miRTarBase - #MIRT441369


—
pre-miRNA Information
pre-miRNA hsa-mir-6845   
Genomic Coordinates chr8: 143837756 - 143837816
Description Homo sapiens miR-6845 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6845-3p
Sequence 41| CCUCUCCUCCCUGUGCCCCAG |61
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM1097049 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1188948040 11 dbSNP
rs782083284 12 dbSNP
rs1420355210 14 dbSNP
rs1474412499 18 dbSNP
rs1164597572 19 dbSNP
rs781835655 21 dbSNP
Putative Targets

Gene Information
Gene Symbol KARS   
Synonyms CMTRIB, DFNB89, KARS1, KARS2, KRS
Description lysyl-tRNA synthetase
Transcript NM_001130089   
Other Transcripts NM_005548   
Expression
Putative miRNA Targets on KARS
3'UTR of KARS
(miRNA target sites are highlighted)		 
>KARS|NM_001130089|3'UTR
   1 AAAATAATAATTGCAAGTTGTATAACTCAGGCGTCTTTGCATTTCTGCGAAAGATCAAGGTCTGCAAGGGAATTCTTGTG
  81 TGCTGCTTTCCATTTGACACCGCAGTTCTGTTCAGCCATCAGAAGAGAGACAAGGAATTAAAAATTTCTTTTTAATCCTG
 161 TTACCAAATAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaccCCGU-GUCCCUCCUCUCc 5'
              | || ||  || ||||| 
Target 5' ttcaGCCATCA--GAAGAGAGa 3'
 111 - 130 117.00 -7.20
2 
miRNA  3' gaccCCGUGUCCCUCCUCUcc 5'
              ||: | |  |||: |  
Target 5' tcaaGGT-CTGCAAGGGAAtt 3'
 55 - 74 76.00 -8.13
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
320623 26 ClinVar
320621 59 ClinVar
COSN29461843 14 COSMIC
COSN30514254 22 COSMIC
COSN30156940 28 COSMIC
COSN26555812 32 COSMIC
COSN31542869 48 COSMIC
COSN30516047 58 COSMIC
COSN30112186 97 COSMIC
COSN27298340 101 COSMIC
COSN30176007 135 COSMIC
COSN30114699 142 COSMIC
COSN31573502 148 COSMIC
COSN31570986 151 COSMIC
COSN30114934 152 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771377883 1 dbSNP
rs1269743973 12 dbSNP
rs974402794 13 dbSNP
rs1228748317 14 dbSNP
rs747105466 17 dbSNP
rs778053495 21 dbSNP
rs376960548 22 dbSNP
rs748316661 24 dbSNP
rs753082472 25 dbSNP
rs983171346 25 dbSNP
rs78654839 26 dbSNP
rs1035901990 28 dbSNP
rs1391322713 30 dbSNP
rs767901895 31 dbSNP
rs750234986 32 dbSNP
rs111679674 33 dbSNP
rs757209685 36 dbSNP
rs1802511 38 dbSNP
rs751510371 39 dbSNP
rs759971006 40 dbSNP
rs1372531353 44 dbSNP
rs1192423088 49 dbSNP
rs1040629549 56 dbSNP
rs1023371022 58 dbSNP
rs11505 59 dbSNP
rs893157086 62 dbSNP
rs1164993979 68 dbSNP
rs1286458665 68 dbSNP
rs1014165252 70 dbSNP
rs892639439 75 dbSNP
rs1323418693 79 dbSNP
rs1405725499 85 dbSNP
rs527236481 91 dbSNP
rs1335689842 99 dbSNP
rs998945690 100 dbSNP
rs902343721 102 dbSNP
rs1051631761 105 dbSNP
rs1332718243 113 dbSNP
rs1227835454 129 dbSNP
rs1156362879 131 dbSNP
rs933212240 135 dbSNP
rs1417976627 136 dbSNP
rs533064131 144 dbSNP
rs1206355099 145 dbSNP
rs900391973 157 dbSNP
rs1038939664 164 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000568378.1 | 3UTR | UUGGCAUGCAAGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000568378.1 | 3UTR | UUGGCAUGCAAGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
261 hsa-miR-6845-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT076314 USP22 ubiquitin specific peptidase 22 2 2
MIRT395371 CDC42EP4 CDC42 effector protein 4 2 4
MIRT441369 KARS lysyl-tRNA synthetase 2 4
MIRT443070 ABLIM1 actin binding LIM protein 1 2 2
MIRT452665 PPIA peptidylprolyl isomerase A 2 2
MIRT452910 ZNF138 zinc finger protein 138 2 2
MIRT469246 RHOB ras homolog family member B 2 2
MIRT472531 NACC1 nucleus accumbens associated 1 2 4
MIRT482758 TMEM126B transmembrane protein 126B 2 2
MIRT483988 PANK1 pantothenate kinase 1 2 4
MIRT484345 EPN1 epsin 1 2 4
MIRT495020 C2CD4B C2 calcium dependent domain containing 4B 2 2
MIRT498529 C19orf26 CACN beta subunit associated regulatory protein 2 4
MIRT498819 PTCH2 patched 2 2 8
MIRT499234 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT499483 ZNF669 zinc finger protein 669 2 8
MIRT500253 ZNF791 zinc finger protein 791 2 8
MIRT500294 ZNF667 zinc finger protein 667 2 6
MIRT500312 ZNF622 zinc finger protein 622 2 8
MIRT509593 ZNF616 zinc finger protein 616 2 4
MIRT512273 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT513388 TUBB4A tubulin beta 4A class IVa 2 2
MIRT514683 ZNF701 zinc finger protein 701 2 4
MIRT515160 ZNF90 zinc finger protein 90 2 2
MIRT526136 GJB7 gap junction protein beta 7 2 2
MIRT526381 LSAMP limbic system-associated membrane protein 2 2
MIRT526653 C17orf105 chromosome 17 open reading frame 105 2 6
MIRT530865 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT533821 TGOLN2 trans-golgi network protein 2 2 2
MIRT534137 SNRK SNF related kinase 2 2
MIRT535243 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 4
MIRT536402 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT538978 BCL2L2 BCL2 like 2 2 2
MIRT545012 ZNF439 zinc finger protein 439 2 2
MIRT551783 ZNF117 zinc finger protein 117 2 4
MIRT559482 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559791 ZNF415 zinc finger protein 415 2 2
MIRT559802 ZNF468 zinc finger protein 468 2 4
MIRT559811 ZNF83 zinc finger protein 83 2 4
MIRT559988 ZNF480 zinc finger protein 480 2 4
MIRT560165 ZNF286A zinc finger protein 286A 2 2
MIRT562806 ZNF611 zinc finger protein 611 2 2
MIRT563742 ZNF107 zinc finger protein 107 2 2
MIRT563963 ZNF431 zinc finger protein 431 2 2
MIRT564734 ZNF23 zinc finger protein 23 2 2
MIRT565957 RPS21 ribosomal protein S21 2 4
MIRT569623 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT571537 ZNF286B zinc finger protein 286B 2 2
MIRT572571 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT575099 Mta3 metastasis associated 3 2 5
MIRT607236 LINS lines homolog 1 2 4
MIRT607345 YAE1D1 Yae1 domain containing 1 2 6
MIRT607411 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT607599 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT609569 CATSPER4 cation channel sperm associated 4 2 2
MIRT610390 FOXE1 forkhead box E1 2 2
MIRT610535 FAM46A family with sequence similarity 46 member A 2 4
MIRT610735 NFIX nuclear factor I X 2 4
MIRT611813 FCRL4 Fc receptor like 4 2 2
MIRT612089 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT612335 TRIB2 tribbles pseudokinase 2 2 2
MIRT612675 POU2F1 POU class 2 homeobox 1 2 4
MIRT613176 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT613411 CDH8 cadherin 8 2 2
MIRT613498 ZNF488 zinc finger protein 488 2 2
MIRT613629 MTA3 metastasis associated 1 family member 3 2 7
MIRT613915 POU3F1 POU class 3 homeobox 1 2 2
MIRT615196 CLUAP1 clusterin associated protein 1 2 2
MIRT616142 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT616610 KCNJ11 potassium voltage-gated channel subfamily J member 11 2 4
MIRT616703 UBXN2A UBX domain protein 2A 2 2
MIRT617074 SPIB Spi-B transcription factor 2 2
MIRT617608 SHOX2 short stature homeobox 2 2 2
MIRT617816 EMX2 empty spiracles homeobox 2 2 2
MIRT618117 OPRM1 opioid receptor mu 1 2 2
MIRT618642 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT619070 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619296 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619380 KLHL12 kelch like family member 12 2 2
MIRT619510 TXLNB taxilin beta 2 2
MIRT620022 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT620553 C10orf10 chromosome 10 open reading frame 10 2 4
MIRT620747 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT620837 ZNF551 zinc finger protein 551 2 2
MIRT621171 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT621561 ZFP1 ZFP1 zinc finger protein 2 2
MIRT621611 UNC45B unc-45 myosin chaperone B 2 2
MIRT622195 SLC5A12 solute carrier family 5 member 12 2 2
MIRT622320 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT622470 RNF11 ring finger protein 11 2 2
MIRT622512 RBM20 RNA binding motif protein 20 2 2
MIRT622637 PPAP2B phospholipid phosphatase 3 2 2
MIRT622740 PITPNM3 PITPNM family member 3 2 2
MIRT622999 ONECUT3 one cut homeobox 3 2 2
MIRT623553 JPH3 junctophilin 3 2 2
MIRT623707 HHAT hedgehog acyltransferase 2 2
MIRT624138 DLX3 distal-less homeobox 3 2 2
MIRT624262 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT625713 SPI1 Spi-1 proto-oncogene 2 2
MIRT625953 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT626151 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626508 ATP1A3 ATPase Na+/K+ transporting subunit alpha 3 2 2
MIRT627049 HOXA13 homeobox A13 2 2
MIRT628924 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT629179 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT630945 SIK2 salt inducible kinase 2 2 2
MIRT632933 FGF9 fibroblast growth factor 9 2 2
MIRT639997 PHF21B PHD finger protein 21B 2 2
MIRT640148 CEP104 centrosomal protein 104 2 2
MIRT640426 COG6 component of oligomeric golgi complex 6 2 2
MIRT640864 TSHZ2 teashirt zinc finger homeobox 2 2 4
MIRT641233 SEMA3E semaphorin 3E 2 2
MIRT641315 ATXN7 ataxin 7 2 2
MIRT641885 SND1 staphylococcal nuclease and tudor domain containing 1 2 2
MIRT641967 PWWP2A PWWP domain containing 2A 2 2
MIRT642428 STAT3 signal transducer and activator of transcription 3 2 2
MIRT642738 TDRD6 tudor domain containing 6 2 2
MIRT643466 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT643484 DISC1 disrupted in schizophrenia 1 2 2
MIRT644086 A4GALT alpha 1,4-galactosyltransferase (P blood group) 2 2
MIRT644740 CCDC174 coiled-coil domain containing 174 2 2
MIRT645312 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645701 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT645829 INADL PATJ, crumbs cell polarity complex component 2 2
MIRT645923 PLXNA3 plexin A3 2 2
MIRT646308 IPO9 importin 9 2 2
MIRT646483 SPATS2L spermatogenesis associated serine rich 2 like 2 2
MIRT647063 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 2
MIRT647116 CRISP1 cysteine rich secretory protein 1 2 2
MIRT647232 OR6A2 olfactory receptor family 6 subfamily A member 2 2 2
MIRT647513 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT647754 NBPF3 NBPF member 3 2 2
MIRT648962 TMEM45B transmembrane protein 45B 2 2
MIRT649228 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT649805 GALC galactosylceramidase 2 2
MIRT650244 CD68 CD68 molecule 2 2
MIRT650381 PTGIS prostaglandin I2 synthase 2 2
MIRT650444 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650641 LTF lactotransferrin 2 2
MIRT651068 ZNF518B zinc finger protein 518B 2 4
MIRT651299 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT651373 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT651860 UNC5B unc-5 netrin receptor B 2 2
MIRT652092 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT652167 TRIM66 tripartite motif containing 66 2 2
MIRT652219 TRIM33 tripartite motif containing 33 2 2
MIRT652427 TMEM239 transmembrane protein 239 2 2
MIRT652811 TBL2 transducin beta like 2 2 2
MIRT652996 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT653065 STC2 stanniocalcin 2 2 2
MIRT653207 SP9 Sp9 transcription factor 2 2
MIRT653297 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT653345 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653509 SLC43A2 solute carrier family 43 member 2 2 2
MIRT653938 SERPINC1 serpin family C member 1 2 2
MIRT653976 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT654053 S1PR1 sphingosine-1-phosphate receptor 1 2 2
MIRT654081 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT654458 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT654954 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT655145 PHF3 PHD finger protein 3 2 2
MIRT655186 PHF13 PHD finger protein 13 2 2
MIRT655292 PELI1 pellino E3 ubiquitin protein ligase 1 2 2
MIRT655655 NUPL2 nucleoporin like 2 2 2
MIRT655856 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT656015 MYPN myopalladin 2 2
MIRT656213 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 2 2
MIRT657232 IER5 immediate early response 5 2 2
MIRT657463 C21orf33 chromosome 21 open reading frame 33 2 2
MIRT657498 HBEGF heparin binding EGF like growth factor 2 2
MIRT657791 GK5 glycerol kinase 5 (putative) 2 2
MIRT657942 GATM glycine amidinotransferase 2 2
MIRT657953 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658242 FAXC failed axon connections homolog 2 2
MIRT659088 DENR density regulated re-initiation and release factor 2 2
MIRT659199 CYBB cytochrome b-245 beta chain 2 2
MIRT659868 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660802 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT661571 EPHX2 epoxide hydrolase 2 2 2
MIRT662199 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT662607 MAGEB4 MAGE family member B4 2 2
MIRT662637 PKHD1L1 PKHD1 like 1 2 2
MIRT662839 FAM110A family with sequence similarity 110 member A 2 2
MIRT663306 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT663444 FBXO2 F-box protein 2 2 2
MIRT665258 ZMYM6 zinc finger MYM-type containing 6 2 2
MIRT668553 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT669415 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT683836 ZNF682 zinc finger protein 682 2 2
MIRT686188 ZNF594 zinc finger protein 594 2 2
MIRT691533 ZNF208 zinc finger protein 208 2 2
MIRT693957 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT700024 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT702008 MIDN midnolin 2 2
MIRT702895 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT705507 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT707381 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708634 STMN4 stathmin 4 2 2
MIRT708914 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT709171 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT709298 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT709638 C2orf91 chromosome 2 open reading frame 91 2 2
MIRT710285 CSNK1G3 casein kinase 1 gamma 3 2 2
MIRT710324 STK40 serine/threonine kinase 40 2 2
MIRT710552 PHF8 PHD finger protein 8 2 2
MIRT710723 C19orf68 zinc finger SWIM-type containing 9 2 2
MIRT711177 EMCN endomucin 2 2
MIRT711378 SKA1 spindle and kinetochore associated complex subunit 1 2 2
MIRT711414 RAB3C RAB3C, member RAS oncogene family 2 2
MIRT711697 GMPR guanosine monophosphate reductase 2 2
MIRT712135 TBC1D30 TBC1 domain family member 30 2 2
MIRT712465 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712730 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT712901 TGFA transforming growth factor alpha 2 2
MIRT712939 GALP galanin like peptide 2 2
MIRT712984 PINX1 PIN2/TERF1 interacting telomerase inhibitor 1 2 2
MIRT713387 NLN neurolysin 2 2
MIRT713549 GJB1 gap junction protein beta 1 2 2
MIRT713843 FAM3D family with sequence similarity 3 member D 2 2
MIRT713978 ASIC4 acid sensing ion channel subunit family member 4 2 2
MIRT714756 ZNF343 zinc finger protein 343 2 2
MIRT715131 ACADL acyl-CoA dehydrogenase, long chain 2 2
MIRT715226 NPVF neuropeptide VF precursor 2 2
MIRT715255 F9 coagulation factor IX 2 2
MIRT715347 VMP1 vacuole membrane protein 1 2 2
MIRT715564 EPHB4 EPH receptor B4 2 2
MIRT715842 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT715907 MFRP membrane frizzled-related protein 2 2
MIRT716017 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT716175 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716672 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT716700 HLA-B major histocompatibility complex, class I, B 2 2
MIRT717328 PGK1 phosphoglycerate kinase 1 2 2
MIRT717365 EDN2 endothelin 2 2 2
MIRT717668 THBS2 thrombospondin 2 2 2
MIRT718050 GPT2 glutamic--pyruvic transaminase 2 2 2
MIRT718078 CLIC5 chloride intracellular channel 5 2 2
MIRT718109 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT718140 PALM paralemmin 2 2
MIRT718320 TMPRSS11B transmembrane protease, serine 11B 2 2
MIRT718632 DIP2A disco interacting protein 2 homolog A 2 2
MIRT719822 LRRC4 leucine rich repeat containing 4 2 2
MIRT719961 SAMD15 sterile alpha motif domain containing 15 2 2
MIRT719981 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT720698 RNF217 ring finger protein 217 2 2
MIRT721343 LIF LIF, interleukin 6 family cytokine 2 2
MIRT721424 TRDN triadin 2 2
MIRT721611 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT721696 TFAP2B transcription factor AP-2 beta 2 2
MIRT721988 FAM214B family with sequence similarity 214 member B 2 2
MIRT722132 TTLL11 tubulin tyrosine ligase like 11 2 2
MIRT722364 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT722523 PLXNA2 plexin A2 2 2
MIRT723136 YPEL1 yippee like 1 2 2
MIRT723221 FMNL3 formin like 3 2 2
MIRT723715 PEAK1 pseudopodium enriched atypical kinase 1 2 2
MIRT723796 MUC17 mucin 17, cell surface associated 2 2
MIRT724054 FAM84A family with sequence similarity 84 member A 2 2
MIRT724181 GDF6 growth differentiation factor 6 2 2
MIRT724489 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT724524 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6845 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)

Error report submission