>MAGEB10|NM_182506|3'UTR
   1 AGTCTGAGGGAGATTCTTCATTTGTGTTTGAAAAGAAATGCACATTCTGAGCTGTGGGAGGTCAGGGTGGGACTGGAGAC
  81 AACACAGTGAATAATATGTTTGTGTTAATGTTCTATGTGATGGCTTGGAATTTTTGAAGATGTTGTTCCTTTAATAGATG
 161 GTTAAAGTAGCTTCACTATCTAAGTTTATGAATGACATTGCTCAAATTTTTCTGTATGTGAGATTAAGAGTAAGCGATTT
 241 ATTGCTTTATAAGTCTAATTGGGAAACTCTCCATTTATTTAGTGATCGAAACACGATAGCATGGTAGTAAATTAGGCATT
 321 TCCTAATTCAATGTGAAATAATTTAGGAGTGTAATAAATGGGATCAAGAAATAGAGCAAAGAGGGTCGGGTGCGGTGGCT
 401 CACACCTGTAATCCTAGCACTTTGGGAGGCCGAGGCAGGCGGATCATGAGGTCAGGAGATCAAGACCATCTTGGCTAACA
 481 CAGTGAAACCCCGTCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGCGGGTTCCTGTAGTCCTAGCTGCTCAGG
 561 AGGCTGAGGCAGGAGAATGGCGTAAACCCGGGAGGCGGAGCTTGCAGTGAGCCAAGATCACACGACTGCATTCTAGCCTG
 641 GGTGACAGAGCGAGACTCTGTCTC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gccCCACGU----GC---CCGCCUCccg 5' || |:| || ||||||| Target 5' aatGGCGTAAACCCGGGAGGCGGAGctt 3'	576 - 603	112.00	-17.10
2	miRNA 3' gcCCCACGUGCCCGCCUCCcg 5' |||| |: | |||| || Target 5' gaGGGT-CGGGTGCGGTGGct 3'	381 - 400	110.00	-22.70
3	miRNA 3' gccccacgugcCCGCCUCCCg 5' | | ||||| Target 5' ----------aGTCTGAGGGa 3'	1 - 11	110.00	-8.00

Mutant ID	Mutant Position	Mutant Source
rs746688852	4	dbSNP
rs1474150545	7	dbSNP
rs867474543	10	dbSNP
rs1466776778	14	dbSNP
rs1379562719	16	dbSNP
rs1157468256	19	dbSNP
rs768325652	26	dbSNP
rs374629585	27	dbSNP
rs368541090	42	dbSNP
rs747684284	45	dbSNP
rs182508711	55	dbSNP
rs1040666052	81	dbSNP
rs1253516777	89	dbSNP
rs1199367015	98	dbSNP
rs780801950	99	dbSNP
rs921897773	114	dbSNP
rs368168872	119	dbSNP
rs931975948	121	dbSNP
rs1237693442	133	dbSNP
rs1352637600	143	dbSNP
rs1049135339	147	dbSNP
rs776522126	150	dbSNP
rs189159319	156	dbSNP
rs745558574	160	dbSNP
rs191947055	165	dbSNP
rs1287275542	167	dbSNP
rs897011441	176	dbSNP
rs1381268674	183	dbSNP
rs1349358041	198	dbSNP
rs1160795228	204	dbSNP
rs1020477448	232	dbSNP
rs1462227245	236	dbSNP
rs967540535	237	dbSNP
rs1328135768	240	dbSNP
rs753030554	245	dbSNP
rs761699783	249	dbSNP
rs1000211395	254	dbSNP
rs1374450487	259	dbSNP
rs1442424867	262	dbSNP
rs1033065377	264	dbSNP
rs1445704663	272	dbSNP
rs1309520219	274	dbSNP
rs1280097492	278	dbSNP
rs767464183	289	dbSNP
rs1487856019	296	dbSNP
rs1034913312	306	dbSNP
rs750355024	308	dbSNP
rs958999228	309	dbSNP
rs1375353993	335	dbSNP
rs1226130392	350	dbSNP
rs183813413	351	dbSNP
rs1011872999	368	dbSNP
rs1245632793	371	dbSNP
rs1342295597	373	dbSNP
rs1288593391	374	dbSNP
rs975480439	380	dbSNP
rs1399672839	382	dbSNP
rs968196341	386	dbSNP
rs1423125938	388	dbSNP
rs977890366	388	dbSNP
rs922504467	389	dbSNP
rs780072930	394	dbSNP
rs1164284851	395	dbSNP
rs924079251	407	dbSNP
rs955339535	409	dbSNP
rs983122446	416	dbSNP
rs966247432	429	dbSNP
rs1477316859	432	dbSNP
rs1263432899	433	dbSNP
rs753221298	439	dbSNP
rs754498551	441	dbSNP
rs376185711	442	dbSNP
rs1289092227	445	dbSNP
rs976295373	451	dbSNP
rs922181344	453	dbSNP
rs778523874	467	dbSNP
rs1456742177	471	dbSNP
rs1204188955	476	dbSNP
rs1256293267	478	dbSNP
rs1038085294	491	dbSNP
rs926397100	493	dbSNP
rs937651310	494	dbSNP
rs1056161149	498	dbSNP
rs1049082862	502	dbSNP
rs1434776934	510	dbSNP
rs1233984691	511	dbSNP
rs896039355	527	dbSNP
rs1407611112	534	dbSNP
rs755795376	535	dbSNP
rs866519289	540	dbSNP
rs1042376403	550	dbSNP
rs903328677	555	dbSNP
rs1417297774	567	dbSNP
rs747862519	574	dbSNP
rs1000322499	583	dbSNP
rs1423918671	590	dbSNP
rs1195341455	591	dbSNP
rs1245955034	593	dbSNP
rs1475564272	597	dbSNP
rs1036467542	598	dbSNP
rs896951545	604	dbSNP
rs1198095521	613	dbSNP
rs1318627430	614	dbSNP
rs146765483	624	dbSNP
rs964131342	625	dbSNP
rs1275858457	629	dbSNP
rs45612836	635	dbSNP
rs1375412813	636	dbSNP
rs1331199679	651	dbSNP
rs1029638910	652	dbSNP
rs1356044493	653	dbSNP
rs1056273943	658	dbSNP
rs1445813843	665	dbSNP

- Cell host & microbe, 2011

Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.

- Nature methods, 2013

High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.