pre-miRNA Information
pre-miRNA hsa-mir-3180-1   
Genomic Coordinates chr16: 14911220 - 14911313
Description Homo sapiens miR-3180-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-2   
Genomic Coordinates chr16: 16309879 - 16309966
Description Homo sapiens miR-3180-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-3   
Genomic Coordinates chr16: 18402178 - 18402271
Description Homo sapiens miR-3180-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3180-3p
Sequence 62| UGGGGCGGAGCUUCCGGAGGCC |83
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C19orf26
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ccggaGGCCUUC-GAGGCGGGGu 5'
               ::||  | | ||||||| 
Target 5' -----UUGGUCGCCGCCGCCCCc 3'
1 - 18
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC
Disease MIMAT0015058
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020023. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ccggaGGCCUUC-GAGGCGGGgu 5'
               ::||  | | ||||||  
Target 5' -----UUGGUCGCCGCCGCCC-- 3'
1 - 16
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020023
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000590083.1 | 3UTR | uuggucgccgccgccc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000590083.1 | 3UTR | uuggucgccgccgccccc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
66 hsa-miR-3180-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT133792 SKI SKI proto-oncogene 2 2
MIRT146658 MINK1 misshapen like kinase 1 2 4
MIRT441337 C19orf26 CACN beta subunit associated regulatory protein 2 4
MIRT449088 XPO6 exportin 6 2 2
MIRT464967 TULP1 tubby like protein 1 2 6
MIRT471706 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT473252 MIDN midnolin 2 2
MIRT483494 STMN3 stathmin 3 2 4
MIRT483726 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT485684 CCDC64 BICD family like cargo adaptor 1 2 4
MIRT486046 WSCD1 WSC domain containing 1 2 4
MIRT486522 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486779 SESTD1 SEC14 and spectrin domain containing 1 2 4
MIRT486852 DPF1 double PHD fingers 1 2 2
MIRT487035 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487082 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT487284 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 4
MIRT487992 RXRB retinoid X receptor beta 2 2
MIRT488101 POU3F1 POU class 3 homeobox 1 2 2
MIRT488547 POU3F3 POU class 3 homeobox 3 2 8
MIRT488582 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488757 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489217 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489350 SYNGR1 synaptogyrin 1 2 4
MIRT489385 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489459 MSC musculin 2 2
MIRT489469 SLITRK5 SLIT and NTRK like family member 5 2 2
MIRT489749 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT490244 MFI2 melanotransferrin 2 2
MIRT490423 VPS51 VPS51, GARP complex subunit 2 4
MIRT490644 FEM1A fem-1 homolog A 2 2
MIRT491977 UNK unkempt family zinc finger 2 2
MIRT492469 RASD1 ras related dexamethasone induced 1 2 4
MIRT492837 NRGN neurogranin 2 2
MIRT492956 NEUROD2 neuronal differentiation 2 2 2
MIRT493002 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT493430 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT493709 H2AFX H2A histone family member X 2 6
MIRT493886 FAM43A family with sequence similarity 43 member A 2 4
MIRT493955 ENG endoglin 2 2
MIRT500168 MSI1 musashi RNA binding protein 1 2 2
MIRT500196 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 2 4
MIRT500366 ZNF385A zinc finger protein 385A 2 2
MIRT501159 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501698 PCGF3 polycomb group ring finger 3 2 6
MIRT512173 CASP16 caspase 16, pseudogene 2 6
MIRT512237 ATG2A autophagy related 2A 2 6
MIRT512879 PITX3 paired like homeodomain 3 2 2
MIRT531184 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT548362 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT569093 FSCN1 fascin actin-bundling protein 1 2 2
MIRT574133 MARVELD1 MARVEL domain containing 1 2 2
MIRT635542 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT654098 RSBN1L round spermatid basic protein 1 like 2 2
MIRT664919 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT669843 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT670502 LYRM4 LYR motif containing 4 2 2
MIRT670526 SLC9A7 solute carrier family 9 member A7 2 2
MIRT670550 SHISA2 shisa family member 2 2 2
MIRT671031 PCDHB2 protocadherin beta 2 2 2
MIRT695219 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700129 RNF144B ring finger protein 144B 2 2
MIRT709280 MAPK8IP2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT712750 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT720753 FAM193A family with sequence similarity 193 member A 2 2
MIRT724920 VPS18 VPS18, CORVET/HOPS core subunit 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3180 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3180 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-3180 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant Low Gastric Cancer cell line (MGC-803)
hsa-miR-3180-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3180-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-3180-3p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission