miRTarBase - #MIRT441804


—
pre-miRNA Information
pre-miRNA hsa-mir-4753   
Genomic Coordinates chr1: 235190034 - 235190116
Description Homo sapiens miR-4753 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4753-5p
Sequence 10| CAAGGCCAAAGGAAGAGAACAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547986869 3 dbSNP
rs1007787337 7 dbSNP
rs1224263160 12 dbSNP
rs1256249071 13 dbSNP
rs1484015538 14 dbSNP
rs535678819 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NOC3L   
Synonyms AD24, C10orf117, FAD24
Description NOC3 like DNA replication regulator
Transcript NM_022451   
Expression
Putative miRNA Targets on NOC3L
3'UTR of NOC3L
(miRNA target sites are highlighted)		 
>NOC3L|NM_022451|3'UTR
   1 TAGAGGAATGAAGTCAGTGGACTTTCTTGTATATTTGTGTGTGCAGATGTACATAAAGATGAGTTGTTAACTTAGGATCT
  81 TTTCTTTTTATACAAGGAAAGCTTCCTAAGAATGTCTAGGAAGAAGAGGAAGAATGACCCTTTGCATGGCACAGGGTTCT
 161 GCCCCTATTCTGAATATGTCATTCCATCAAGGAGATCAAAAGCCTTTTTTTCTCCCCAGTATTTGGAAATTACTTTCTTG
 241 ATGATGCTGCCTTTTAAAAGCTTCACGTACATTATAGTTTTTTAAAAAAATCTTTGGACTGGATCTTACTGAAGTGCAGT
 321 TGCTATATTAAAATTAGGGCATAGAGCACAGAAAAATCAAGACCATGAGAAGACATTTTACCATTTAGCTACTTTTTATA
 401 ACTAAATACTCTTTAAATATTTTTATTTCAATACTGTGGATGGAAATGAGAAGCATTCTAAATTTGAGTTAATATATTTT
 481 TATGAAGATATTTGAGAAAAGAAAAAAATAGCTTGTATTCAGGTTCATTGGCTTTTGCTGGATGATCCACCTAAAGAAGT
 561 TACCTAATTTGGCCTTTTAAAAAAGGTGTTAGTGTTTATTATAGCTACTTTCAAGGAAAGTTTGAATATGATTCTAGTCT
 641 CTAAAGTTCTTCACGTTTTCTGACATTCCCTGGAGGGTGACTGGGGAAGAATTGCTCCAGGGTAGAAGAACCAGGCCCAA
 721 GACTTTACCATTCTGATCTAGAGACAAAGGATACTCAATGAGGAGCTTTTTTCCCCTCTTGGAACAGGTAAAATGCTTTT
 801 TCTTATTAATATAATTATAAAACAGTATTTTATGTAACAGCTATTCCCATATTCTAGGAGTGGCCTAAGAAATGCGTGTT
 881 TCAGTGACTAGATTATAAATATTCTCTATTGTGAATAGTTGAATAAAACAGCTGTTTTTTTCTGCTTCCTAAAAAAAAAA
 961 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaCAAGAGAAGGAAACCGGAAc 5'
            |||  | |  ||||||||| 
Target 5' aaGTT-ACCTAATTTGGCCTTt 3'
 557 - 577 155.00 -13.80
2 
miRNA  3' gacAAGAGAAGGAAACCGGAAc 5'
             |||   |:| |||||:|| 
Target 5' gtaTTCAGGTTCATTGGCTTTt 3'
 515 - 536 143.00 -9.90
3 
miRNA  3' gacAAGAG-A-AGGA----AACCGGAac 5'
             ||| | | |:||     ||||||  
Target 5' ctaTTCCCATATTCTAGGAGTGGCCTaa 3'
 841 - 868 125.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30475196 3 COSMIC
COSN30506082 37 COSMIC
COSN31539862 75 COSMIC
COSN31599672 124 COSMIC
COSN30105493 166 COSMIC
COSN30105486 167 COSMIC
COSN31605740 197 COSMIC
COSN29158257 292 COSMIC
COSN25243812 692 COSMIC
COSN21125346 722 COSMIC
COSN18929389 929 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs369782482 3 dbSNP
rs543464187 4 dbSNP
rs779876294 7 dbSNP
rs781111576 8 dbSNP
rs1008182599 17 dbSNP
rs1157007564 22 dbSNP
rs1172181408 23 dbSNP
rs768981752 24 dbSNP
rs887011981 25 dbSNP
rs747191866 28 dbSNP
rs770660472 31 dbSNP
rs1161994276 32 dbSNP
rs1473952195 39 dbSNP
rs755930183 44 dbSNP
rs780356661 46 dbSNP
rs1361027866 47 dbSNP
rs377499221 50 dbSNP
rs371695303 52 dbSNP
rs1288481154 66 dbSNP
rs574842448 77 dbSNP
rs182312006 85 dbSNP
rs907095987 91 dbSNP
rs1163313336 98 dbSNP
rs1280520920 99 dbSNP
rs779267362 106 dbSNP
rs1045979583 112 dbSNP
rs1221785037 118 dbSNP
rs769070956 120 dbSNP
rs1280093124 126 dbSNP
rs1424514606 128 dbSNP
rs1261122663 129 dbSNP
rs1459043284 132 dbSNP
rs1204873713 133 dbSNP
rs1232156845 138 dbSNP
rs948503439 139 dbSNP
rs917622309 142 dbSNP
rs749318539 144 dbSNP
rs1431504770 146 dbSNP
rs935606914 149 dbSNP
rs1480782636 153 dbSNP
rs1175829163 173 dbSNP
rs1404471298 176 dbSNP
rs894266056 178 dbSNP
rs1329967144 190 dbSNP
rs924215379 192 dbSNP
rs1185755556 203 dbSNP
rs1048822700 212 dbSNP
rs1259279189 214 dbSNP
rs1276208770 214 dbSNP
rs1185566112 223 dbSNP
rs1345774601 231 dbSNP
rs1222313257 232 dbSNP
rs112601290 241 dbSNP
rs930323587 249 dbSNP
rs1280810579 266 dbSNP
rs148235340 268 dbSNP
rs1196370534 275 dbSNP
rs1271998091 283 dbSNP
rs968254521 284 dbSNP
rs1243285016 291 dbSNP
rs1271259064 291 dbSNP
rs780012078 292 dbSNP
rs1029537875 294 dbSNP
rs1678 302 dbSNP
rs1427373641 309 dbSNP
rs940268995 314 dbSNP
rs1419459846 325 dbSNP
rs1408521710 338 dbSNP
rs553297849 339 dbSNP
rs966518311 341 dbSNP
rs750926245 343 dbSNP
rs781741966 355 dbSNP
rs1325957946 363 dbSNP
rs539769894 364 dbSNP
rs757594174 368 dbSNP
rs1365738402 382 dbSNP
rs192232362 383 dbSNP
rs1300730953 395 dbSNP
rs556873139 407 dbSNP
rs1247954972 409 dbSNP
rs1269484657 412 dbSNP
rs1339803701 431 dbSNP
rs1295202109 435 dbSNP
rs1382937908 438 dbSNP
rs1364182949 439 dbSNP
rs1229764755 440 dbSNP
rs1292239242 448 dbSNP
rs1360438134 461 dbSNP
rs1222106952 466 dbSNP
rs1291815341 471 dbSNP
rs1448765977 475 dbSNP
rs1404901145 485 dbSNP
rs1004869918 489 dbSNP
rs1241983286 491 dbSNP
rs886410179 500 dbSNP
rs1366784305 507 dbSNP
rs1165855730 509 dbSNP
rs987408817 512 dbSNP
rs1025574313 515 dbSNP
rs1161326075 519 dbSNP
rs536662136 526 dbSNP
rs898368023 527 dbSNP
rs954209638 528 dbSNP
rs567784879 535 dbSNP
rs1450210177 541 dbSNP
rs1315460253 544 dbSNP
rs1358532093 553 dbSNP
rs11558740 559 dbSNP
rs1428673708 563 dbSNP
rs947856267 564 dbSNP
rs1353122868 578 dbSNP
rs1205720827 584 dbSNP
rs528646605 592 dbSNP
rs957424550 600 dbSNP
rs1032110172 607 dbSNP
rs542859241 609 dbSNP
rs763731911 616 dbSNP
rs1196715586 617 dbSNP
rs1490035151 619 dbSNP
rs574165565 621 dbSNP
rs186896103 626 dbSNP
rs971731161 629 dbSNP
rs1365124538 634 dbSNP
rs552590711 639 dbSNP
rs1157481773 641 dbSNP
rs1012777044 648 dbSNP
rs923576395 654 dbSNP
rs12269029 655 dbSNP
rs35817968 657 dbSNP
rs563844311 664 dbSNP
rs1450112682 665 dbSNP
rs1048896345 668 dbSNP
rs1337747674 679 dbSNP
rs922158079 679 dbSNP
rs1309429502 680 dbSNP
rs1281584790 681 dbSNP
rs1279010023 685 dbSNP
rs1348682205 702 dbSNP
rs975304109 711 dbSNP
rs764673495 716 dbSNP
rs1461275949 717 dbSNP
rs1346222615 722 dbSNP
rs1202096281 735 dbSNP
rs543772378 735 dbSNP
rs911998666 740 dbSNP
rs74153306 758 dbSNP
rs78252671 759 dbSNP
rs1361531210 762 dbSNP
rs867641179 767 dbSNP
rs1408474758 773 dbSNP
rs1176531893 778 dbSNP
rs1396228325 781 dbSNP
rs950697015 786 dbSNP
rs1027653535 792 dbSNP
rs1468227698 803 dbSNP
rs995468161 812 dbSNP
rs1463831328 824 dbSNP
rs1374476400 826 dbSNP
rs1051268799 832 dbSNP
rs1479858805 836 dbSNP
rs962931941 838 dbSNP
rs1306510785 843 dbSNP
rs1348888496 849 dbSNP
rs1225367282 850 dbSNP
rs1284009126 852 dbSNP
rs932851554 871 dbSNP
rs1222288359 873 dbSNP
rs867253003 875 dbSNP
rs1481189899 876 dbSNP
rs1195605138 895 dbSNP
rs1247904883 901 dbSNP
rs181647595 908 dbSNP
rs990255488 918 dbSNP
rs1428058204 921 dbSNP
rs1012510010 929 dbSNP
rs1172495012 931 dbSNP
rs924687036 935 dbSNP
rs977861759 935 dbSNP
rs776412562 941 dbSNP
rs1407066805 942 dbSNP
rs145707916 942 dbSNP
rs79144106 942 dbSNP
rs1481473031 943 dbSNP
rs1303826719 951 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaagagaaggaAACCGGAAc 5'
                       |||||||| 
Target 5' -------------UUGGCCUUu 3'
 		1 - 9
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_022451 | 3UTR | CUUGUAUUCAGGUUCAUUGGCUUUUGCUGGAUGAUCCACCUAAAGAAGUUACCUAAUUUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_022451 | 3UTR | CAGGUUCAUUGGCUUUUGCUGGAUGAUCCACCUAAAGAAGUUACCUAAUUUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_022451 | 3UTR | AUUUGGCCUUUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_022451 | 3UTR | UGUAUUCAGGUUCAUUGGCUUUUGCUGGAUGAUCCACCUAAAGAAGUUACCUAAUUUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_022451 | 3UTR | GUAUUCAGGUUCAUUGGCUUUUGCUGGAUGAUCCACCUAAAGAAGUUACCUAAUUUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_022451 | 3UTR | AAGAAAAAAAUAGCUUGUAUUCAGGUUCAUUGGCUUUUGCUGGAUGAUCCACCUAAAGAAGUUACCUAAUUUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000371361.3 | 3UTR | UUGGCCUUUUAAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4753-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064916 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT161166 SLC25A36 solute carrier family 25 member 36 2 2
MIRT285542 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT308266 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT311425 LMNB1 lamin B1 2 2
MIRT373989 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT383141 CRY2 cryptochrome circadian clock 2 2 2
MIRT405243 ADIPOR2 adiponectin receptor 2 2 2
MIRT441620 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 6
MIRT441789 SRPK1 SRSF protein kinase 1 2 2
MIRT441804 NOC3L NOC3 like DNA replication regulator 2 2
MIRT441832 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442005 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442411 LIMD1 LIM domains containing 1 2 2
MIRT442708 UBE4B ubiquitination factor E4B 2 2
MIRT442714 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT442738 SERINC5 serine incorporator 5 2 2
MIRT442793 CEP170 centrosomal protein 170 2 2
MIRT442984 ZNF736 zinc finger protein 736 2 2
MIRT443055 THRB thyroid hormone receptor beta 2 2
MIRT443288 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT443325 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443331 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT443593 ZNF439 zinc finger protein 439 2 4
MIRT443696 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT443748 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT443866 HDLBP high density lipoprotein binding protein 2 2
MIRT461185 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT464074 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT468738 SDC4 syndecan 4 2 2
MIRT470540 COASY Coenzyme A synthase 2 2
MIRT476458 GBA2 glucosylceramidase beta 2 2 2
MIRT479470 CDK6 cyclin dependent kinase 6 2 2
MIRT486351 TACC2 transforming acidic coiled-coil containing protein 2 2 8
MIRT495126 CXorf67 chromosome X open reading frame 67 2 2
MIRT495166 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495432 ATG7 autophagy related 7 2 2
MIRT495922 FBXO41 F-box protein 41 2 2
MIRT496572 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT498277 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT498431 DDX39A DExD-box helicase 39A 2 2
MIRT530149 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530313 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT530880 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT531177 ZNF626 zinc finger protein 626 2 2
MIRT533395 TYRP1 tyrosinase related protein 1 2 2
MIRT533709 TMEM64 transmembrane protein 64 2 2
MIRT533954 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT535616 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT539472 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT542878 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT559077 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT559465 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT561233 ZNF772 zinc finger protein 772 2 2
MIRT563477 POLE3 DNA polymerase epsilon 3, accessory subunit 2 2
MIRT563995 SLFN11 schlafen family member 11 2 2
MIRT564222 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT566017 RHOA ras homolog family member A 2 2
MIRT566028 RFX1 regulatory factor X1 2 2
MIRT566591 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT567874 CTDSP1 CTD small phosphatase 1 2 2
MIRT568552 AKT2 AKT serine/threonine kinase 2 2 2
MIRT569357 EFHC1 EF-hand domain containing 1 2 2
MIRT569973 DNAAF2 dynein axonemal assembly factor 2 2 2
MIRT614423 ZNF440 zinc finger protein 440 2 2
MIRT628831 SLC25A34 solute carrier family 25 member 34 2 2
MIRT630142 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT634479 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634498 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT637394 R3HDM2 R3H domain containing 2 2 2
MIRT641840 TCF7L2 transcription factor 7 like 2 2 2
MIRT644397 CDKL1 cyclin dependent kinase like 1 2 2
MIRT644888 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647124 ZNF446 zinc finger protein 446 2 2
MIRT647420 SSTR3 somatostatin receptor 3 2 2
MIRT650297 PYCARD PYD and CARD domain containing 2 2
MIRT655488 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT658185 FBXO9 F-box protein 9 2 2
MIRT660931 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT665317 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT670350 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT670823 NICN1 nicolin 1 2 2
MIRT671825 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT672732 NETO2 neuropilin and tolloid like 2 2 2
MIRT674841 GLRX2 glutaredoxin 2 2 2
MIRT675930 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT686786 AZF1 azoospermia factor 1 2 2
MIRT697723 USP8 ubiquitin specific peptidase 8 2 2
MIRT702357 KLHL26 kelch like family member 26 2 2
MIRT704361 DBR1 debranching RNA lariats 1 2 2
MIRT709242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT714433 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717000 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT720875 ADCY5 adenylate cyclase 5 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4753 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4753-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4753-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4753-5p Platinum 23939 resistant tissue
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission