pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol CSNK1E   
Synonyms CKIepsilon, HCKIE
Description casein kinase 1 epsilon
Transcript NM_001894   
Other Transcripts NM_152221   
Expression
Putative miRNA Targets on CSNK1E
3'UTR of CSNK1E
(miRNA target sites are highlighted)
>CSNK1E|NM_001894|3'UTR
   1 GGAGAGCCCCCATTGGACCAGTGTTTGCTTAGTGTCTTCACTGTATTTTCTTTAAAAAAAAAAAAAAAAAAAAAAAGGCA
  81 AAAATAAACCACTCAAAAGAACAACAAAAAAACCCAGCACAAAACCGACGATGGAGTTTGTTTCTTTGATTTCTTTGCCA
 161 ATGGCAAGAAGATGAGATGCCCTCAGCACTGAGGATTCTTGCCCCCTTGTGGTGCCCGCTGCCCCCAACCTTCAGGCTGC
 241 CAGATGCTCCCCTGACAACACCAGGCTACAGGAGCCAGACGCCAGGGCCTGCCCGGCCTCCTGTTCCTGCCCCCACCCAC
 321 CACCTGCCTGGAGAGGAACGGGTCGGGTCCGTGTCGGAGAAGTGACAGGTCCCAGAGCCAAAGCCGGCCCTCAAGCATCA
 401 TCAGGGAGTGGTGTAGTCAGTTGAAGGCAGTTCCCACCGAGTTTTCCGAGCCTCAGAATCCAGGAGATACGCACAGCCCC
 481 ACCCACTCTGAGATGACAGTGGCTGACTTCCCGTGCTGGGCTTTTCCATTGTCCCCCTGGCCTCCAGGCTCCTCCTCTGC
 561 CTCTCCATGGAGTGGGTGGGGAGGTGGTGGGGGCCGGCGTCCCCTGCGTGTGTGTGTGTGTGTGTGTGTGTGGATGTATT
 641 GACCTGTGTTTCCCAAGACAGCAGGTGCCACGGCCCGCCCCGCCTGCCAGCCCGAATTCCCGTTCTCCTGTGTCTACTAA
 721 CAAGGACATGGGGGTGGGCGGTGACCTCCGCATCCCTCAGAGCTCAGAGGGTCCTCGCTGCCACCGGTCCCCCCCTAGCC
 801 CGTCATCAGCCGGTGGCAGCTCCATCTTCCATTCCTGGTTTTAGGGCAGAATCCATGGAGACTGCTTCCAGAAGGCATCT
 881 GGCTCTGAGTTATAAATTACTTCCCTGGTCCTGACAGTCACCTGGGGTCCCCCCTCTCCCTGGTTCCACCTTTCTGAGGA
 961 GGAGCCTGGAGTCAGGGCTGGGTTTTGGATTAACCCATCCTTCCTAGTTAACACCTTTTTGTTTTTATTTTATTTTATTT
1041 TTGTTTGTTTTCTCCGTGTGTGTGTTTTCCTAATTTATTTACCTCTGTTTCCCCTTTTTCCTTTTTTTTTTTAATTAAAG
1121 AGCAAAGCTTTTTATTACTTTGTAATTTAAAAAACTGAAAAAAAAAAAACTGAAGAACTTTGGGGGGAATTTTGTACTTT
1201 TTTCCTGTGTAAATATTGGACTTTTTTGAGCTTTATCGTGGTTGTTAATTTGAAGTAATAAAGTAGAAAAGATAAAGTGA
1281 AAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUCGGCGAC--AG------UGUGCGUGUc 5'
            |||| | |  ||      |:||||||| 
Target 5' cgAGCCTCAGAATCCAGGAGATACGCACAg 3'
447 - 476 152.00 -18.80
2
miRNA  3' aguCGGCGAC-AGUGUGCGUGuc 5'
             |:: |||  | ||| |||  
Target 5' cctGTTCCTGCCCCCACCCACca 3'
300 - 322 103.00 -7.50
3
miRNA  3' agucggcgacagugugCGUGUc 5'
                          ||||| 
Target 5' acaacaaaaaaacccaGCACAa 3'
101 - 122 100.00 -5.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30507435 6 COSMIC
COSN8010559 477 COSMIC
COSN24047764 580 COSMIC
COSN1261851 836 COSMIC
COSN21507284 1010 COSMIC
COSN29917231 1140 COSMIC
COSN8018530 1294 COSMIC
COSN28658854 1295 COSMIC
COSN20093997 1401 COSMIC
COSN20234469 1447 COSMIC
COSN31516711 1469 COSMIC
COSN20117452 1923 COSMIC
COSN23814014 1950 COSMIC
COSN8997385 2108 COSMIC
COSN30538747 2150 COSMIC
COSN8018529 2220 COSMIC
COSN27686507 2280 COSMIC
COSN29461230 2343 COSMIC
COSN26669854 2344 COSMIC
COSN31529455 2368 COSMIC
COSN26481889 2372 COSMIC
COSN26568172 2416 COSMIC
COSN26577854 2417 COSMIC
COSN25840942 2450 COSMIC
COSN25702146 2454 COSMIC
COSN16563779 2458 COSMIC
COSN31535802 2473 COSMIC
COSN31532673 2553 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1027941531 4 dbSNP
rs1302082343 7 dbSNP
rs201579666 9 dbSNP
rs767327253 11 dbSNP
rs142283293 12 dbSNP
rs371135313 13 dbSNP
rs55755354 14 dbSNP
rs1212691446 15 dbSNP
rs1013896567 19 dbSNP
rs762304380 22 dbSNP
rs777155984 35 dbSNP
rs769102255 40 dbSNP
rs747423925 41 dbSNP
rs893439075 43 dbSNP
rs1238423052 47 dbSNP
rs775804860 49 dbSNP
rs1386211231 50 dbSNP
rs1049407389 55 dbSNP
rs1483363848 67 dbSNP
rs1208635728 69 dbSNP
rs894106618 70 dbSNP
rs185497677 71 dbSNP
rs1226059098 73 dbSNP
rs1159292384 98 dbSNP
rs1414045212 101 dbSNP
rs1355061015 106 dbSNP
rs922365919 110 dbSNP
rs774399111 114 dbSNP
rs976936065 121 dbSNP
rs1359586766 126 dbSNP
rs1450460251 127 dbSNP
rs904769012 132 dbSNP
rs1350123938 134 dbSNP
rs1246579270 139 dbSNP
rs939816029 144 dbSNP
rs1362745958 149 dbSNP
rs1041940313 150 dbSNP
rs908392593 151 dbSNP
rs542489995 154 dbSNP
rs1435725108 155 dbSNP
rs12484542 156 dbSNP
rs1279773908 157 dbSNP
rs1321524523 159 dbSNP
rs952616736 160 dbSNP
rs563488355 164 dbSNP
rs1390148785 168 dbSNP
rs1182190252 169 dbSNP
rs1482543454 169 dbSNP
rs1028031491 174 dbSNP
rs544426886 175 dbSNP
rs959671517 185 dbSNP
rs1388701226 186 dbSNP
rs193294065 195 dbSNP
rs1415911104 199 dbSNP
rs1166516920 214 dbSNP
rs1003606895 216 dbSNP
rs902667522 217 dbSNP
rs1370113708 219 dbSNP
rs1021086347 227 dbSNP
rs1450493237 228 dbSNP
rs1250390501 230 dbSNP
rs558748028 239 dbSNP
rs532266542 240 dbSNP
rs1348276238 244 dbSNP
rs1436345743 248 dbSNP
rs1276008682 255 dbSNP
rs1370394440 256 dbSNP
rs911241045 261 dbSNP
rs894055481 272 dbSNP
rs1297330393 273 dbSNP
rs1340949896 274 dbSNP
rs1205504829 278 dbSNP
rs1450502678 278 dbSNP
rs1048388982 283 dbSNP
rs1050462255 285 dbSNP
rs932320339 286 dbSNP
rs1478969819 290 dbSNP
rs1186375468 296 dbSNP
rs1389385237 298 dbSNP
rs900856935 300 dbSNP
rs1450316788 306 dbSNP
rs920489428 308 dbSNP
rs573254857 310 dbSNP
rs555338797 316 dbSNP
rs1324323794 328 dbSNP
rs117867125 331 dbSNP
rs1320291607 332 dbSNP
rs939767058 336 dbSNP
rs917011327 346 dbSNP
rs908343542 347 dbSNP
rs1435723563 350 dbSNP
rs1227180387 352 dbSNP
rs992567043 353 dbSNP
rs958462766 354 dbSNP
rs983959265 358 dbSNP
rs1247147774 372 dbSNP
rs999855155 377 dbSNP
rs931176018 379 dbSNP
rs781554835 380 dbSNP
rs1472596602 381 dbSNP
rs1010426953 382 dbSNP
rs1163856073 382 dbSNP
rs901312062 387 dbSNP
rs569399661 402 dbSNP
rs1332613131 407 dbSNP
rs1338275600 413 dbSNP
rs557531910 413 dbSNP
rs749464464 414 dbSNP
rs1336355633 416 dbSNP
rs1226470043 418 dbSNP
rs112589828 425 dbSNP
rs561678912 426 dbSNP
rs1329812398 427 dbSNP
rs1007426585 432 dbSNP
rs751351716 440 dbSNP
rs959383338 442 dbSNP
rs1442049980 443 dbSNP
rs1035451340 445 dbSNP
rs780528496 447 dbSNP
rs1189956473 449 dbSNP
rs1478023713 459 dbSNP
rs1246782491 460 dbSNP
rs966767378 462 dbSNP
rs1481795790 473 dbSNP
rs1158550878 480 dbSNP
rs1021034176 481 dbSNP
rs1011022558 484 dbSNP
rs188925297 495 dbSNP
rs1402025685 497 dbSNP
rs1413520426 502 dbSNP
rs1276303983 504 dbSNP
rs1218571360 506 dbSNP
rs1345545422 515 dbSNP
rs117527714 519 dbSNP
rs917106079 520 dbSNP
rs1406793132 523 dbSNP
rs1241171883 525 dbSNP
rs528102139 536 dbSNP
rs543424614 537 dbSNP
rs992615743 537 dbSNP
rs566906807 547 dbSNP
rs1482198982 549 dbSNP
rs1307615920 554 dbSNP
rs1181477136 558 dbSNP
rs1410717834 559 dbSNP
rs1006603288 563 dbSNP
rs1252701318 571 dbSNP
rs1421392940 572 dbSNP
rs997523393 573 dbSNP
rs548905615 574 dbSNP
rs1197418366 576 dbSNP
rs1377398350 577 dbSNP
rs1414267572 583 dbSNP
rs1175948987 587 dbSNP
rs978834486 606 dbSNP
rs900807243 607 dbSNP
rs369360282 608 dbSNP
rs1250482829 612 dbSNP
rs1393034946 628 dbSNP
rs758815024 630 dbSNP
rs750871222 631 dbSNP
rs1020561699 634 dbSNP
rs1235388422 641 dbSNP
rs1209090744 642 dbSNP
rs1442809229 645 dbSNP
rs886856607 646 dbSNP
rs1481685172 649 dbSNP
rs1280597709 659 dbSNP
rs1048210436 660 dbSNP
rs931148912 661 dbSNP
rs1226535972 666 dbSNP
rs965600048 667 dbSNP
rs1287871280 678 dbSNP
rs1447282942 685 dbSNP
rs915754529 686 dbSNP
rs574070479 689 dbSNP
rs765811712 691 dbSNP
rs756717054 693 dbSNP
rs1007025648 698 dbSNP
rs1291319848 699 dbSNP
rs184369352 704 dbSNP
rs927946251 705 dbSNP
rs541901158 710 dbSNP
rs1339232464 711 dbSNP
rs897193312 716 dbSNP
rs1456160825 718 dbSNP
rs1410568949 720 dbSNP
rs1264955080 724 dbSNP
rs1159170805 726 dbSNP
rs1216174982 730 dbSNP
rs1246545436 731 dbSNP
rs775581715 738 dbSNP
rs1261950164 750 dbSNP
rs1411116472 758 dbSNP
rs760249218 759 dbSNP
rs1162073538 760 dbSNP
rs1367451281 775 dbSNP
rs940650370 778 dbSNP
rs1167076058 780 dbSNP
rs1244794237 782 dbSNP
rs895727727 783 dbSNP
rs913972084 788 dbSNP
rs1268700268 791 dbSNP
rs1289233616 793 dbSNP
rs989547036 794 dbSNP
rs775152377 806 dbSNP
rs958208377 807 dbSNP
rs1312093012 820 dbSNP
rs1228003103 823 dbSNP
rs1322452153 823 dbSNP
rs1028921784 827 dbSNP
rs997075469 828 dbSNP
rs545205095 830 dbSNP
rs978505956 836 dbSNP
rs1486639685 837 dbSNP
rs947111084 845 dbSNP
rs1254840683 846 dbSNP
rs912924911 848 dbSNP
rs561019331 852 dbSNP
rs1321831490 854 dbSNP
rs34853198 860 dbSNP
rs1454855089 865 dbSNP
rs966017933 896 dbSNP
rs775842932 897 dbSNP
rs1003874149 901 dbSNP
rs191538982 907 dbSNP
rs1356365289 908 dbSNP
rs965627537 920 dbSNP
rs1286540691 925 dbSNP
rs1019838864 927 dbSNP
rs986051164 928 dbSNP
rs1048156848 931 dbSNP
rs767248938 937 dbSNP
rs1448662417 939 dbSNP
rs1248519421 943 dbSNP
rs1255007948 946 dbSNP
rs894281530 956 dbSNP
rs1056035779 967 dbSNP
rs938565907 968 dbSNP
rs375205999 969 dbSNP
rs1041643311 970 dbSNP
rs1177753078 970 dbSNP
rs1409866908 971 dbSNP
rs945361282 980 dbSNP
rs144337373 981 dbSNP
rs1376220714 988 dbSNP
rs1322624287 990 dbSNP
rs1015580274 992 dbSNP
rs989550906 995 dbSNP
rs565408096 998 dbSNP
rs540716860 1005 dbSNP
rs1013505638 1018 dbSNP
rs531457910 1019 dbSNP
rs1370071882 1027 dbSNP
rs895737552 1029 dbSNP
rs1057022832 1031 dbSNP
rs958370365 1032 dbSNP
rs1218934385 1038 dbSNP
rs1304640583 1040 dbSNP
rs1348136182 1041 dbSNP
rs573316660 1050 dbSNP
rs921404010 1055 dbSNP
rs975984622 1059 dbSNP
rs555001807 1060 dbSNP
rs1482472705 1062 dbSNP
rs1204638970 1063 dbSNP
rs1234495460 1064 dbSNP
rs1487467727 1065 dbSNP
rs1190355689 1067 dbSNP
rs1395523300 1071 dbSNP
rs1166999891 1072 dbSNP
rs965608898 1074 dbSNP
rs1019865322 1080 dbSNP
rs983057441 1081 dbSNP
rs1364855510 1095 dbSNP
rs1348585765 1104 dbSNP
rs1292499233 1108 dbSNP
rs1436465438 1109 dbSNP
rs1326989583 1110 dbSNP
rs1373701819 1115 dbSNP
rs774155024 1116 dbSNP
rs1294888855 1118 dbSNP
rs542999021 1123 dbSNP
rs759185512 1125 dbSNP
rs1366995067 1126 dbSNP
rs367564536 1134 dbSNP
rs564056739 1134 dbSNP
rs1214577074 1138 dbSNP
rs1274518682 1139 dbSNP
rs995235099 1140 dbSNP
rs894211661 1152 dbSNP
rs1034134977 1157 dbSNP
rs1003104129 1158 dbSNP
rs1253369781 1164 dbSNP
rs1469609214 1170 dbSNP
rs575906192 1175 dbSNP
rs377285543 1176 dbSNP
rs187086051 1180 dbSNP
rs1390604567 1181 dbSNP
rs1411798990 1190 dbSNP
rs571728244 1197 dbSNP
rs1431428524 1209 dbSNP
rs945979393 1212 dbSNP
rs1397355431 1215 dbSNP
rs1433303132 1221 dbSNP
rs562510590 1222 dbSNP
rs545963260 1224 dbSNP
rs892431583 1224 dbSNP
rs1271429303 1231 dbSNP
rs1376399580 1232 dbSNP
rs912952703 1234 dbSNP
rs1273694391 1237 dbSNP
rs552685856 1238 dbSNP
rs1054200622 1243 dbSNP
rs1283365049 1256 dbSNP
rs746647032 1258 dbSNP
rs534405154 1269 dbSNP
rs1252312656 1270 dbSNP
rs1188792670 1274 dbSNP
rs1420574267 1276 dbSNP
rs1230249535 1277 dbSNP
rs1310885723 1281 dbSNP
rs1301207428 1282 dbSNP
rs1386801734 1283 dbSNP
rs1158875447 1293 dbSNP
rs1346884276 1294 dbSNP
rs1348856800 1295 dbSNP
rs1057465 1296 dbSNP
rs1338369187 1297 dbSNP
rs549849173 1297 dbSNP
rs1293382666 1298 dbSNP
rs201969819 1298 dbSNP
rs754030936 1298 dbSNP
rs1226568237 1305 dbSNP
rs1278701439 1306 dbSNP
rs1351198311 1313 dbSNP
rs1169499537 1314 dbSNP
rs1276721779 1333 dbSNP
rs548571823 1333 dbSNP
rs530390909 1340 dbSNP
rs1464362225 1355 dbSNP
rs1485472843 1357 dbSNP
rs1376949143 1361 dbSNP
rs1050526629 1366 dbSNP
rs374843093 1367 dbSNP
rs376205064 1369 dbSNP
rs1259770959 1370 dbSNP
rs1180267930 1371 dbSNP
rs1482889133 1372 dbSNP
rs1251517704 1373 dbSNP
rs1364900221 1383 dbSNP
rs1197861203 1387 dbSNP
rs1471338133 1388 dbSNP
rs1399539661 1391 dbSNP
rs1482496549 1392 dbSNP
rs10560249 1393 dbSNP
rs1240844391 1393 dbSNP
rs1272876713 1393 dbSNP
rs1312949841 1393 dbSNP
rs1328046160 1393 dbSNP
rs1336313149 1393 dbSNP
rs1376785259 1393 dbSNP
rs1407895371 1393 dbSNP
rs1491202049 1393 dbSNP
rs553739129 1393 dbSNP
rs55649369 1393 dbSNP
rs71197105 1393 dbSNP
rs759808676 1393 dbSNP
rs766370421 1393 dbSNP
rs771287480 1393 dbSNP
rs869133333 1393 dbSNP
rs1491543911 1394 dbSNP
rs750991411 1394 dbSNP
rs773726685 1394 dbSNP
rs954424707 1394 dbSNP
rs1197183734 1395 dbSNP
rs1027195153 1396 dbSNP
rs372282520 1396 dbSNP
rs974637706 1399 dbSNP
rs878874490 1401 dbSNP
rs1173931663 1405 dbSNP
rs1396533045 1408 dbSNP
rs1459991598 1410 dbSNP
rs1297111438 1415 dbSNP
rs936726107 1415 dbSNP
rs921341221 1418 dbSNP
rs1321339307 1420 dbSNP
rs1370035296 1422 dbSNP
rs1441892056 1423 dbSNP
rs1226702591 1429 dbSNP
rs1305848853 1429 dbSNP
rs1340304763 1429 dbSNP
rs1252020599 1431 dbSNP
rs1342080527 1436 dbSNP
rs975553372 1442 dbSNP
rs77012152 1443 dbSNP
rs912756553 1445 dbSNP
rs1254419289 1446 dbSNP
rs1426383719 1448 dbSNP
rs1169117877 1450 dbSNP
rs1013556437 1460 dbSNP
rs1330493923 1480 dbSNP
rs1463436885 1487 dbSNP
rs983005065 1498 dbSNP
rs551363762 1505 dbSNP
rs1034083431 1510 dbSNP
rs1401279523 1518 dbSNP
rs373407741 1519 dbSNP
rs1327681623 1525 dbSNP
rs1363267206 1531 dbSNP
rs1470947014 1531 dbSNP
rs533185266 1533 dbSNP
rs1242727236 1534 dbSNP
rs1273064347 1536 dbSNP
rs1156944143 1538 dbSNP
rs1336116368 1558 dbSNP
rs1215883249 1571 dbSNP
rs1472311202 1573 dbSNP
rs1364554656 1577 dbSNP
rs1484689144 1578 dbSNP
rs1185616776 1580 dbSNP
rs974137689 1580 dbSNP
rs1261793779 1586 dbSNP
rs1429726602 1591 dbSNP
rs75264209 1596 dbSNP
rs1255964988 1597 dbSNP
rs113908050 1600 dbSNP
rs1166814424 1610 dbSNP
rs1343256612 1611 dbSNP
rs1052827070 1614 dbSNP
rs796943898 1616 dbSNP
rs1289614546 1618 dbSNP
rs1266788845 1620 dbSNP
rs1387453946 1629 dbSNP
rs528596908 1630 dbSNP
rs1207488244 1641 dbSNP
rs1412942792 1641 dbSNP
rs1002645052 1652 dbSNP
rs907016369 1655 dbSNP
rs1020082294 1656 dbSNP
rs561328501 1657 dbSNP
rs912255803 1660 dbSNP
rs1242220702 1661 dbSNP
rs1260909051 1664 dbSNP
rs1486649177 1666 dbSNP
rs1208079875 1667 dbSNP
rs555401105 1671 dbSNP
rs1339639112 1672 dbSNP
rs543026289 1678 dbSNP
rs774922976 1680 dbSNP
rs1454377609 1688 dbSNP
rs1405729316 1689 dbSNP
rs1054414584 1701 dbSNP
rs920136370 1702 dbSNP
rs780418188 1707 dbSNP
rs961499304 1710 dbSNP
rs1456740938 1711 dbSNP
rs1312347390 1714 dbSNP
rs1376189010 1715 dbSNP
rs1385815558 1719 dbSNP
rs36054621 1723 dbSNP
rs1417141786 1724 dbSNP
rs936656195 1727 dbSNP
rs1296909355 1731 dbSNP
rs1373294067 1745 dbSNP
rs1224625884 1749 dbSNP
rs899855908 1754 dbSNP
rs1231670131 1755 dbSNP
rs1278964553 1758 dbSNP
rs1456639114 1759 dbSNP
rs780601627 1763 dbSNP
rs192247907 1764 dbSNP
rs1231035205 1769 dbSNP
rs575523666 1772 dbSNP
rs960759598 1778 dbSNP
rs1033724459 1780 dbSNP
rs1252487708 1781 dbSNP
rs1452776886 1782 dbSNP
rs146002785 1786 dbSNP
rs1436620735 1787 dbSNP
rs970004378 1790 dbSNP
rs912702895 1792 dbSNP
rs28458809 1797 dbSNP
rs1354446759 1813 dbSNP
rs545362798 1828 dbSNP
rs1302591638 1829 dbSNP
rs770271528 1829 dbSNP
rs77655604 1836 dbSNP
rs1447057714 1842 dbSNP
rs188021900 1843 dbSNP
rs1052923622 1849 dbSNP
rs1270346054 1852 dbSNP
rs1306843245 1854 dbSNP
rs758658009 1858 dbSNP
rs974372646 1865 dbSNP
rs139212007 1867 dbSNP
rs1247831434 1868 dbSNP
rs1184849560 1875 dbSNP
rs1418941109 1876 dbSNP
rs1049410810 1883 dbSNP
rs540145665 1884 dbSNP
rs1392956683 1892 dbSNP
rs1461189185 1899 dbSNP
rs1446117869 1900 dbSNP
rs981121511 1902 dbSNP
rs932267719 1906 dbSNP
rs1267864430 1907 dbSNP
rs117771670 1911 dbSNP
rs1327092724 1912 dbSNP
rs1020031819 1914 dbSNP
rs1010017795 1915 dbSNP
rs940263634 1917 dbSNP
rs369074234 1918 dbSNP
rs1453509691 1919 dbSNP
rs375787499 1920 dbSNP
rs1301611750 1923 dbSNP
rs3041793 1924 dbSNP
rs1475759533 1925 dbSNP
rs1188363456 1927 dbSNP
rs1164478389 1928 dbSNP
rs531627015 1929 dbSNP
rs992283938 1930 dbSNP
rs1166100593 1931 dbSNP
rs960855641 1931 dbSNP
rs34007134 1934 dbSNP
rs183841853 1935 dbSNP
rs1344274687 1938 dbSNP
rs1430742304 1939 dbSNP
rs1033324232 1942 dbSNP
rs1279560414 1946 dbSNP
rs1232641957 1949 dbSNP
rs1293652580 1949 dbSNP
rs1353477571 1949 dbSNP
rs1356438950 1949 dbSNP
rs1358137342 1949 dbSNP
rs71324902 1949 dbSNP
rs996128974 1949 dbSNP
rs1168495462 1950 dbSNP
rs1476064917 1953 dbSNP
rs1244335093 1958 dbSNP
rs1196053983 1961 dbSNP
rs1299461642 1964 dbSNP
rs926661511 1966 dbSNP
rs537076502 1968 dbSNP
rs1269101733 1971 dbSNP
rs1039716981 1979 dbSNP
rs980814754 1979 dbSNP
rs1008277664 1980 dbSNP
rs1224307114 1983 dbSNP
rs1278797089 1984 dbSNP
rs574443899 1987 dbSNP
rs1242638607 1988 dbSNP
rs1278256454 1990 dbSNP
rs1022292757 1992 dbSNP
rs1047205658 1993 dbSNP
rs990091816 1997 dbSNP
rs150805728 1998 dbSNP
rs1233854591 2001 dbSNP
rs1341306444 2003 dbSNP
rs1273020994 2006 dbSNP
rs1160027729 2007 dbSNP
rs141143438 2009 dbSNP
rs1038997903 2010 dbSNP
rs754343348 2017 dbSNP
rs781299883 2018 dbSNP
rs1404248052 2026 dbSNP
rs981070603 2031 dbSNP
rs890880496 2033 dbSNP
rs1369090916 2035 dbSNP
rs1328517486 2039 dbSNP
rs1327905590 2050 dbSNP
rs1336181861 2051 dbSNP
rs1028464811 2052 dbSNP
rs377234025 2056 dbSNP
rs1347438189 2058 dbSNP
rs1235043164 2060 dbSNP
rs912971699 2062 dbSNP
rs1171366881 2065 dbSNP
rs988544141 2066 dbSNP
rs1274345269 2072 dbSNP
rs1477392440 2085 dbSNP
rs1429442424 2086 dbSNP
rs539347531 2092 dbSNP
rs1032861186 2093 dbSNP
rs1250689395 2094 dbSNP
rs113536507 2101 dbSNP
rs996464701 2102 dbSNP
rs1250622414 2104 dbSNP
rs964663666 2106 dbSNP
rs887352812 2109 dbSNP
rs1056565571 2110 dbSNP
rs866877656 2111 dbSNP
rs1218625128 2112 dbSNP
rs1370516966 2112 dbSNP
rs926741244 2112 dbSNP
rs981293816 2113 dbSNP
rs1008217111 2117 dbSNP
rs946804707 2118 dbSNP
rs915286136 2121 dbSNP
rs1165445104 2123 dbSNP
rs891153813 2127 dbSNP
rs955950121 2128 dbSNP
rs1269049642 2130 dbSNP
rs547619428 2139 dbSNP
rs529068207 2154 dbSNP
rs561391403 2159 dbSNP
rs1047152181 2163 dbSNP
rs986667494 2166 dbSNP
rs994264312 2171 dbSNP
rs1162528041 2175 dbSNP
rs549189905 2198 dbSNP
rs575675256 2203 dbSNP
rs1458236990 2209 dbSNP
rs1356680847 2210 dbSNP
rs898625740 2219 dbSNP
rs1381657817 2226 dbSNP
rs113994298 2231 dbSNP
rs1406173434 2232 dbSNP
rs1342931540 2236 dbSNP
rs1177890308 2237 dbSNP
rs1232042600 2245 dbSNP
rs937544319 2246 dbSNP
rs1028142313 2247 dbSNP
rs1335850242 2250 dbSNP
rs1471332294 2251 dbSNP
rs752318710 2252 dbSNP
rs997022387 2254 dbSNP
rs1484698421 2255 dbSNP
rs1045993348 2256 dbSNP
rs372926674 2257 dbSNP
rs912918042 2262 dbSNP
rs988493431 2270 dbSNP
rs1185642745 2271 dbSNP
rs898240630 2275 dbSNP
rs1177460253 2278 dbSNP
rs1424105214 2280 dbSNP
rs539222889 2281 dbSNP
rs558815023 2281 dbSNP
rs770917823 2283 dbSNP
rs138691385 2284 dbSNP
rs1362590281 2286 dbSNP
rs558741181 2292 dbSNP
rs1235581019 2297 dbSNP
rs887378833 2304 dbSNP
rs1209329705 2315 dbSNP
rs935775913 2319 dbSNP
rs1056613120 2336 dbSNP
rs925740266 2338 dbSNP
rs1398094059 2348 dbSNP
rs867282997 2351 dbSNP
rs1054207 2353 dbSNP
rs939607558 2353 dbSNP
rs974602428 2354 dbSNP
rs1045235380 2358 dbSNP
rs1237935516 2358 dbSNP
rs11548925 2359 dbSNP
rs946826447 2359 dbSNP
rs777442184 2367 dbSNP
rs1467974351 2371 dbSNP
rs915297445 2372 dbSNP
rs1483568918 2378 dbSNP
rs778083850 2382 dbSNP
rs1359290489 2393 dbSNP
rs1224595167 2399 dbSNP
rs1382433784 2403 dbSNP
rs1432869395 2403 dbSNP
rs1173109442 2404 dbSNP
rs1450906460 2410 dbSNP
rs935293603 2412 dbSNP
rs1375970149 2414 dbSNP
rs1448020023 2416 dbSNP
rs1309443075 2417 dbSNP
rs1378669741 2418 dbSNP
rs6001086 2427 dbSNP
rs1282868703 2428 dbSNP
rs113188643 2429 dbSNP
rs1249568426 2429 dbSNP
rs1277382183 2429 dbSNP
rs1452381579 2430 dbSNP
rs1384106368 2433 dbSNP
rs1339295897 2434 dbSNP
rs1193084476 2438 dbSNP
rs77316284 2441 dbSNP
rs577920523 2443 dbSNP
rs1354464769 2444 dbSNP
rs1159361800 2450 dbSNP
rs1466411195 2450 dbSNP
rs1402015806 2453 dbSNP
rs1438307701 2454 dbSNP
rs955298301 2458 dbSNP
rs9607526 2459 dbSNP
rs559578184 2460 dbSNP
rs1182688978 2465 dbSNP
rs1293272523 2471 dbSNP
rs1445038104 2471 dbSNP
rs1244848896 2472 dbSNP
rs1186635829 2473 dbSNP
rs1259829779 2474 dbSNP
rs1484920006 2474 dbSNP
rs1260279934 2476 dbSNP
rs1467288391 2478 dbSNP
rs541249071 2480 dbSNP
rs573873476 2483 dbSNP
rs962443607 2484 dbSNP
rs555472705 2485 dbSNP
rs1003847361 2486 dbSNP
rs1203996201 2486 dbSNP
rs1322420946 2486 dbSNP
rs1350114821 2486 dbSNP
rs951080697 2492 dbSNP
rs1339755803 2499 dbSNP
rs1279838003 2505 dbSNP
rs1227566533 2510 dbSNP
rs964929322 2513 dbSNP
rs1453594671 2526 dbSNP
rs1213724949 2532 dbSNP
rs1018853872 2535 dbSNP
rs1488889761 2543 dbSNP
rs1196407770 2544 dbSNP
rs1416374335 2553 dbSNP
rs1475046439 2568 dbSNP
rs566996251 2579 dbSNP
rs1414052949 2581 dbSNP
rs1293297441 2593 dbSNP
rs987401345 2596 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PCPG -0.996 0.03 -0.500 0.33 3 Click to see details
STAD -0.286 0.06 -0.360 0.02 32 Click to see details
THCA 0.205 0.06 0.131 0.16 59 Click to see details
BLCA 0.335 0.09 0.437 0.03 18 Click to see details
KIRC 0.155 0.1 0.204 0.05 68 Click to see details
HNSC -0.186 0.12 -0.167 0.15 42 Click to see details
BRCA 0.129 0.12 0.106 0.17 84 Click to see details
LUSC 0.191 0.13 0.236 0.08 38 Click to see details
PAAD 0.551 0.22 0.400 0.3 4 Click to see details
UCEC 0.184 0.23 0.133 0.29 19 Click to see details
PRAD 0.101 0.24 0.090 0.27 50 Click to see details
LUAD 0.21 0.26 0.168 0.3 12 Click to see details
ESCA 0.178 0.3 0.100 0.38 11 Click to see details
LIHC -0.065 0.33 -0.052 0.36 49 Click to see details
KIRP 0.073 0.35 0.047 0.4 32 Click to see details
CHOL 0.117 0.38 -0.117 0.38 9 Click to see details
CESC -0.131 0.46 -0.500 0.33 3 Click to see details
KICH 0.016 0.47 0.058 0.39 25 Click to see details
COAD 0.004 0.5 -0.048 0.46 8 Click to see details
COAD 0.004 0.5 -0.048 0.46 8 Click to see details
COAD 0.004 0.5 -0.048 0.46 8 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission