pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4255 |
Genomic Coordinates | chr1: 37161563 - 37161634 |
Description | Homo sapiens miR-4255 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4255 | |||||||||||||||||||||
Sequence | 11| CAGUGUUCAGAGAUGGA |27 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | SOLiD | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PSTK | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | C10orf89 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | phosphoseryl-tRNA kinase | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_153336 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on PSTK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of PSTK (miRNA target sites are highlighted) |
>PSTK|NM_153336|3'UTR 1 GATGAACAAGTGCTTCCTCACAACTTGAAGCTTCTAGCAGAAGAACTTAACAAGCTCAAAGCAGAGTTTTTGGAAGACCT 81 AAAACAAGGAAACAAAAAATATCTGTGCTTTCAGCAAACCATTGACATACCAGATGTCATTTCTTTTTTTCATTATGAGA 161 AAGATAATATTGTACAGAAGTATTTTTCAAAGCAGCATTAAAATTTCTGAACTGCCAAAAAAAAAAAAAAAAAAAAAAAA 241 AAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | BC-3 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
CLIP-seq Support 1 for dataset GSM796040 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-3 / 4-Thiouridine |
Location of target site | ENST00000405485.1 | 3UTR | UUGGCAAACACUACAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
79 hsa-miR-4255 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT086447 | NABP1 | nucleic acid binding protein 1 | 2 | 6 | ||||||||
MIRT100423 | HSPA1B | heat shock protein family A (Hsp70) member 1B | 2 | 8 | ||||||||
MIRT105339 | SLC7A2 | solute carrier family 7 member 2 | 2 | 4 | ||||||||
MIRT107702 | CLTA | clathrin light chain A | 2 | 2 | ||||||||
MIRT173027 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | 2 | 2 | ||||||||
MIRT178507 | LCOR | ligand dependent nuclear receptor corepressor | 2 | 2 | ||||||||
MIRT178621 | HIAT1 | major facilitator superfamily domain containing 14A | 2 | 2 | ||||||||
MIRT199032 | POLI | DNA polymerase iota | 2 | 2 | ||||||||
MIRT205179 | CPS1 | carbamoyl-phosphate synthase 1 | 2 | 2 | ||||||||
MIRT209910 | CTNNB1 | catenin beta 1 | 2 | 4 | ||||||||
MIRT211675 | OTUD4 | OTU deubiquitinase 4 | 2 | 2 | ||||||||
MIRT235433 | TSEN34 | tRNA splicing endonuclease subunit 34 | 2 | 2 | ||||||||
MIRT235776 | CEBPB | CCAAT/enhancer binding protein beta | 2 | 2 | ||||||||
MIRT259577 | KLHL15 | kelch like family member 15 | 2 | 4 | ||||||||
MIRT357964 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 2 | ||||||||
MIRT404130 | ASB1 | ankyrin repeat and SOCS box containing 1 | 2 | 2 | ||||||||
MIRT405288 | ARF1 | ADP ribosylation factor 1 | 2 | 2 | ||||||||
MIRT441596 | PSTK | phosphoseryl-tRNA kinase | 2 | 2 | ||||||||
MIRT442463 | SLC25A13 | solute carrier family 25 member 13 | 2 | 2 | ||||||||
MIRT444065 | SERPINA4 | serpin family A member 4 | 2 | 2 | ||||||||
MIRT444637 | HSBP1 | heat shock factor binding protein 1 | 2 | 2 | ||||||||
MIRT445467 | TRIM13 | tripartite motif containing 13 | 2 | 2 | ||||||||
MIRT446874 | NBPF3 | NBPF member 3 | 2 | 2 | ||||||||
MIRT446907 | RGS5 | regulator of G protein signaling 5 | 2 | 2 | ||||||||
MIRT447575 | CDC14B | cell division cycle 14B | 2 | 2 | ||||||||
MIRT449966 | ZNF555 | zinc finger protein 555 | 2 | 2 | ||||||||
MIRT460773 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | 2 | 2 | ||||||||
MIRT463972 | WHSC1 | nuclear receptor binding SET domain protein 2 | 2 | 4 | ||||||||
MIRT463986 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 4 | ||||||||
MIRT464218 | VGLL4 | vestigial like family member 4 | 2 | 2 | ||||||||
MIRT465098 | TSC22D3 | TSC22 domain family member 3 | 2 | 4 | ||||||||
MIRT472797 | MTMR4 | myotubularin related protein 4 | 2 | 4 | ||||||||
MIRT473488 | MCFD2 | multiple coagulation factor deficiency 2 | 2 | 2 | ||||||||
MIRT478690 | CSRP2 | cysteine and glycine rich protein 2 | 2 | 4 | ||||||||
MIRT485064 | SUCO | SUN domain containing ossification factor | 2 | 2 | ||||||||
MIRT485459 | IVNS1ABP | influenza virus NS1A binding protein | 2 | 2 | ||||||||
MIRT486630 | TBRG1 | transforming growth factor beta regulator 1 | 2 | 2 | ||||||||
MIRT488730 | ADPRHL1 | ADP-ribosylhydrolase like 1 | 2 | 2 | ||||||||
MIRT491959 | VPS52 | VPS52, GARP complex subunit | 2 | 2 | ||||||||
MIRT492428 | RGL2 | ral guanine nucleotide dissociation stimulator like 2 | 2 | 2 | ||||||||
MIRT493062 | MTFR1 | mitochondrial fission regulator 1 | 2 | 2 | ||||||||
MIRT493071 | MTCH1 | mitochondrial carrier 1 | 2 | 2 | ||||||||
MIRT493360 | KIF5B | kinesin family member 5B | 2 | 2 | ||||||||
MIRT493831 | FRS2 | fibroblast growth factor receptor substrate 2 | 2 | 6 | ||||||||
MIRT494003 | ECT2 | epithelial cell transforming 2 | 2 | 2 | ||||||||
MIRT494314 | CDKN1B | cyclin dependent kinase inhibitor 1B | 2 | 2 | ||||||||
MIRT497477 | TOR1AIP2 | torsin 1A interacting protein 2 | 2 | 2 | ||||||||
MIRT504636 | MFSD8 | major facilitator superfamily domain containing 8 | 2 | 6 | ||||||||
MIRT509229 | KIF14 | kinesin family member 14 | 2 | 6 | ||||||||
MIRT532450 | PLGRKT | plasminogen receptor with a C-terminal lysine | 2 | 2 | ||||||||
MIRT534825 | RAB30 | RAB30, member RAS oncogene family | 2 | 2 | ||||||||
MIRT538333 | CSGALNACT1 | chondroitin sulfate N-acetylgalactosaminyltransferase 1 | 2 | 2 | ||||||||
MIRT543178 | FICD | FIC domain containing | 2 | 2 | ||||||||
MIRT545477 | TRIM37 | tripartite motif containing 37 | 2 | 2 | ||||||||
MIRT546476 | SLC17A5 | solute carrier family 17 member 5 | 2 | 2 | ||||||||
MIRT548762 | CNN3 | calponin 3 | 2 | 2 | ||||||||
MIRT552285 | CBY1 | chibby family member 1, beta catenin antagonist | 2 | 4 | ||||||||
MIRT554059 | SOCS5 | suppressor of cytokine signaling 5 | 2 | 2 | ||||||||
MIRT556636 | LAMC1 | laminin subunit gamma 1 | 2 | 2 | ||||||||
MIRT557399 | H3F3C | H3 histone family member 3C | 2 | 2 | ||||||||
MIRT563541 | RBM41 | RNA binding motif protein 41 | 2 | 2 | ||||||||
MIRT564078 | KIAA1191 | KIAA1191 | 2 | 2 | ||||||||
MIRT564709 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | 2 | 2 | ||||||||
MIRT565176 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT565495 | AZF1 | azoospermia factor 1 | 2 | 2 | ||||||||
MIRT565817 | SDCCAG3 | serologically defined colon cancer antigen 3 | 2 | 2 | ||||||||
MIRT566859 | LRRC58 | leucine rich repeat containing 58 | 2 | 2 | ||||||||
MIRT567074 | KBTBD2 | kelch repeat and BTB domain containing 2 | 2 | 2 | ||||||||
MIRT568433 | GDNF | glial cell derived neurotrophic factor | 2 | 2 | ||||||||
MIRT635098 | AKIRIN1 | akirin 1 | 2 | 2 | ||||||||
MIRT638501 | NNT | nicotinamide nucleotide transhydrogenase | 2 | 2 | ||||||||
MIRT651609 | WDFY2 | WD repeat and FYVE domain containing 2 | 2 | 2 | ||||||||
MIRT653175 | SPPL3 | signal peptide peptidase like 3 | 2 | 2 | ||||||||
MIRT653995 | SECISBP2 | SECIS binding protein 2 | 2 | 2 | ||||||||
MIRT656957 | KIAA1244 | ARFGEF family member 3 | 3 | 3 | ||||||||
MIRT683841 | ZNF682 | zinc finger protein 682 | 2 | 2 | ||||||||
MIRT685223 | POTED | POTE ankyrin domain family member D | 2 | 2 | ||||||||
MIRT716829 | PSME4 | proteasome activator subunit 4 | 2 | 2 | ||||||||
MIRT721513 | CARHSP1 | calcium regulated heat stable protein 1 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|