miRTarBase - #MIRT441597


—
pre-miRNA Information
pre-miRNA hsa-mir-4480   
Genomic Coordinates chr10: 12578753 - 12578823
Description Homo sapiens miR-4480 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4480
Sequence 44| AGCCAAGUGGAAGUUACUUUA |64
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 10 + 12578796 23291724, 27587585 MiREDiBase
A-to-I 12 10 + 12578807 23291724, 27587585 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs929437808 7 dbSNP
rs1454494557 9 dbSNP
rs1345041659 17 dbSNP
rs561601367 21 dbSNP
Putative Targets

Gene Information
Gene Symbol ABCB5   
Synonyms ABCB5alpha, ABCB5beta, EST422562
Description ATP binding cassette subfamily B member 5
Transcript NM_001163941   
Other Transcripts NM_001163942 , NM_001163993 , NM_178559   
Expression
Putative miRNA Targets on ABCB5
3'UTR of ABCB5
(miRNA target sites are highlighted)		 
>ABCB5|NM_001163941|3'UTR
   1 TGCTGTTGAGGTAGCACATATTTTGATGTTCGTGTAATGCAAAGAAGGAGTACTTAATAATTACTTGGCAAGCTTTGATC
  81 TCTTTTATTGCATATATCAATACCTAGAATCATGCTACTCAAGTACATACATGTTCTATTCACACACCATCTGACCTTCA
 161 GATTTTTAAAAGGAAGCAAAAATTTGCTTATTTCATGTAAGTGAAATAATGCTTATATCCTTCACTTTATAAAACTATTC
 241 TAGCACATTTGCTTGTAAAGCAGTTTTCTACAAGGTGAATTTATTTCCCATCAACTTCTGCTATAAAATCGGAAATATGT
 321 TTCCAGGGGGAATATTATCCAATTAACCATGTTGAAGGTTTTAGCAAAGGCAGTGTAAGATAGAGTGGGGCCTGTAGCAT
 401 TGCAGGGAGAGTGTCTTTCACTTGGAATTTTGTTTTGCAGCACATATTACAGTAGTTTTGCTAGTCCCTTTTCTCCAGAC
 481 CGTAGGGATTTCTCTCAATAAGTATTCACTATTTCTCTAAATTTTATTCTATTTTTTTGTTGAGCAGGGAATAGAAAGGA
 561 TTACGATGTAAAATTTCTGGGAGGATTAGGTAGCTATCTCCTACTTCACCAGTAAGTGAAGTGCCTCACATGAGCCATCC
 641 CAAAGATTCATTATTCCAAACCTTGGGTTTGGCAGTATAAGTCACAGGCCTACCTGTTTATGAAAACTTACTTACTTAAA
 721 ATAAGAGCTACTTTTGGGCCGGGTGCGGTGGCTCACGCCTGTAATCCCAGAACTTTGGGAGGCCGAGGAGGGCGGATCAC
 801 TTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAACACAAAAATTAGCCAATCT
 881 TGGTGGCGGGCACCTGGAATCCCAGCTACTTGGGAGGCTGAGGCAGGAGAATCATTTGAACCTAGGAGGCAGAGGTTGCA
 961 GTGAGCCGAGATCTCACCACTGCACTCCAGCCTGCGCAACAGAGCGAGACTCCATCTCAAAAAATAATAAATAAGAGCTA
1041 ATTTTATTGTGGGTGAAAATTTTTAAACGTCTTTCTCTATAATAAAATAATTTCCTTAAATTTTATATATACTTTATCAT
1121 ATATAATGTGTGAATGATTTTAAAGTTCTGTGTAAATAACAATATTGGTAAAATGAGTTACATTTTCAACTTACTTAAAT
1201 ATGTAATGTCACCTGGTGATTTTATCTTTATTCTTCAGTGTATTTTCTTCCATTTACACATTTAGCTAGCCTCCCTAAAG
1281 TGTACTCTACCAATAATTGAAATCTTGTTAAACAAAATTAAAACCATTTATATATTATGCTGCTTTCTTTAAAATGCAAA
1361 ATAAAAATAAGATTGGGGACTTGAGAATCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auUUCAUUGAAGGUGAACCga 5'
            :|||: |||:|||||||  
Target 5' gaGAGTGTCTTTCACTTGGaa 3'
 407 - 427 155.00 -22.00
2 
miRNA  3' auUUCAUUGAA-----GGUGAACCGa 5'
            :||| ||||     ::||||||| 
Target 5' agGAGT-ACTTAATAATTACTTGGCa 3'
 46 - 70 154.00 -13.80
3 
miRNA  3' auUUCAUUGAAGGUGAACCga 5'
            :| |  |  |:||||||  
Target 5' tgGAATCCCAGCTACTTGGga 3'
 895 - 915 127.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30156114 9 COSMIC
COSN30463735 11 COSMIC
COSN30155225 32 COSMIC
COSN30449623 32 COSMIC
COSN31539347 33 COSMIC
COSN30184027 48 COSMIC
COSN30123675 75 COSMIC
COSN30192734 81 COSMIC
COSN30121820 83 COSMIC
COSN30452986 84 COSMIC
COSN31604962 112 COSMIC
COSN31610269 125 COSMIC
COSN1347188 202 COSMIC
COSN20561473 366 COSMIC
COSN6875345 404 COSMIC
COSN29329843 448 COSMIC
COSN31962745 482 COSMIC
COSN21484259 483 COSMIC
COSN8789648 681 COSMIC
COSN4868571 741 COSMIC
COSN17243559 752 COSMIC
COSN7974124 757 COSMIC
COSN6875346 841 COSMIC
COSN17078572 1095 COSMIC
COSN20372106 1176 COSMIC
COSN9315615 1197 COSMIC
COSN26305364 1260 COSMIC
COSN9939392 1314 COSMIC
COSN29258585 1321 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779617009 2 dbSNP
rs748969374 3 dbSNP
rs754596539 4 dbSNP
rs1269753671 6 dbSNP
rs1047034992 9 dbSNP
rs1461691358 12 dbSNP
rs1480702661 13 dbSNP
rs778511230 14 dbSNP
rs1371112405 15 dbSNP
rs938208503 19 dbSNP
rs748103889 20 dbSNP
rs1490738831 21 dbSNP
rs376697135 22 dbSNP
rs773083608 30 dbSNP
rs746830015 32 dbSNP
rs1042404193 33 dbSNP
rs1365732539 34 dbSNP
rs1399918542 39 dbSNP
rs1276795199 40 dbSNP
rs772885348 42 dbSNP
rs770728639 48 dbSNP
rs775632145 49 dbSNP
rs763176128 51 dbSNP
rs1202911341 52 dbSNP
rs1225051209 53 dbSNP
rs1324186142 57 dbSNP
rs903945017 60 dbSNP
rs1220021058 74 dbSNP
rs1303068838 79 dbSNP
rs1212577688 85 dbSNP
rs1190977913 91 dbSNP
rs1361099017 94 dbSNP
rs1270960933 101 dbSNP
rs562123497 104 dbSNP
rs1016187289 114 dbSNP
rs1480571958 117 dbSNP
rs1403939569 119 dbSNP
rs529226655 123 dbSNP
rs1336198681 125 dbSNP
rs1470551339 130 dbSNP
rs762499792 137 dbSNP
rs963324342 141 dbSNP
rs763731854 144 dbSNP
rs1017651318 146 dbSNP
rs964196245 150 dbSNP
rs544535719 151 dbSNP
rs995997016 162 dbSNP
rs1186694147 169 dbSNP
rs562623909 172 dbSNP
rs1450973871 174 dbSNP
rs185005502 178 dbSNP
rs530367631 186 dbSNP
rs1182463874 197 dbSNP
rs1461426796 198 dbSNP
rs955350744 211 dbSNP
rs1202406601 212 dbSNP
rs1029268334 213 dbSNP
rs954464812 217 dbSNP
rs1230836764 227 dbSNP
rs987641580 232 dbSNP
rs982440852 236 dbSNP
rs967018476 237 dbSNP
rs751144657 241 dbSNP
rs1296932267 242 dbSNP
rs1442143315 245 dbSNP
rs1355435916 256 dbSNP
rs908168400 262 dbSNP
rs753662823 265 dbSNP
rs962376624 268 dbSNP
rs756915608 273 dbSNP
rs1162614675 275 dbSNP
rs1407012557 278 dbSNP
rs569093487 280 dbSNP
rs767166741 285 dbSNP
rs750261001 293 dbSNP
rs1055949643 299 dbSNP
rs757133433 301 dbSNP
rs1276469460 305 dbSNP
rs926414339 311 dbSNP
rs917424469 312 dbSNP
rs950134056 325 dbSNP
rs1047596404 326 dbSNP
rs1228303126 329 dbSNP
rs189467333 330 dbSNP
rs368812636 339 dbSNP
rs1056664767 343 dbSNP
rs1323526506 345 dbSNP
rs1341420416 347 dbSNP
rs1243616614 359 dbSNP
rs373030334 363 dbSNP
rs918156972 364 dbSNP
rs945689280 365 dbSNP
rs540563616 366 dbSNP
rs1403491789 370 dbSNP
rs903830430 376 dbSNP
rs1365392310 379 dbSNP
rs1000835299 380 dbSNP
rs560447474 382 dbSNP
rs900612857 390 dbSNP
rs1038408616 392 dbSNP
rs1446045442 396 dbSNP
rs1418371826 401 dbSNP
rs997075779 403 dbSNP
rs1412616359 407 dbSNP
rs780085757 421 dbSNP
rs1489788057 433 dbSNP
rs1193331101 441 dbSNP
rs1267942601 445 dbSNP
rs1029535612 448 dbSNP
rs996116500 452 dbSNP
rs1258975645 453 dbSNP
rs1238401042 454 dbSNP
rs180978142 456 dbSNP
rs1290725135 462 dbSNP
rs1222281059 473 dbSNP
rs1345223260 479 dbSNP
rs566294742 482 dbSNP
rs531960949 483 dbSNP
rs1163447235 488 dbSNP
rs1386257640 499 dbSNP
rs1015530609 504 dbSNP
rs1427024826 506 dbSNP
rs1452392422 518 dbSNP
rs1388795578 519 dbSNP
rs962349814 520 dbSNP
rs1008609970 528 dbSNP
rs1020449408 532 dbSNP
rs973759579 532 dbSNP
rs1033836158 534 dbSNP
rs745454938 540 dbSNP
rs184930142 543 dbSNP
rs959187997 545 dbSNP
rs978382466 546 dbSNP
rs992735101 550 dbSNP
rs1486224152 552 dbSNP
rs1338716495 558 dbSNP
rs918054407 560 dbSNP
rs189691870 565 dbSNP
rs182002068 566 dbSNP
rs917390567 568 dbSNP
rs1292970588 569 dbSNP
rs567298629 580 dbSNP
rs1258709056 585 dbSNP
rs1365236628 591 dbSNP
rs186188564 595 dbSNP
rs1205304882 598 dbSNP
rs1468112484 603 dbSNP
rs1405242496 610 dbSNP
rs936661714 611 dbSNP
rs1467364234 612 dbSNP
rs778009086 621 dbSNP
rs557672541 630 dbSNP
rs1459539018 633 dbSNP
rs1249905047 637 dbSNP
rs900580574 639 dbSNP
rs933379320 640 dbSNP
rs569429801 651 dbSNP
rs1460974480 655 dbSNP
rs771209139 657 dbSNP
rs757997869 665 dbSNP
rs1004065532 667 dbSNP
rs776822774 668 dbSNP
rs1337800233 672 dbSNP
rs540111885 675 dbSNP
rs1226155108 676 dbSNP
rs558400817 678 dbSNP
rs1244345085 687 dbSNP
rs899848788 689 dbSNP
rs1449825494 691 dbSNP
rs995164649 694 dbSNP
rs931853519 696 dbSNP
rs1050776942 699 dbSNP
rs532249075 699 dbSNP
rs1033392503 700 dbSNP
rs535584317 702 dbSNP
rs1020142361 706 dbSNP
rs902921055 708 dbSNP
rs1363529155 709 dbSNP
rs1238147002 712 dbSNP
rs1454515414 713 dbSNP
rs959301381 720 dbSNP
rs1436581859 723 dbSNP
rs746285478 729 dbSNP
rs1404176220 740 dbSNP
rs141089246 741 dbSNP
rs770180176 742 dbSNP
rs1025158758 748 dbSNP
rs776035685 753 dbSNP
rs190602322 755 dbSNP
rs779488519 757 dbSNP
rs1383492039 758 dbSNP
rs936962332 764 dbSNP
rs1032610668 766 dbSNP
rs1328169201 768 dbSNP
rs13228201 775 dbSNP
rs574013272 776 dbSNP
rs1372223506 778 dbSNP
rs1301471161 782 dbSNP
rs1334895001 785 dbSNP
rs1424298100 786 dbSNP
rs991715501 789 dbSNP
rs921920034 791 dbSNP
rs544257075 792 dbSNP
rs1414539185 794 dbSNP
rs1165086303 795 dbSNP
rs1468718262 802 dbSNP
rs1363721753 804 dbSNP
rs1484230493 805 dbSNP
rs933328158 806 dbSNP
rs1051831727 814 dbSNP
rs562870795 817 dbSNP
rs939824531 818 dbSNP
rs1289901152 823 dbSNP
rs773871763 836 dbSNP
rs983337318 839 dbSNP
rs1287615751 842 dbSNP
rs577530197 846 dbSNP
rs1352055971 848 dbSNP
rs767236030 849 dbSNP
rs1034023495 851 dbSNP
rs941399689 854 dbSNP
rs1250264716 870 dbSNP
rs894782052 878 dbSNP
rs1325852180 883 dbSNP
rs1420123164 884 dbSNP
rs143451572 888 dbSNP
rs760572414 889 dbSNP
rs1024713428 890 dbSNP
rs12112555 898 dbSNP
rs376711277 911 dbSNP
rs911783809 918 dbSNP
rs1246924631 942 dbSNP
rs1200601392 944 dbSNP
rs1444758520 945 dbSNP
rs944661477 950 dbSNP
rs753765075 955 dbSNP
rs1408329186 958 dbSNP
rs1218419405 959 dbSNP
rs958205773 961 dbSNP
rs974992011 964 dbSNP
rs1467534329 968 dbSNP
rs922193648 969 dbSNP
rs1054135294 976 dbSNP
rs527478047 978 dbSNP
rs1459235905 981 dbSNP
rs1404522123 984 dbSNP
rs954713167 986 dbSNP
rs987907340 988 dbSNP
rs188321562 989 dbSNP
rs940796078 994 dbSNP
rs191015629 996 dbSNP
rs531368173 997 dbSNP
rs919725261 1001 dbSNP
rs777954042 1003 dbSNP
rs1012985184 1005 dbSNP
rs1055027894 1006 dbSNP
rs1283378886 1007 dbSNP
rs1313372472 1008 dbSNP
rs1241159395 1015 dbSNP
rs140253766 1016 dbSNP
rs571189181 1021 dbSNP
rs972033871 1029 dbSNP
rs1004483697 1032 dbSNP
rs1341744459 1033 dbSNP
rs749611234 1037 dbSNP
rs1376966626 1048 dbSNP
rs1298689505 1051 dbSNP
rs540146590 1052 dbSNP
rs962875280 1053 dbSNP
rs552056477 1066 dbSNP
rs373610561 1069 dbSNP
rs1046526662 1070 dbSNP
rs1267165260 1081 dbSNP
rs1168788696 1090 dbSNP
rs954182673 1094 dbSNP
rs987186050 1097 dbSNP
rs1168876782 1104 dbSNP
rs912580604 1108 dbSNP
rs1382875211 1110 dbSNP
rs902188777 1111 dbSNP
rs1315483651 1113 dbSNP
rs1200335043 1115 dbSNP
rs999196200 1118 dbSNP
rs1482645396 1119 dbSNP
rs1431551854 1124 dbSNP
rs150442227 1131 dbSNP
rs555857965 1132 dbSNP
rs1169812507 1133 dbSNP
rs1357313029 1138 dbSNP
rs1312099322 1139 dbSNP
rs374664463 1140 dbSNP
rs1229332885 1149 dbSNP
rs1381954046 1149 dbSNP
rs1297031344 1151 dbSNP
rs958174395 1163 dbSNP
rs924407820 1175 dbSNP
rs574071962 1176 dbSNP
rs1308205809 1182 dbSNP
rs1431282391 1184 dbSNP
rs1054246651 1185 dbSNP
rs1163480344 1186 dbSNP
rs1423950726 1189 dbSNP
rs138210219 1191 dbSNP
rs1363415855 1197 dbSNP
rs142367245 1208 dbSNP
rs1472129864 1213 dbSNP
rs770129650 1214 dbSNP
rs987488687 1221 dbSNP
rs1207514055 1222 dbSNP
rs907837843 1234 dbSNP
rs1045782367 1236 dbSNP
rs3210441 1241 dbSNP
rs973457267 1242 dbSNP
rs1305458890 1247 dbSNP
rs920696135 1250 dbSNP
rs1308633698 1255 dbSNP
rs1290601425 1256 dbSNP
rs1411216855 1258 dbSNP
rs1231197657 1261 dbSNP
rs1292657120 1263 dbSNP
rs1290061623 1266 dbSNP
rs931142712 1268 dbSNP
rs1156800937 1269 dbSNP
rs1490269881 1270 dbSNP
rs1223688134 1271 dbSNP
rs1271398031 1274 dbSNP
rs1412359226 1278 dbSNP
rs1015853036 1286 dbSNP
rs146328292 1289 dbSNP
rs962991366 1290 dbSNP
rs995660101 1292 dbSNP
rs1489475072 1294 dbSNP
rs1429058859 1295 dbSNP
rs560002430 1301 dbSNP
rs1028517722 1304 dbSNP
rs139006523 1307 dbSNP
rs1330445045 1308 dbSNP
rs1270642435 1311 dbSNP
rs1222067161 1313 dbSNP
rs954244168 1314 dbSNP
rs1300141116 1316 dbSNP
rs1170334880 1320 dbSNP
rs1387015195 1325 dbSNP
rs568156520 1326 dbSNP
rs1456302181 1327 dbSNP
rs1161333683 1328 dbSNP
rs966717 1339 dbSNP
rs1376874026 1341 dbSNP
rs1303508881 1343 dbSNP
rs949287232 1345 dbSNP
rs966738596 1353 dbSNP
rs552626235 1365 dbSNP
rs978101630 1365 dbSNP
rs1351296503 1373 dbSNP
rs1246202836 1374 dbSNP
rs1187993875 1381 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions EF3D-AGO2 , LCL-BAC
Disease MIMAT0019014
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020021. RNA binding protein: AGO2. Condition:EBV B95-8-infected "PAR-CLIP data was present in GSM1020023. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1020021
Method / RBP PAR-CLIP / AGO2
Cell line / Condition EF3D-AGO2 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000404938.2 | 3UTR | UUGGCAAGCUUUGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1020023
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000404938.2 | 3UTR | UUGGCAAGCUUUGAUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000404938.2 | 3UTR | UUGGCAAGCUUUGAUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000404938.2 | 3UTR | UUGGCAAGCUUUGAUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000404938.2 | 3UTR | UUGGCAAGCUUUGAUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
117 hsa-miR-4480 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056040 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT091259 FXR1 FMR1 autosomal homolog 1 2 4
MIRT117347 MAPRE2 microtubule associated protein RP/EB family member 2 2 2
MIRT234960 ZNF439 zinc finger protein 439 2 4
MIRT441356 ZNF75A zinc finger protein 75a 2 2
MIRT441426 STXBP2 syntaxin binding protein 2 2 2
MIRT441455 ZNF488 zinc finger protein 488 2 4
MIRT441524 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT441576 EXOC5 exocyst complex component 5 2 2
MIRT441597 ABCB5 ATP binding cassette subfamily B member 5 2 6
MIRT441610 ATP13A4 ATPase 13A4 2 2
MIRT441698 CIT citron rho-interacting serine/threonine kinase 2 2
MIRT441714 FGF9 fibroblast growth factor 9 2 2
MIRT441784 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT441795 EXOSC2 exosome component 2 2 2
MIRT441868 RNASEL ribonuclease L 2 2
MIRT441900 SLC9A8 solute carrier family 9 member A8 2 6
MIRT441919 FAM217B family with sequence similarity 217 member B 2 2
MIRT441928 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT441938 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT442157 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT442172 AZF1 azoospermia factor 1 2 2
MIRT442208 IRS1 insulin receptor substrate 1 2 2
MIRT442237 DDX19A DEAD-box helicase 19A 2 2
MIRT442366 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT442572 SDC1 syndecan 1 2 2
MIRT442604 ZNF391 zinc finger protein 391 2 2
MIRT442609 MRC1 mannose receptor C-type 1 2 2
MIRT442647 POP4 POP4 homolog, ribonuclease P/MRP subunit 2 2
MIRT442658 OIP5 Opa interacting protein 5 2 6
MIRT442686 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT442773 JAG1 jagged 1 2 2
MIRT442785 CHD8 chromodomain helicase DNA binding protein 8 2 2
MIRT442895 PLCB3 phospholipase C beta 3 2 2
MIRT442941 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT442959 SGCD sarcoglycan delta 2 2
MIRT442998 EDAR ectodysplasin A receptor 2 2
MIRT443017 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT443064 CASP5 caspase 5 2 2
MIRT443069 ABLIM1 actin binding LIM protein 1 2 2
MIRT443208 VPS36 vacuolar protein sorting 36 homolog 2 2
MIRT443237 ANKRD26 ankyrin repeat domain 26 2 2
MIRT443253 A1CF APOBEC1 complementation factor 2 2
MIRT443329 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT443333 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT443349 STX7 syntaxin 7 2 2
MIRT443452 CLIC5 chloride intracellular channel 5 2 2
MIRT443547 GPR35 G protein-coupled receptor 35 2 2
MIRT443616 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT443626 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT443730 ALPK3 alpha kinase 3 2 2
MIRT443786 ST13 ST13, Hsp70 interacting protein 2 2
MIRT443852 RGS6 regulator of G protein signaling 6 2 2
MIRT445483 KLF5 Kruppel like factor 5 2 2
MIRT471105 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT472329 NETO2 neuropilin and tolloid like 2 2 4
MIRT472391 NDRG3 NDRG family member 3 2 2
MIRT473522 MAX MYC associated factor X 2 2
MIRT473874 MAFK MAF bZIP transcription factor K 2 6
MIRT476021 GTF2A1 general transcription factor IIA subunit 1 2 2
MIRT478320 DDN dendrin 2 2
MIRT492049 TNFSF9 TNF superfamily member 9 2 2
MIRT494851 ANKRD24 ankyrin repeat domain 24 2 2
MIRT494991 TSSC1 EARP complex and GARP complex interacting protein 1 2 2
MIRT495034 RASSF2 Ras association domain family member 2 2 2
MIRT495111 NOL10 nucleolar protein 10 2 2
MIRT495113 TRADD TNFRSF1A associated via death domain 2 2
MIRT495131 METTL24 methyltransferase like 24 2 2
MIRT495147 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT495297 NUP54 nucleoporin 54 2 2
MIRT495341 RTN2 reticulon 2 2 2
MIRT495347 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT496682 DUSP18 dual specificity phosphatase 18 2 2
MIRT496743 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT496841 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT496852 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 2
MIRT496889 FOXP1 forkhead box P1 2 2
MIRT496922 CLMN calmin 2 2
MIRT496990 TMEM231 transmembrane protein 231 2 2
MIRT497002 SNAP25 synaptosome associated protein 25 2 2
MIRT497058 C6orf223 chromosome 6 open reading frame 223 2 2
MIRT500529 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 6
MIRT506048 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT512163 CD164 CD164 molecule 2 6
MIRT527051 RDH13 retinol dehydrogenase 13 2 2
MIRT532282 TNFSF14 TNF superfamily member 14 2 2
MIRT534083 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT534605 RNASEH1 ribonuclease H1 2 4
MIRT539509 ACSS3 acyl-CoA synthetase short chain family member 3 2 2
MIRT543069 ARID4B AT-rich interaction domain 4B 2 2
MIRT544233 CCBL2 kynurenine aminotransferase 3 2 2
MIRT544686 ZNF224 zinc finger protein 224 2 4
MIRT546269 TMEM30A transmembrane protein 30A 2 4
MIRT559069 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT562768 RMI2 RecQ mediated genome instability 2 2 2
MIRT563974 HCFC1 host cell factor C1 2 2
MIRT564086 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564525 PDXP pyridoxal phosphatase 2 2
MIRT564613 ZNF703 zinc finger protein 703 2 2
MIRT566252 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT614420 ZNF440 zinc finger protein 440 2 2
MIRT618789 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT619160 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT641778 ZDHHC7 zinc finger DHHC-type containing 7 2 4
MIRT653680 SLC25A36 solute carrier family 25 member 36 2 2
MIRT657861 GJD2 gap junction protein delta 2 2 2
MIRT660879 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT668781 DAAM1 dishevelled associated activator of morphogenesis 1 2 4
MIRT688559 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT695393 WDR41 WD repeat domain 41 2 2
MIRT698680 TCEA1 transcription elongation factor A1 2 2
MIRT700974 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT705055 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705864 AFF1 AF4/FMR2 family member 1 2 2
MIRT710586 CDCA4 cell division cycle associated 4 2 2
MIRT713904 IGF2R insulin like growth factor 2 receptor 2 2
MIRT717133 SKI SKI proto-oncogene 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4480 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-4480 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)

Error report submission