>NDUFA11|NM_175614|3'UTR
   1 GCCCTGTGCCTGCCGGGACCTCCAGCCTGCAGAATGCGTCCAGAAATAAATTCTGTGTCTGTGTGTGTGTCAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ggGGGUAACGAUGUC------GG-CGGACa 5' ||::| ||:| | || ||||| Target 5' gcCCTGTGCCTGCCGGGACCTCCAGCCTGc 3'	1 - 30	119.00	-19.90
2	miRNA 3' gggggUAACGAUGUCGGCGGACa 5' ||| ||::: |:|: || Target 5' aataaATT-CTGTGTCTGTGTGt 3'	45 - 66	93.00	-9.30
3	miRNA 3' ggggguaacgaugucggCGGaca 5' ||| Target 5' -----------------GCCctg 3'	1 - 6	60.00	-8.76

Mutant ID	Mutant Position	Mutant Source
330235	55	ClinVar
330234	59	ClinVar
894131	63	ClinVar
COSN31784989	1	COSMIC
COSN26986182	5	COSMIC
COSN30646692	12	COSMIC
COSN508341	60	COSMIC
COSN30156544	64	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs766304743	1	dbSNP
rs763178359	3	dbSNP
rs750598527	9	dbSNP
rs1273668007	11	dbSNP
rs1206996306	12	dbSNP
rs765624733	14	dbSNP
rs762209658	15	dbSNP
rs776834428	20	dbSNP
rs955742240	26	dbSNP
rs1277796318	30	dbSNP
rs769260017	34	dbSNP
rs372606393	37	dbSNP
rs368932386	38	dbSNP
rs1433227753	46	dbSNP
rs1389824913	51	dbSNP
rs1375290940	53	dbSNP
rs771648754	55	dbSNP
rs765727153	56	dbSNP
rs191571307	59	dbSNP
rs770675936	60	dbSNP
rs779588327	61	dbSNP
rs1408789549	63	dbSNP
rs749166288	63	dbSNP
rs1469217273	67	dbSNP

- Cell host & microbe, 2011

Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.