miRTarBase - #MIRT441441


—
pre-miRNA Information
pre-miRNA hsa-mir-4699   
Genomic Coordinates chr12: 81158388 - 81158461
Description Homo sapiens miR-4699 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4699-3p
Sequence 46| AAUUUACUCUGCAAUCUUCUCC |67
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN20804631 9 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1419816940 6 dbSNP
rs919201645 9 dbSNP
rs950685323 11 dbSNP
rs985212635 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HAVCR1   
Synonyms CD365, HAVCR, HAVCR-1, KIM-1, KIM1, TIM, TIM-1, TIM1, TIMD-1, TIMD1
Description hepatitis A virus cellular receptor 1
Transcript NM_001173393   
Other Transcripts NM_012206   
Expression
Putative miRNA Targets on HAVCR1
3'UTR of HAVCR1
(miRNA target sites are highlighted)		 
>HAVCR1|NM_001173393|3'UTR
   1 GACCCAGTGGTGCTCTTTGAGAGTTTACGCCCATGAGTGCAGAAGACTGAACAGACATCAGCACATCAGACGTCTTTTAG
  81 ACCCCAAGACAATTTTTCTGTTTCAGTTTCATCTGGCATTCCAACATGTCAGTGATACTGGGTAGAGTAACTCTCTCACT
 161 CCAAACTGTGTATAGTCAACCTCATCATTAATGTAGTCCTAATTTTTTATGCTAAAACTGGCTCAATCCTTCTGATCATT
 241 GCAGTTTTCTCTCAAATATGAACACTTTATAATTGTATGTTCTTTTTAGACCCCATAAATCCTGTATACATCAAAGAGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccUC-UUCUAA--CGUCUCAUUUAa 5'
            || :| | |  |:||||||| | 
Target 5' tcAGTGATACTGGGTAGAGTAACTc 3'
 129 - 153 126.00 -10.92
2 
miRNA  3' ccUCUUCUAAC--GUC-----UCAUUUAa 5'
            |||||| ||  |||     || | || 
Target 5' gcAGAAGACTGAACAGACATCAGCACATc 3'
 39 - 67 102.00 -6.97
3 
miRNA  3' ccuCU-UCUAA--C--GU-CUCAUUUaa 5'
             || || ||  |  || ||||: |  
Target 5' tttGAGAGTTTACGCCCATGAGTGCAga 3'
 16 - 43 83.00 -9.34
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM8725961 9 COSMIC
COSM7785849 11 COSMIC
COSM7105738 15 COSMIC
COSM8389976 27 COSMIC
COSM7618578 28 COSMIC
COSM8208238 31 COSMIC
COSM7549841 88 COSMIC
COSM9022518 98 COSMIC
COSM7920395 104 COSMIC
COSM7940885 110 COSMIC
COSM8777358 113 COSMIC
COSM7961342 115 COSMIC
COSN28758293 161 COSMIC
COSN30704088 222 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs979866131 1 dbSNP
rs772667379 4 dbSNP
rs780853400 5 dbSNP
rs373813178 10 dbSNP
rs111759551 13 dbSNP
rs1401813280 19 dbSNP
rs1415210771 21 dbSNP
rs1445638698 22 dbSNP
rs770483110 23 dbSNP
rs950729585 27 dbSNP
rs1177354352 28 dbSNP
rs137884244 29 dbSNP
rs777473215 30 dbSNP
rs1382342181 31 dbSNP
rs755774394 33 dbSNP
rs1319495904 34 dbSNP
rs145237072 35 dbSNP
rs780983817 37 dbSNP
rs1354025879 39 dbSNP
rs1201775774 43 dbSNP
rs1281889926 45 dbSNP
rs181656381 47 dbSNP
rs369159990 48 dbSNP
rs1017369783 53 dbSNP
rs1306961488 55 dbSNP
rs768944549 56 dbSNP
rs751500388 57 dbSNP
rs1298753044 60 dbSNP
rs746516163 64 dbSNP
rs766292669 66 dbSNP
rs1179256735 67 dbSNP
rs571014946 71 dbSNP
rs1165736724 72 dbSNP
rs753914129 74 dbSNP
rs1380140509 82 dbSNP
rs1157383414 83 dbSNP
rs1051537562 88 dbSNP
rs764346701 91 dbSNP
rs1190073482 92 dbSNP
rs761010730 97 dbSNP
rs1248063563 98 dbSNP
rs749667001 100 dbSNP
rs775949578 101 dbSNP
rs772581266 105 dbSNP
rs1242056598 106 dbSNP
rs1317384019 113 dbSNP
rs1300528684 116 dbSNP
rs1386238060 117 dbSNP
rs1365630502 126 dbSNP
rs1305161651 128 dbSNP
rs760055918 131 dbSNP
rs1331111296 135 dbSNP
rs774921639 139 dbSNP
rs1296679975 141 dbSNP
rs190777889 142 dbSNP
rs1364840941 149 dbSNP
rs1176024751 155 dbSNP
rs1328038575 156 dbSNP
rs775526063 158 dbSNP
rs749057166 164 dbSNP
rs1199690580 168 dbSNP
rs1487718675 170 dbSNP
rs1260607158 172 dbSNP
rs1208289483 173 dbSNP
rs1218456196 174 dbSNP
rs1486087824 180 dbSNP
rs1255304440 181 dbSNP
rs1231038560 182 dbSNP
rs546280208 187 dbSNP
rs1266783262 189 dbSNP
rs748813773 190 dbSNP
rs1452318799 196 dbSNP
rs577372715 209 dbSNP
rs1231434221 212 dbSNP
rs1472375193 220 dbSNP
rs1160400860 221 dbSNP
rs1414593172 234 dbSNP
rs752467194 238 dbSNP
rs1163125308 239 dbSNP
rs778632402 255 dbSNP
rs1343585342 256 dbSNP
rs917000959 275 dbSNP
rs983554812 277 dbSNP
rs1410001515 278 dbSNP
rs1289991168 294 dbSNP
rs1405065955 304 dbSNP
rs748965107 309 dbSNP
rs1266032159 316 dbSNP
rs554046011 320 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000522693.1 | 3UTR | UUGGUAAAUAAUUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
88 hsa-miR-4699-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056239 RAB18 RAB18, member RAS oncogene family 2 2
MIRT080536 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT095600 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT128911 KMT2A lysine methyltransferase 2A 2 2
MIRT161904 FXR1 FMR1 autosomal homolog 1 2 4
MIRT177614 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 4
MIRT231364 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 6
MIRT285164 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT307337 SEC22C SEC22 homolog C, vesicle trafficking protein 2 2
MIRT317083 DEK DEK proto-oncogene 2 2
MIRT347692 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT358438 STC2 stanniocalcin 2 2 2
MIRT362592 PURB purine rich element binding protein B 2 4
MIRT441441 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT445264 LOH12CR2 loss of heterozygosity, 12, chromosomal region 2 (non-protein coding) 2 4
MIRT447097 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT449013 ANKRD17 ankyrin repeat domain 17 2 2
MIRT450358 SETD9 SET domain containing 9 2 2
MIRT454976 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT461922 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT465191 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT467685 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468003 SKI SKI proto-oncogene 2 2
MIRT473127 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT476370 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT477067 FAM208B family with sequence similarity 208 member B 2 4
MIRT479950 CBX4 chromobox 4 2 4
MIRT481092 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT481932 ANKRD11 ankyrin repeat domain 11 2 12
MIRT482239 AHCY adenosylhomocysteinase 2 2
MIRT485804 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT492026 TWF1 twinfilin actin binding protein 1 2 2
MIRT494389 CALM3 calmodulin 3 2 2
MIRT504115 GPR158 G protein-coupled receptor 158 2 2
MIRT506346 NUP54 nucleoporin 54 2 4
MIRT510081 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 4
MIRT521019 SLC8A1 solute carrier family 8 member A1 2 2
MIRT524709 BTBD3 BTB domain containing 3 2 2
MIRT524989 AGO2 argonaute 2, RISC catalytic component 2 6
MIRT525003 ACVR1B activin A receptor type 1B 2 2
MIRT528064 OLAH oleoyl-ACP hydrolase 2 2
MIRT528865 C1orf147 chromosome 1 open reading frame 147 2 2
MIRT532182 DOCK7 dedicator of cytokinesis 7 2 2
MIRT533592 TOB1 transducer of ERBB2, 1 2 6
MIRT538835 C16orf70 chromosome 16 open reading frame 70 2 2
MIRT539488 ACVR1C activin A receptor type 1C 2 2
MIRT539542 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT542123 VENTX VENT homeobox 2 2
MIRT542993 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT543067 ATXN7L3B ataxin 7 like 3B 2 2
MIRT543370 CYB5B cytochrome b5 type B 2 2
MIRT545080 TSEN34 tRNA splicing endonuclease subunit 34 2 2
MIRT545258 TRIM36 tripartite motif containing 36 2 4
MIRT549144 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT549403 AKAP1 A-kinase anchoring protein 1 2 2
MIRT552143 MRPL34 mitochondrial ribosomal protein L34 2 2
MIRT554781 RHEBP1 RHEB pseudogene 1 2 4
MIRT555991 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556425 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT558325 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT561357 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT562240 HMGB1 high mobility group box 1 2 2
MIRT562269 GOLT1B golgi transport 1B 2 2
MIRT564020 FAM103A1 family with sequence similarity 103 member A1 2 2
MIRT564832 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT565350 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565678 SET SET nuclear proto-oncogene 2 2
MIRT576547 Txlna taxilin alpha 2 2
MIRT609358 ZNF664 zinc finger protein 664 2 2
MIRT610646 CTGF connective tissue growth factor 2 2
MIRT624681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT637118 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT639955 PRRC2B proline rich coiled-coil 2B 2 2
MIRT644051 WWC2 WW and C2 domain containing 2 2 2
MIRT650463 SLC35B1 solute carrier family 35 member B1 2 2
MIRT651094 ZNF516 zinc finger protein 516 2 2
MIRT655268 PER2 period circadian clock 2 2 2
MIRT657450 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT692248 POLR3F RNA polymerase III subunit F 2 2
MIRT695239 PBK PDZ binding kinase 2 2
MIRT696024 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 2 2
MIRT698486 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT700581 PRSS22 protease, serine 22 2 2
MIRT704540 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704723 CEP135 centrosomal protein 135 2 2
MIRT705194 BTG1 BTG anti-proliferation factor 1 2 2
MIRT710286 CSNK1G3 casein kinase 1 gamma 3 2 2
MIRT719623 TUBGCP3 tubulin gamma complex associated protein 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4699 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-4699-3p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission