miRTarBase - #MIRT441708


—
pre-miRNA Information
pre-miRNA hsa-mir-4786   
Genomic Coordinates chr2: 239943015 - 239943094
Description Homo sapiens miR-4786 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4786-3p
Sequence 51| UGAAGCCAGCUCUGGUCUGGGC |72
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs765116255 2 dbSNP
rs982109365 6 dbSNP
rs949249229 7 dbSNP
rs759383793 8 dbSNP
rs990649205 9 dbSNP
rs1389629709 14 dbSNP
rs975346189 18 dbSNP
rs188625223 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RP1L1   
Synonyms DCDC4B
Description RP1 like 1
Transcript NM_178857   
Expression
Putative miRNA Targets on RP1L1
3'UTR of RP1L1
(miRNA target sites are highlighted)		 
>RP1L1|NM_178857|3'UTR
   1 ACAAGATCAAGCTAGAAAACAATCACGAGCTTGGGAGCTCTGTTTTTATTCATATTTTTTCTACAAAACTGAGCAACGTT
  81 CAGTCCACTGGAGATGTCCATAGTACATGGACAAAGACCAAGGACTTGCCAAGGACACAGCCCATGCCATGCTGTCCTGG
 161 GACTCTTAAGTCCAGAAGTGTCAGAGAGCTCTGCGGCCCGTCCCACACGCAGTGTGAAGAAAGGGGGTGTCTGCGGATCT
 241 GCCCGGTTATCGGAGGTCAGCCCGGCTCCTATTTATTTGTCTGCAGAGCCCGAAAGATGGAACTGATTGGAAAGGCTCCA
 321 GTTTAGCTTTTGTTTGTGGGTTTGTTTTCTGCTAGCAAGTGTTGCTCTCTGTCTTTTCCCTGTTGATCTCCTGTTACTTT
 401 TCTCCTTGGCTTCTGTTGGCACTCACCTCATTTGACTTTGAGGTGCTTTTTTTCTAGTCTTGAATATATTTGATGACTCT
 481 GCAGAAATACTTGGGCAAAGCAGGTAACTTCAGAGTCATTGGATAAAGTTTGTTCTCAACTCCAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgggucuggucucGACCGAAGu 5'
                       :||||||| 
Target 5' gttacttttctccTTGGCTTCt 3'
 393 - 414 141.00 -10.90
2 
miRNA  3' cgggUCUGGUCUC-GACCGAAGu 5'
              ||:|:  || :| ||||: 
Target 5' ggaaAGGCTCCAGTTTAGCTTTt 3'
 309 - 331 106.00 -9.40
3 
miRNA  3' cgggucUGGUCUCGACCGAAGu 5'
                |||  | :|| |||: 
Target 5' gcactcACCTCATTTGACTTTg 3'
 419 - 440 104.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
361202 28 ClinVar
361201 38 ClinVar
361200 98 ClinVar
361199 99 ClinVar
908079 122 ClinVar
908078 191 ClinVar
361198 199 ClinVar
361197 200 ClinVar
361196 226 ClinVar
361195 244 ClinVar
908077 256 ClinVar
361194 265 ClinVar
361193 266 ClinVar
912086 291 ClinVar
361192 307 ClinVar
361191 330 ClinVar
912085 332 ClinVar
361190 335 ClinVar
361189 356 ClinVar
912084 367 ClinVar
910865 441 ClinVar
361188 444 ClinVar
361187 461 ClinVar
361186 495 ClinVar
361185 513 ClinVar
COSN21519373 5 COSMIC
COSN30543743 35 COSMIC
COSN31597763 40 COSMIC
COSN30494851 47 COSMIC
COSN26993090 54 COSMIC
COSN30494477 60 COSMIC
COSN28739320 71 COSMIC
COSN19614908 98 COSMIC
COSN31594498 112 COSMIC
COSN32063270 266 COSMIC
COSN28196202 292 COSMIC
COSN19514550 537 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763461501 1 dbSNP
rs776010302 2 dbSNP
rs1249113251 4 dbSNP
rs746478698 5 dbSNP
rs1458718056 6 dbSNP
rs1238213311 10 dbSNP
rs1212707559 11 dbSNP
rs772891137 12 dbSNP
rs771671808 14 dbSNP
rs1275330520 16 dbSNP
rs747957828 20 dbSNP
rs778619755 22 dbSNP
rs754873607 24 dbSNP
rs191360259 26 dbSNP
rs779838260 27 dbSNP
rs143284016 28 dbSNP
rs756271252 29 dbSNP
rs1393234697 30 dbSNP
rs750503655 33 dbSNP
rs1453518193 34 dbSNP
rs1378782012 35 dbSNP
rs1161007262 37 dbSNP
rs374533327 38 dbSNP
rs757508423 41 dbSNP
rs1197624154 42 dbSNP
rs751988065 47 dbSNP
rs1333815726 48 dbSNP
rs764487355 49 dbSNP
rs371202240 51 dbSNP
rs954431720 52 dbSNP
rs756678748 53 dbSNP
rs951699476 54 dbSNP
rs1428025888 56 dbSNP
rs567659079 69 dbSNP
rs974540081 71 dbSNP
rs1340418575 74 dbSNP
rs767108680 77 dbSNP
rs550736333 78 dbSNP
rs768625942 81 dbSNP
rs1209398635 82 dbSNP
rs1285197901 83 dbSNP
rs1448860852 91 dbSNP
rs993260517 92 dbSNP
rs1213688774 93 dbSNP
rs12542104 98 dbSNP
rs886062573 99 dbSNP
rs565405970 101 dbSNP
rs1024458546 102 dbSNP
rs1475465911 103 dbSNP
rs1189812868 104 dbSNP
rs751532278 108 dbSNP
rs894293456 119 dbSNP
rs773233721 121 dbSNP
rs551888547 122 dbSNP
rs1158845895 123 dbSNP
rs1005508504 128 dbSNP
rs563079315 129 dbSNP
rs935883693 131 dbSNP
rs950964409 133 dbSNP
rs879801092 134 dbSNP
rs1360479786 135 dbSNP
rs1415876524 136 dbSNP
rs1315190502 141 dbSNP
rs528712101 142 dbSNP
rs1244487357 145 dbSNP
rs903879409 146 dbSNP
rs1353062142 147 dbSNP
rs1042338627 150 dbSNP
rs1285325698 160 dbSNP
rs945364604 161 dbSNP
rs923380064 170 dbSNP
rs1040855634 173 dbSNP
rs1441683068 176 dbSNP
rs895340456 182 dbSNP
rs943583839 186 dbSNP
rs1182221564 194 dbSNP
rs1055615324 195 dbSNP
rs1441627346 196 dbSNP
rs910676729 197 dbSNP
rs12542075 199 dbSNP
rs544642796 200 dbSNP
rs952246320 202 dbSNP
rs919496727 205 dbSNP
rs149378435 208 dbSNP
rs1395837061 209 dbSNP
rs971748071 212 dbSNP
rs564006223 214 dbSNP
rs1392257805 219 dbSNP
rs1337767534 223 dbSNP
rs533253516 224 dbSNP
rs12547192 226 dbSNP
rs1422400381 227 dbSNP
rs933134431 232 dbSNP
rs1386752141 235 dbSNP
rs1013049039 240 dbSNP
rs12542071 244 dbSNP
rs544678121 245 dbSNP
rs138768427 251 dbSNP
rs1000080253 252 dbSNP
rs1183912119 252 dbSNP
rs1438129091 255 dbSNP
rs903135373 256 dbSNP
rs1041597338 260 dbSNP
rs1168857504 262 dbSNP
rs552849663 263 dbSNP
rs145010029 264 dbSNP
rs567494148 265 dbSNP
rs557198895 266 dbSNP
rs1227987649 279 dbSNP
rs141246100 279 dbSNP
rs1033860411 281 dbSNP
rs1040468623 284 dbSNP
rs903954324 289 dbSNP
rs943409150 291 dbSNP
rs1191218740 300 dbSNP
rs1265973495 303 dbSNP
rs1428589720 303 dbSNP
rs146542491 307 dbSNP
rs1375266596 308 dbSNP
rs1477070490 310 dbSNP
rs1170362830 313 dbSNP
rs551925630 315 dbSNP
rs528555716 318 dbSNP
rs1049287107 321 dbSNP
rs60196627 330 dbSNP
rs145601298 332 dbSNP
rs1390198594 334 dbSNP
rs58309857 335 dbSNP
rs1297683322 336 dbSNP
rs1323881959 347 dbSNP
rs140390217 349 dbSNP
rs377333492 353 dbSNP
rs79353166 356 dbSNP
rs186479019 371 dbSNP
rs1038888175 373 dbSNP
rs113097150 378 dbSNP
rs760847885 379 dbSNP
rs958669070 380 dbSNP
rs1264480462 383 dbSNP
rs1472859300 394 dbSNP
rs908950555 406 dbSNP
rs1487567675 413 dbSNP
rs1032746839 414 dbSNP
rs1476389971 416 dbSNP
rs574075465 422 dbSNP
rs1196998105 436 dbSNP
rs1368097107 440 dbSNP
rs1481332511 443 dbSNP
rs530449457 444 dbSNP
rs555695983 445 dbSNP
rs1358560854 446 dbSNP
rs1313402765 447 dbSNP
rs1399246654 447 dbSNP
rs772115337 458 dbSNP
rs928954042 460 dbSNP
rs7816990 461 dbSNP
rs1311620169 466 dbSNP
rs1317098636 479 dbSNP
rs1286474162 486 dbSNP
rs544710613 487 dbSNP
rs992376523 488 dbSNP
rs886062572 495 dbSNP
rs1258374999 497 dbSNP
rs779467225 498 dbSNP
rs901845764 504 dbSNP
rs572460344 511 dbSNP
rs181865746 513 dbSNP
rs1180436406 517 dbSNP
rs1007545543 525 dbSNP
rs1255759929 528 dbSNP
rs1419831951 531 dbSNP
rs553028484 532 dbSNP
rs889224056 537 dbSNP
rs1049172595 541 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgggucuggucucGACCGAAGu 5'
                       :||||||| 
Target 5' -------------UUGGCUUCu 3'
 		1 - 9
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000382483.3 | 3UTR | UUGGCUUCUGUUGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000382483.3 | 3UTR | UUGGCUUCUGUUGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
91 hsa-miR-4786-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055412 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT219055 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT247423 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT301990 NUP50 nucleoporin 50 2 4
MIRT344711 ZNF207 zinc finger protein 207 2 2
MIRT409792 FOXO3 forkhead box O3 2 2
MIRT441666 SEPT3 septin 3 2 2
MIRT441708 RP1L1 RP1 like 1 2 2
MIRT441843 SYT11 synaptotagmin 11 2 2
MIRT441862 TEX35 testis expressed 35 2 2
MIRT441872 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT442363 ZC3H12C zinc finger CCCH-type containing 12C 2 2
MIRT442588 HOXD9 homeobox D9 2 2
MIRT442891 RHCG Rh family C glycoprotein 2 2
MIRT443100 RNF20 ring finger protein 20 2 2
MIRT443238 ANKRD26 ankyrin repeat domain 26 2 2
MIRT443611 OR2D2 olfactory receptor family 2 subfamily D member 2 2 2
MIRT443637 ELP6 elongator acetyltransferase complex subunit 6 2 2
MIRT449298 SMIM19 small integral membrane protein 19 2 2
MIRT449581 ZNF510 zinc finger protein 510 2 2
MIRT450699 RORA RAR related orphan receptor A 2 2
MIRT455269 DDX39B DExD-box helicase 39B 2 10
MIRT456608 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT461509 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT461710 ZNF426 zinc finger protein 426 2 2
MIRT463760 YPEL2 yippee like 2 2 2
MIRT465221 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT466648 TAGLN2 transgelin 2 2 2
MIRT473046 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT473184 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 4
MIRT478996 COLGALT1 collagen beta(1-O)galactosyltransferase 1 2 2
MIRT479650 CD4 CD4 molecule 2 2
MIRT480329 C5orf51 chromosome 5 open reading frame 51 2 2
MIRT484162 FAM71B family with sequence similarity 71 member B 2 2
MIRT487586 FAM83H family with sequence similarity 83 member H 2 2
MIRT487598 NKD2 naked cuticle homolog 2 2 4
MIRT494852 ANKRD24 ankyrin repeat domain 24 2 2
MIRT494931 TMEM167A transmembrane protein 167A 2 2
MIRT495227 SIK2 salt inducible kinase 2 2 4
MIRT496088 C17orf85 nuclear cap binding subunit 3 2 2
MIRT496172 RPL35A ribosomal protein L35a 2 4
MIRT496729 GPR180 G protein-coupled receptor 180 2 2
MIRT496786 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT496844 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT497924 BTG1 BTG anti-proliferation factor 1 2 2
MIRT512249 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT513269 SCUBE1 signal peptide, CUB domain and EGF like domain containing 1 2 4
MIRT525310 FANCA Fanconi anemia complementation group A 2 4
MIRT525805 SOD2 superoxide dismutase 2 2 2
MIRT526178 HEPH hephaestin 2 2
MIRT530555 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT531431 MPZL3 myelin protein zero like 3 2 2
MIRT531715 TARS threonyl-tRNA synthetase 2 2
MIRT531812 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT536185 MAOB monoamine oxidase B 2 2
MIRT541015 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT544685 ZNF224 zinc finger protein 224 2 4
MIRT560194 CACNG7 calcium voltage-gated channel auxiliary subunit gamma 7 2 2
MIRT560214 SLC7A1 solute carrier family 7 member 1 2 2
MIRT560703 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT561023 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT562249 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT566256 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT610519 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT611255 EHD3 EH domain containing 3 2 2
MIRT625352 MGLL monoglyceride lipase 2 2
MIRT633625 R3HDM2 R3H domain containing 2 2 2
MIRT633638 CASC5 kinetochore scaffold 1 2 2
MIRT643514 CCDC115 coiled-coil domain containing 115 2 2
MIRT647629 PELI3 pellino E3 ubiquitin protein ligase family member 3 2 2
MIRT651218 ZNF225 zinc finger protein 225 2 2
MIRT656738 LMBR1L limb development membrane protein 1 like 2 2
MIRT658055 FSD1L fibronectin type III and SPRY domain containing 1 like 2 2
MIRT662937 PSMB2 proteasome subunit beta 2 2 2
MIRT666735 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT667491 MACROD2 MACRO domain containing 2 2 2
MIRT668131 GJD2 gap junction protein delta 2 2 2
MIRT671644 FBXO36 F-box protein 36 2 2
MIRT674924 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT704425 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT709712 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT710068 UBL4A ubiquitin like 4A 2 2
MIRT716227 DGKI diacylglycerol kinase iota 2 2
MIRT716265 TOM1 target of myb1 membrane trafficking protein 2 2
MIRT719906 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT720888 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT721388 ATP13A4 ATPase 13A4 2 2
MIRT721938 LGR4 leucine rich repeat containing G protein-coupled receptor 4 2 2
MIRT722947 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 2
MIRT724745 ZNF391 zinc finger protein 391 2 2
MIRT724761 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4786 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4786-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4786-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CP20)
hsa-miR-4786-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (CAL-27, HSC3, SCC-25, HOK, SCC-9)
hsa-miR-4786-3p Fluorouracil 3385 NSC19893 approved resistant Low Oral Cancer cell line (CAL-27, HSC3, SCC-25, HOK, SCC-9)
hsa-miR-4786-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-4786-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4786-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4786-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-4786-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4786-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4786-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-4786-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)

Error report submission