miRTarBase - #MIRT441902


—
pre-miRNA Information
pre-miRNA hsa-mir-3180-1   
Genomic Coordinates chr16: 14911220 - 14911313
Description Homo sapiens miR-3180-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-2   
Genomic Coordinates chr16: 16309879 - 16309966
Description Homo sapiens miR-3180-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-3   
Genomic Coordinates chr16: 18402178 - 18402271
Description Homo sapiens miR-3180-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3180-5p
Sequence 18| CUUCCAGACGCUCCGCCCCACGUCG |42
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SEPN1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcugcaccccgccUCGCAGACCUUc 5'
                       :|| ||||||| 
Target 5' -----------uuGGC-UCUGGAAg 3'
 		1 - 13
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_206926 | 3UTR | AUUUGGCUCUGGAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000361547.2 | 3UTR | UUGGCUCUGGAAGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
126 hsa-miR-3180-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088042 UBXN2A UBX domain protein 2A 2 2
MIRT092741 SETD5 SET domain containing 5 2 4
MIRT123870 FZD6 frizzled class receptor 6 2 2
MIRT134588 GXYLT1 glucoside xylosyltransferase 1 2 2
MIRT174919 RNF38 ring finger protein 38 2 2
MIRT232088 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT257503 HIST1H2AH histone cluster 1 H2A family member h 2 2
MIRT332968 CELF1 CUGBP Elav-like family member 1 2 4
MIRT441902 SEPN1 selenoprotein N 2 2
MIRT443231 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT446243 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT447999 GPR63 G protein-coupled receptor 63 2 2
MIRT458203 FOXL2 forkhead box L2 2 2
MIRT461680 ZNF426 zinc finger protein 426 2 2
MIRT462650 HMOX1 heme oxygenase 1 2 4
MIRT462850 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT464366 URM1 ubiquitin related modifier 1 2 2
MIRT466852 STX6 syntaxin 6 2 2
MIRT468228 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT472037 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT481535 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT482639 RPL18A ribosomal protein L18a 2 2
MIRT498085 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT498273 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT506560 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT507153 GATA6 GATA binding protein 6 2 4
MIRT507447 EIF6 eukaryotic translation initiation factor 6 2 2
MIRT507565 DEK DEK proto-oncogene 2 2
MIRT519629 ZNF772 zinc finger protein 772 2 4
MIRT527689 IL17REL interleukin 17 receptor E like 2 2
MIRT528200 NELFE negative elongation factor complex member E 2 2
MIRT528528 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 4
MIRT528871 ATF3 activating transcription factor 3 2 2
MIRT529121 HOMEZ homeobox and leucine zipper encoding 2 2
MIRT529479 TPD52L3 tumor protein D52 like 3 2 2
MIRT530757 ZNF582 zinc finger protein 582 2 2
MIRT530897 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT531495 NONO non-POU domain containing octamer binding 2 2
MIRT531927 IL12RB2 interleukin 12 receptor subunit beta 2 2 2
MIRT532343 PLEK pleckstrin 2 2
MIRT532817 ZNF827 zinc finger protein 827 2 2
MIRT533516 TRIM13 tripartite motif containing 13 2 2
MIRT534275 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534480 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT537351 FJX1 four jointed box 1 2 2
MIRT538799 C2CD5 C2 calcium dependent domain containing 5 2 2
MIRT538842 BTG1 BTG anti-proliferation factor 1 2 2
MIRT539266 ANKRD28 ankyrin repeat domain 28 2 2
MIRT543401 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT552637 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT556033 MXD1 MAX dimerization protein 1 2 2
MIRT556449 LMNB2 lamin B2 2 4
MIRT562448 CSDE1 cold shock domain containing E1 2 2
MIRT567281 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT574050 PROSC pyridoxal phosphate binding protein 2 2
MIRT575658 Map1b microtubule-associated protein 1B 2 2
MIRT606823 APBB2 amyloid beta precursor protein binding family B member 2 2 2
MIRT609583 GPM6B glycoprotein M6B 2 2
MIRT609678 TMEM213 transmembrane protein 213 2 2
MIRT611221 ZNF274 zinc finger protein 274 2 2
MIRT612577 SYNGAP1 synaptic Ras GTPase activating protein 1 2 4
MIRT613583 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 2 2
MIRT614394 C11orf45 chromosome 11 open reading frame 45 2 2
MIRT615558 JPH2 junctophilin 2 2 2
MIRT615850 RASGRP1 RAS guanyl releasing protein 1 2 2
MIRT615906 C1orf27 chromosome 1 open reading frame 27 2 2
MIRT615932 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT617632 RXRA retinoid X receptor alpha 2 2
MIRT618745 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT622073 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT624390 CD3D CD3d molecule 2 2
MIRT634656 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT636717 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT638033 SHPK sedoheptulokinase 2 2
MIRT638543 KIAA1549 KIAA1549 2 2
MIRT638754 EPHA4 EPH receptor A4 2 2
MIRT639223 IMMP2L inner mitochondrial membrane peptidase subunit 2 2 2
MIRT641774 ZFP91 ZFP91 zinc finger protein 2 2
MIRT643672 CEP78 centrosomal protein 78 2 2
MIRT645851 AFF2 AF4/FMR2 family member 2 2 2
MIRT646021 S100A7A S100 calcium binding protein A7A 2 2
MIRT646071 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 2 2
MIRT646730 FADS1 fatty acid desaturase 1 2 2
MIRT646742 MUC4 mucin 4, cell surface associated 2 2
MIRT647563 ZNF660 zinc finger protein 660 2 2
MIRT648539 TMEM169 transmembrane protein 169 2 2
MIRT650852 UNC13D unc-13 homolog D 2 2
MIRT650872 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT652345 TMOD3 tropomodulin 3 2 2
MIRT653451 SLC6A17 solute carrier family 6 member 17 2 2
MIRT654750 PRKCB protein kinase C beta 2 2
MIRT655569 OXSR1 oxidative stress responsive 1 2 2
MIRT656547 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT657212 IGF1R insulin like growth factor 1 receptor 2 2
MIRT657740 GNG12 G protein subunit gamma 12 2 2
MIRT659225 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT659272 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT660822 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT666123 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT666608 REEP2 receptor accessory protein 2 2 2
MIRT668974 CLSTN2 calsyntenin 2 2 2
MIRT678890 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT683998 FOLR1 folate receptor 1 2 2
MIRT685672 PSMB7 proteasome subunit beta 7 2 2
MIRT689095 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT690645 RPF2 ribosome production factor 2 homolog 2 2
MIRT697740 USP5 ubiquitin specific peptidase 5 2 2
MIRT698823 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT699886 RUNX1 runt related transcription factor 1 2 2
MIRT700010 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT706001 ABCC1 ATP binding cassette subfamily C member 1 2 2
MIRT708394 XKR7 XK related 7 2 2
MIRT708517 TOP2B DNA topoisomerase II beta 2 2
MIRT709215 PARD3B par-3 family cell polarity regulator beta 2 2
MIRT710154 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT711069 NLGN2 neuroligin 2 2 2
MIRT714631 TM4SF18 transmembrane 4 L six family member 18 2 2
MIRT715418 SPOPL speckle type BTB/POZ protein like 2 2
MIRT716612 RBM18 RNA binding motif protein 18 2 2
MIRT718658 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT718929 TRIM66 tripartite motif containing 66 2 2
MIRT720637 ELF5 E74 like ETS transcription factor 5 2 2
MIRT720782 PRKRIP1 PRKR interacting protein 1 2 2
MIRT721285 TRABD2A TraB domain containing 2A 2 2
MIRT721337 LIF LIF, interleukin 6 family cytokine 2 2
MIRT722891 LRRC20 leucine rich repeat containing 20 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3180-5p Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3180 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3180 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-3180 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-3180-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-3180-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3180-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3180-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-3180-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission