miRTarBase - #MIRT440651


—
pre-miRNA Information
pre-miRNA hsa-mir-127   
Genomic Coordinates chr14: 100882979 - 100883075
Description Homo sapiens miR-127 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-127-5p
Sequence 23| CUGAAGCUCAGAGGGCUCUGAU |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM9722115 13 COSMIC
COSM7115045 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs867796380 11 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FBXO7   
Synonyms FBX, FBX07, FBX7, PARK15, PKPS
Description F-box protein 7
Transcript NM_001033024   
Other Transcripts NM_012179   
Expression
Putative miRNA Targets on FBXO7
3'UTR of FBXO7
(miRNA target sites are highlighted)		 
>FBXO7|NM_001033024|3'UTR
   1 TTGATTTGTAATTTCATTTCTGGAGCTCCATTTGTTTTTGTTTCTAAACTACAGATGTCAACTCCTTGGGGTGCTGATCT
  81 CGAGTGTTATTTTCTGATTGTGGTGTTGAGAGTTGCACTCCCAGAAACCTTTTAAGAGATACATTTATAGCCCTAGGGGT
 161 GGTATGACCCAAAGGTTCCTCTGTGACAAGGTTGGCCTTGGGAATAGTTGGCTGCCAATCTCCCTGCTCTTGGTTCTCCT
 241 CTAGATTGAAGTTTGTTTTCTGATGCTGTTCTTACCAGATTAAAAAAAAGTGTAAATTACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uagucucgGGAGA-CUCGAAGUc 5'
                  ::||| ||||| || 
Target 5' taatttcaTTTCTGGAGCTCCAt 3'
 9 - 31 122.00 -9.30
2 
miRNA  3' uaGUCUCGGGAGA---CUCGAAGUc 5'
            ||||  |||:|   ||| | || 
Target 5' ccCAGAAACCTTTTAAGAGATACAt 3'
 120 - 144 104.00 -10.51
3 
miRNA  3' uagucUCGGGAGACUCGAAGUc 5'
               :|: :|  |||:| || 
Target 5' attgtGGTGTTGAGAGTTGCAc 3'
 97 - 118 101.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
341320 48 ClinVar
901101 83 ClinVar
901102 105 ClinVar
341321 171 ClinVar
901103 199 ClinVar
341322 264 ClinVar
341323 283 ClinVar
COSN30496813 25 COSMIC
COSN21250062 55 COSMIC
COSN5991209 268 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751984568 2 dbSNP
rs1219471946 4 dbSNP
rs759489473 5 dbSNP
rs764041917 7 dbSNP
rs1190046869 18 dbSNP
rs751832193 21 dbSNP
rs1261530011 28 dbSNP
rs757531730 31 dbSNP
rs781171099 33 dbSNP
rs1418157528 36 dbSNP
rs906619695 38 dbSNP
rs1406670990 45 dbSNP
rs375964315 46 dbSNP
rs367714958 48 dbSNP
rs1033867049 56 dbSNP
rs946039324 59 dbSNP
rs1284436553 62 dbSNP
rs953019206 64 dbSNP
rs1293745344 72 dbSNP
rs1005781283 82 dbSNP
rs147661976 83 dbSNP
rs1231308728 85 dbSNP
rs904545464 100 dbSNP
rs1297673169 101 dbSNP
rs773959542 104 dbSNP
rs1000685195 107 dbSNP
rs14698 117 dbSNP
rs1307517963 120 dbSNP
rs961023530 122 dbSNP
rs1319177296 137 dbSNP
rs1018347290 143 dbSNP
rs1415452735 151 dbSNP
rs1166816924 152 dbSNP
rs899975411 153 dbSNP
rs1475526532 161 dbSNP
rs1206057964 168 dbSNP
rs186797068 171 dbSNP
rs1476085914 173 dbSNP
rs1242360485 176 dbSNP
rs1029844005 184 dbSNP
rs951733600 199 dbSNP
rs983085594 203 dbSNP
rs1258571442 218 dbSNP
rs953815615 219 dbSNP
rs1336118834 228 dbSNP
rs373540073 230 dbSNP
rs1295449663 241 dbSNP
rs191188063 242 dbSNP
rs12810 245 dbSNP
rs527607556 247 dbSNP
rs1270817982 261 dbSNP
rs886057422 264 dbSNP
rs980923234 268 dbSNP
rs1186362488 282 dbSNP
rs886057423 283 dbSNP
rs935856379 288 dbSNP
rs1399497048 289 dbSNP
rs1053034742 293 dbSNP
rs1430215893 295 dbSNP
rs913160322 296 dbSNP
rs1190110230 297 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions islets
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO. ...

- Kameswaran V; Bramswig NC; McKenna LB; Penn et al., 2014, Cell metabolism.

Article - Kameswaran V; Bramswig NC; McKenna LB; Penn et al.
- Cell metabolism, 2014
Type 2 diabetes mellitus (T2DM) is a complex disease characterized by the inability of the insulin-producing beta cells in the endocrine pancreas to overcome insulin resistance in peripheral tissues. To determine if microRNAs are involved in the pathogenesis of human T2DM, we sequenced the small RNAs of human islets from diabetic and nondiabetic organ donors. We identified a cluster of microRNAs in an imprinted locus on human chromosome 14q32 that is highly and specifically expressed in human beta cells and dramatically downregulated in islets from T2DM organ donors. The downregulation of this locus strongly correlates with hypermethylation of its promoter. Using HITS-CLIP for the essential RISC-component Argonaute, we identified disease-relevant targets of the chromosome 14q32 microRNAs, such as IAPP and TP53INP1, that cause increased beta cell apoptosis upon overexpression in human islets. Our results support a role for microRNAs and their epigenetic control by DNA methylation in the pathogenesis of T2DM.
LinkOut: [PMID: 24374217]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.607 1.1e-3 0.692 1.3e-4 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.516 4.1e-3 -0.526 3.5e-3 25 Click to see details
GSE32688 Pancreatic cancer -0.412 9.6e-3 -0.416 8.9e-3 32 Click to see details
GSE21687 Ependynoma primary tumors 0.147 1.2e-1 0.031 4.0e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.35 1.3e-1 -0.070 4.1e-1 12 Click to see details
GSE28544 Breast cancer 0.223 1.5e-1 0.192 1.8e-1 24 Click to see details
GSE17498 Multiple myeloma -0.153 1.7e-1 -0.256 5.5e-2 40 Click to see details
GSE19536 Breast cancer 0.072 2.4e-1 0.058 2.8e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells -0.098 3.2e-1 -0.040 4.3e-1 24 Click to see details
GSE38226 Liver fibrosis -0.036 4.4e-1 -0.021 4.6e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.016 4.4e-1 -0.046 3.4e-1 79 Click to see details
GSE28260 Renal cortex and medulla 0.043 4.4e-1 0.016 4.8e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.019 4.7e-1 0.033 4.5e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.008 4.9e-1 -0.403 3.9e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.008 4.9e-1 -0.403 3.9e-2 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.94 0.03 -0.800 0.1 4 Click to see details
ESCA 0.542 0.04 0.427 0.1 11 Click to see details
KICH -0.338 0.05 -0.307 0.07 25 Click to see details
THCA -0.163 0.11 -0.127 0.17 59 Click to see details
UCEC 0.271 0.13 0.209 0.2 19 Click to see details
CESC -0.836 0.18 -1.000 0.5 3 Click to see details
PCPG -0.807 0.2 -0.500 0.33 3 Click to see details
KIRC -0.088 0.24 -0.094 0.22 68 Click to see details
LIHC 0.103 0.24 0.059 0.34 49 Click to see details
BLCA 0.16 0.26 0.197 0.22 18 Click to see details
STAD -0.109 0.28 -0.238 0.09 32 Click to see details
HNSC -0.09 0.29 -0.160 0.16 42 Click to see details
KIRP -0.088 0.32 -0.008 0.48 32 Click to see details
LUAD 0.11 0.37 -0.084 0.4 12 Click to see details
BRCA 0.035 0.38 -0.018 0.44 84 Click to see details
PRAD -0.033 0.41 0.017 0.45 50 Click to see details
CHOL -0.07 0.43 -0.233 0.27 9 Click to see details
LUSC -0.029 0.43 -0.067 0.34 38 Click to see details
COAD -0.062 0.44 -0.071 0.43 8 Click to see details
COAD -0.062 0.44 -0.071 0.43 8 Click to see details
COAD -0.062 0.44 -0.071 0.43 8 Click to see details
113 hsa-miR-127-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT380928 ZNF264 zinc finger protein 264 2 2
MIRT439324 USP34 ubiquitin specific peptidase 34 1 1
MIRT439333 USP22 ubiquitin specific peptidase 22 1 1
MIRT439379 TTC37 tetratricopeptide repeat domain 37 1 1
MIRT439445 TMEM116 transmembrane protein 116 1 1
MIRT439498 SYNJ2 synaptojanin 2 1 1
MIRT439525 STBD1 starch binding domain 1 1 1
MIRT439562 SORL1 sortilin related receptor 1 1 1
MIRT439660 SF3B1 splicing factor 3b subunit 1 1 1
MIRT439749 ROGDI rogdi homolog 1 1
MIRT439836 RAB3B RAB3B, member RAS oncogene family 1 1
MIRT439923 PPL periplakin 1 1
MIRT439963 PKD1 polycystin 1, transient receptor potential channel interacting 1 1
MIRT439985 PHKG2 phosphorylase kinase catalytic subunit gamma 2 1 1
MIRT440029 PCLO piccolo presynaptic cytomatrix protein 1 1
MIRT440179 MTRNR2L8 MT-RNR2-like 8 1 1
MIRT440183 MTRNR2L4 MT-RNR2-like 4 1 1
MIRT440184 MTRNR2L6 MT-RNR2-like 6 1 1
MIRT440194 MTRNR2L1 MT-RNR2-like 1 1 1
MIRT440269 MBP myelin basic protein 1 1
MIRT440323 LIN7C lin-7 homolog C, crumbs cell polarity complex component 1 1
MIRT440331 LGALS8 galectin 8 1 1
MIRT440355 KLHL29 kelch like family member 29 1 1
MIRT440397 KDM6B lysine demethylase 6B 1 1
MIRT440411 KAT2B lysine acetyltransferase 2B 1 1
MIRT440424 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT440651 FBXO7 F-box protein 7 1 1
MIRT440773 DST dystonin 1 1
MIRT440824 DGKD diacylglycerol kinase delta 1 1
MIRT440914 COPA coatomer protein complex subunit alpha 1 1
MIRT441118 BBS4 Bardet-Biedl syndrome 4 1 1
MIRT441153 ATP2A3 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 1 1
MIRT441193 ARID1A AT-rich interaction domain 1A 1 1
MIRT441260 ADM adrenomedullin 1 1
MIRT441282 ACTB actin beta 1 1
MIRT441306 ABHD2 abhydrolase domain containing 2 1 1
MIRT441860 TEX35 testis expressed 35 2 2
MIRT442190 CCDC132 VPS50, EARP/GARPII complex subunit 2 2
MIRT442886 RHCG Rh family C glycoprotein 2 2
MIRT444158 ZNF701 zinc finger protein 701 2 2
MIRT444506 ZNF525 zinc finger protein 525 2 2
MIRT444770 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 2 2
MIRT445830 SRSF11 serine and arginine rich splicing factor 11 2 2
MIRT445850 LRRC1 leucine rich repeat containing 1 2 2
MIRT445863 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT446161 C8A complement C8 alpha chain 2 2
MIRT447117 SLFN5 schlafen family member 5 2 2
MIRT447990 CDX1 caudal type homeobox 1 2 2
MIRT449032 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449295 SMIM19 small integral membrane protein 19 2 2
MIRT449541 PCDH9 protocadherin 9 2 2
MIRT449579 ZNF510 zinc finger protein 510 2 2
MIRT450062 SYT9 synaptotagmin 9 2 2
MIRT450437 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 2
MIRT450449 ZDHHC2 zinc finger DHHC-type containing 2 2 2
MIRT450695 RORA RAR related orphan receptor A 2 2
MIRT453654 RAB6C RAB6C, member RAS oncogene family 2 2
MIRT463771 YOD1 YOD1 deubiquitinase 2 2
MIRT468425 SETD1B SET domain containing 1B 2 2
MIRT468843 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT475594 HMGB2 high mobility group box 2 4 4
MIRT478284 DDX19A DEAD-box helicase 19A 2 2
MIRT487594 NKD2 naked cuticle homolog 2 2 4
MIRT493440 KANSL1 KAT8 regulatory NSL complex subunit 1 2 6
MIRT496169 RPL35A ribosomal protein L35a 2 4
MIRT497566 CCR6 C-C motif chemokine receptor 6 2 2
MIRT497917 BTG1 BTG anti-proliferation factor 1 2 2
MIRT498331 PRELID2 PRELI domain containing 2 2 2
MIRT498369 KLHL11 kelch like family member 11 2 2
MIRT498856 LITAF lipopolysaccharide induced TNF factor 2 2
MIRT505640 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT506128 PLRG1 pleiotropic regulator 1 2 4
MIRT512242 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT512489 ARID2 AT-rich interaction domain 2 2 2
MIRT525251 RNF213 ring finger protein 213 2 2
MIRT530197 ALX1 ALX homeobox 1 2 4
MIRT530551 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT534048 STC2 stanniocalcin 2 2 2
MIRT537508 FAM105A family with sequence similarity 105 member A 2 2
MIRT543005 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT543814 SNX10 sorting nexin 10 2 2
MIRT549303 ARID5B AT-rich interaction domain 5B 2 2
MIRT549407 ADIPOR2 adiponectin receptor 2 2 4
MIRT550547 ARSK arylsulfatase family member K 2 2
MIRT554319 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT554515 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT559603 AMOT angiomotin 2 2
MIRT564844 ZBED3 zinc finger BED-type containing 3 2 2
MIRT566125 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT567484 FOXK1 forkhead box K1 2 2
MIRT576521 Txlna taxilin alpha 2 2
MIRT633635 CASC5 kinetochore scaffold 1 2 2
MIRT639325 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT643174 MDM2 MDM2 proto-oncogene 2 2
MIRT651214 ZNF225 zinc finger protein 225 2 2
MIRT653039 STRIP2 striatin interacting protein 2 2 2
MIRT653042 STOX2 storkhead box 2 2 2
MIRT658769 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT666728 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT681223 DUSP19 dual specificity phosphatase 19 2 2
MIRT685562 SRD5A3 steroid 5 alpha-reductase 3 2 2
MIRT687434 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT688439 DNAJC3 DnaJ heat shock protein family (Hsp40) member C3 2 2
MIRT692707 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT700552 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT704955 CBX2 chromobox 2 2 2
MIRT714524 ALKBH3 alkB homolog 3, alpha-ketoglutaratedependent dioxygenase 2 2
MIRT716225 DGKI diacylglycerol kinase iota 2 2
MIRT717953 MIA3 MIA family member 3, ER export factor 2 2
MIRT719902 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT732044 BLVRB biliverdin reductase B 3 1
MIRT733622 SNX5 sorting nexin 5 3 0
MIRT737210 CXCR4 C-X-C motif chemokine receptor 4 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-127 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR rat breast 17700064 2007 down-regulated
miR-127 5-aza-2'-deoxycytidine (5-Aza-CdR) + 4-phenylbutyric acid (PBA) NULL NULL Microarray T24 human bladder cancer cells 16766263 2006 up-regulated
miR-127 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-127-5p Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-127 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-127 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-miR-127-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-127-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-127-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-127-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-127-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-127-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-127-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-127-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-127-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-127-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-127-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission