 5-acetyl-1,3-diphenyl-6-(2-pyrrolidin-1-ylethylsulfanyl)-2-thioxo-pyrimidin-4-one NSC703439 resistant
hsa-miR-136-5p 5-acetyl-6-(2-diethylaminoethylsulfanyl)-1,3-diphenyl-2-thioxo-pyrimidin-4-one NSC707006 resistant
hsa-miR-136-5p 5-amino-6-(7-amino-6-methoxy-5,8-dioxo-1,2,3,4-tetrahydroquinolin-2-yl)-4-(2-hydroxy-3,4-dimethoxyphenyl)-3-methylpyridine-2-carboxylic acid 253712 NSC76919 sensitive
hsa-miR-136-5p 5-fluoro-4-methoxy-1-(5-oxo-2H-furan-2-yl)pyrimidin-2-one 330094 NSC315844 resistant
hsa-miR-136-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-136-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-136-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-136-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-136-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-136-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]pyrazine-2,3-dicarbonitrile 395616 NSC700361 resistant
hsa-miR-136-5p 5,6-bis[(5-methyl-1,3,4-thiadiazol-2-yl)sulfanylmethyl]pyrazine-2,3-dicarbonitrile NSC708393 resistant
hsa-miR-136-5p 5,6-dimethoxy-n-(2-piperidin-2-ylethyl)quinolin-8-amine;hydroiodide 24182013 NSC13275 resistant
hsa-miR-136-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-136-5p 5,8-quinolinedione, 2-methyl- 388305 NSC682995 resistant
hsa-miR-136-5p 5h-naphtho[2,3-c][1]benzazepine-6,13-dione 386348 NSC678131 sensitive
hsa-miR-136-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-136-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-136-5p 6-(4-methoxyphenyl)-2-oxo-4-(4-phenylpiperazin-1-yl)-2h-pyran-3-carbonitrile 360619 NSC622924 sensitive
hsa-miR-136-5p 6-(5-nitropyridin-2-yl)sulfanyl-7h-purin-2-amine 3977545 NSC704077 resistant
hsa-miR-136-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-136-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-136-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-136-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-136-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-136-5p 6-bromochroman-2-one 266737 NSC105509 sensitive
hsa-miR-136-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-136-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-136-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-136-5p 6-N,6-N,8-N,8-N-tetraethylthieno[3,4-f]pentathiepine-6,8-diamine 406615 NSC724855 resistant
hsa-miR-136-5p 6,13-bis[3-[(2-chlorophenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone;4-methylbenzenesulfonic acid;hydrate 60147715 NSC752270 resistant
hsa-miR-136-5p 6,7-dimethyl-3-[4-(4-nitrophenyl)piperazin-1-yl]-1,4-dioxido-quinoxaline-1,4-diium-2-carbonitrile 394345 NSC697715 sensitive
hsa-miR-136-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-136-5p 7-[5-(diethylamino)pentoxy]-5-hydroxy-2-phenylchromen-4-one 24205488 NSC736041 resistant
hsa-miR-136-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-136-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-136-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-136-5p 8-azadenosine 251928 NSC72961 resistant
hsa-miR-136-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-136-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-136-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-136-5p 9-(2-chloroethylsulfinyl)-2,7-dimethoxy-acridine 395390 NSC699926 resistant
hsa-miR-136-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-136-5p 9-(oxan-2-yl)-1,3-diphenyl-2-sulfanylidenepurin-6-one 387937 NSC682242 sensitive
hsa-miR-136-5p 9-amino-5-methyl-N-[2-[4-[(4-nitrophenyl)methyl]morpholin-4-ium-4-yl]ethyl]acridine-4-carboxamide;chloride;hydrochloride 393528 NSC695586 sensitive
hsa-miR-136-5p 9-amino-7-(3,4,5-trimethoxyphenyl)-6h-benzo[c]chromene-8,10-dicarbonitrile 399086 NSC709502 sensitive
hsa-miR-136-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-136-5p 9-chloro-2-methylellipticinium acetate, hydrate 10383530 NSC632855 sensitive
hsa-miR-136-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-136-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium iodide 373612 NSC650262 sensitive
hsa-miR-136-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-136-5p 9-methoxy-2-methylellipticinium iodide 3086380 NSC155693 sensitive
hsa-miR-136-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-136-5p Active compound from cephalodiscus gilchristi 5458859 NSC363979 sensitive
hsa-miR-136-5p Ak136303 388306 NSC682996 resistant
hsa-miR-136-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-136-5p Ambrosin 257272 NSC85235 resistant
hsa-miR-136-5p Annamycin liposomal NSC700363 sensitive
hsa-miR-136-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-136-5p Antineoplastic-d648114 372647 NSC648114 sensitive
hsa-miR-136-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-136-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-136-5p Benzamido 2-methyl-5-phenyl-4-(p-tolyl)-1h-pyrrole-3-carboxylate 398159 NSC707691 sensitive
hsa-miR-136-5p Benzoyloxy-[[6-(benzoyloxymercuriomethyl)-1,4-dioxan-2-yl]methyl]mercury 16683646 NSC30915 resistant
hsa-miR-136-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-136-5p Biantrazole 54607781 NSC357885 sensitive
hsa-miR-136-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-136-5p C11h7clo5 135409146 NSC659996 resistant
hsa-miR-136-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-136-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-136-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-136-5p Carquniostatin b 380452 NSC666034 resistant
hsa-miR-136-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-136-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-136-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-136-5p Ci-921: amsacrine derivative 157348 NSC343499 sensitive
hsa-miR-136-5p Cisplatin 5460033 NSC119875 approved sensitive
hsa-miR-136-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-136-5p Deoxyartemisitene 6712468 NSC690035 resistant
hsa-miR-136-5p Destruxin b NSC236580 resistant
hsa-miR-136-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-136-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-136-5p Dienone b 100324 NSC289074 resistant
hsa-miR-136-5p Diethyl (E)-2-[5-chloro-3-(2-ethoxy-2-oxoethyl)-2,4-dioxopyrimidin-1-yl]but-2-enedioate 5470768 NSC704888 resistant
hsa-miR-136-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-136-5p Diethyl 2-[[2-[4-[(3-phenylquinoxalin-2-yl)amino]phenyl]acetyl]amino]pentanedioate 401477 NSC715135 sensitive
hsa-miR-136-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 sensitive
hsa-miR-136-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-136-5p Dimethyl 1-[(z)-2-[(z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1,2-bis(4-methoxyphenyl)ethenyl]pyrazole-3,4-dicarboxylate 5471659 NSC712735 resistant
hsa-miR-136-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-136-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-136-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-136-5p Eremantholide b 5478094 NSC380721 resistant
hsa-miR-136-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-136-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-136-5p Ethyl 3-(4-fluoroanilino)quinoxaline-2-carboxylate 387137 NSC680553 sensitive
hsa-miR-136-5p Ethyl 3-[4-[bis(2-chloroethyl)amino]phenyl]-2-[4-(7-chloro-2-oxo-5-phenyl-3h-1,4-benzodiazepin-1-yl)butanoylamino]propanoate 388729 NSC683782 resistant
hsa-miR-136-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-136-5p Ethyl 7-(1,3-benzodioxol-5-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399950 NSC711102 sensitive
hsa-miR-136-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-136-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-miR-136-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-136-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-136-5p Fixierer p 70397 NSC63839 resistant
hsa-miR-136-5p Geldanamycin analog 5358467 NSC255104 resistant
hsa-miR-136-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-136-5p Gtpl10345 378629 NSC661421 resistant
hsa-miR-136-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-136-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-136-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-136-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-136-5p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-136-5p Imidazole, 1-(4-chlorophenyl)-4-(4-nitrophenyl)- 355940 NSC610744 sensitive
hsa-miR-136-5p Inosine dialdehyde 135400916 NSC118994 resistant
hsa-miR-136-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-136-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-136-5p Isoquinoline, 1-(5-phenyl-4-p-tolyl-2-oxazolyl)- 272358 NSC116702 resistant
hsa-miR-136-5p Jatrophon 5281373 NSC135037 resistant
hsa-miR-136-5p Jolkinolide b 161954 NSC700087 resistant
hsa-miR-136-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-136-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-136-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-136-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-136-5p Ls-150387 365515 NSC633203 sensitive
hsa-miR-136-5p Ls-154710 380361 NSC665883 resistant
hsa-miR-136-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-136-5p Mcs-688 371061 NSC644960 sensitive
hsa-miR-136-5p Mcs-694 371067 NSC644966 sensitive
hsa-miR-136-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-136-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-136-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-(thiophen-2-ylmethylideneamino)but-2-enoate 5470184 NSC698280 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-136-5p Methyl (Z)-4,4-dicyano-4-[(3-methylthiophen-2-yl)methylideneamino]but-2-enoate 5470185 NSC698281 resistant
hsa-miR-136-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-136-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-136-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-136-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-136-5p Mitoxantrone 4212 NSC279836 approved sensitive
hsa-miR-136-5p Musennin 267361 NSC106554 sensitive
hsa-miR-136-5p Mycoin 4696 NSC32951 resistant
hsa-miR-136-5p Mycoin 4696 NSC32951 resistant
hsa-miR-136-5p N'-(cyano(3-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375018 NSC653844 sensitive
hsa-miR-136-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-136-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-136-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-136-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-136-5p N-(2-phenylethyl)-4-[[[3-(2-phenylthiazole-4-yl)acryloyl]amino]methyl]benzamide 5470485 NSC702131 sensitive
hsa-miR-136-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-136-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-136-5p N-[(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]-3-cyanobenzamide 369926 NSC642293 sensitive
hsa-miR-136-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-136-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-136-5p N-[(Z)-(3-nitrophenyl)methylideneamino]-2-[2-[(2Z)-2-[(3-nitrophenyl)methylidene]hydrazinyl]-2-oxoethyl]sulfanylacetamide 9572668 NSC724063 sensitive
hsa-miR-136-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-136-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-136-5p N-[2-(1h-indole-3-yl)ethyl]-4-[[[3-[4-(benzyloxy)phenyl]acryloyl]amino]methyl]benzamide 5470479 NSC702125 sensitive
hsa-miR-136-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-136-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-136-5p N-1-adamantyl-2-(5-nitro-1h-indol-3-yl)-2-oxoacetamide 374150 NSC651607 sensitive
hsa-miR-136-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-136-5p N-methyl-2,4-dinitro-N-[(E)-quinolin-8-ylmethylideneamino]aniline 9555808 NSC630684 sensitive
hsa-miR-136-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-136-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-136-5p Ncichal_000043 393018 NSC694266 sensitive
hsa-miR-136-5p Ncimech_000601 264119 NSC99027 resistant
hsa-miR-136-5p Nobiletin 72344 NSC76751 resistant
hsa-miR-136-5p NSC337857 NSC337857 resistant
hsa-miR-136-5p NSC372474 NSC372474 resistant
hsa-miR-136-5p NSC618857 NSC618857 sensitive
hsa-miR-136-5p NSC671902 NSC671902 resistant
hsa-miR-136-5p NSC751830 NSC751830 resistant
hsa-miR-136-5p Ovatifolin acetate 5358419 NSC251668 resistant
hsa-miR-136-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-136-5p P-bromophenacyl benzoate 345792 NSC403572 resistant
hsa-miR-136-5p P-fuchsin 11292 NSC10460 sensitive
hsa-miR-136-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-136-5p Paucin 282787 NSC136722 resistant
hsa-miR-136-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-136-5p Pepleo 122804 NSC276382 sensitive
hsa-miR-136-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-136-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-136-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-136-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-136-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-136-5p Proflavine hcl 197873 NSC605756 resistant
hsa-miR-136-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-136-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-136-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-136-5p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 resistant
hsa-miR-136-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-136-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-136-5p Sangivamycin 5153 NSC65346 resistant
hsa-miR-136-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-136-5p Selendale 54601159 NSC347466 sensitive
hsa-miR-136-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-136-5p Stereoisomer of 672120 (mw=262) 5459262 NSC687011 resistant
hsa-miR-136-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-136-5p Stk134301 135400303 NSC715186 resistant