pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6768 |
Genomic Coordinates | chr16: 2463967 - 2464038 |
Description | Homo sapiens miR-6768 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6768-3p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 45| CAAAGGCCACAUUCUCCUGUGCAC |68 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NDUFV3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | CI-10k, CI-9KD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | NADH:ubiquinone oxidoreductase subunit V3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001001503 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_021075 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on NDUFV3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of NDUFV3 (miRNA target sites are highlighted) |
>NDUFV3|NM_001001503|3'UTR 1 GGGCCCTCGGTGTGAAGATGAACCTTCCACCGTCTTCACTGCATCCTGGAGTGCAAAAATAAAATCCACTCAAGAGTCAC 81 AAGGCCCGCTGTGCATAATCGGTTTCACTTTTACCTTTTTTTTTTTTTTTTTTTTTTTGAGACAGGGTCTCACTCTGTCA 161 CCCAGGCTGGAGTGCAGTGGCACATTCTCGGCTCACTGCAACTTCCGCCTCCTGGGTTCAAGTGATTCTCCCACCTCAGC 241 CTCCCAAGTAGGTGGGATTACAGGTACTCACCACCAGGTCCAGCTAACTTTTGTATTTTTAGTAGAGACAGGGTTTCACC 321 ATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGATGGTCTGCCCACCTCCGCCTCCCAAAGTGCTGGGATTACAGGC 401 GTGAGCCACTGCGCCCGGCCACTTTCACACTTTTTACAGTGAGTGGTGAATTAGCAACAGTAACACTGATTATCCAACAT 481 ATATTTTGGAATATCTACTATGTGCAAGGAATTTTTCTTAAACTCTAAGGTTATGAATCACTGGGCAAATCCATATAATT 561 AGAGAATTTTAAGTGCTTTAGAGCGGTGTGATTCTACTGTGCTCAGCCTAGTCAATTTCGCATTAAACTGATTATCAGCT 641 GAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | BC-3 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine
PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
CLIP-seq Support 1 for dataset GSM796039 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-3 / 4-Thiouridine |
Location of target site | ENST00000340344.4 | 3UTR | UUGGCCUUUAUUCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM796040 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-3 / 4-Thiouridine |
Location of target site | ENST00000340344.4 | 3UTR | UUGGCCUUUAUUCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
95 hsa-miR-6768-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT060980 | LAMC1 | laminin subunit gamma 1 | 2 | 2 | ||||||||
MIRT145633 | LASP1 | LIM and SH3 protein 1 | 2 | 2 | ||||||||
MIRT161065 | CDV3 | CDV3 homolog | 2 | 2 | ||||||||
MIRT161171 | SLC25A36 | solute carrier family 25 member 36 | 2 | 2 | ||||||||
MIRT177407 | ZMYND11 | zinc finger MYND-type containing 11 | 2 | 2 | ||||||||
MIRT262237 | WAC | WW domain containing adaptor with coiled-coil | 2 | 2 | ||||||||
MIRT300236 | INO80D | INO80 complex subunit D | 2 | 2 | ||||||||
MIRT373993 | PEBP1 | phosphatidylethanolamine binding protein 1 | 2 | 4 | ||||||||
MIRT379949 | CRY2 | cryptochrome circadian clock 2 | 2 | 2 | ||||||||
MIRT405244 | ADIPOR2 | adiponectin receptor 2 | 2 | 2 | ||||||||
MIRT441622 | ROCK1 | Rho associated coiled-coil containing protein kinase 1 | 2 | 6 | ||||||||
MIRT441807 | NOC3L | NOC3 like DNA replication regulator | 2 | 2 | ||||||||
MIRT442007 | NDUFV3 | NADH:ubiquinone oxidoreductase subunit V3 | 2 | 2 | ||||||||
MIRT442254 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT442413 | LIMD1 | LIM domains containing 1 | 2 | 2 | ||||||||
MIRT442741 | SERINC5 | serine incorporator 5 | 2 | 2 | ||||||||
MIRT442796 | CEP170 | centrosomal protein 170 | 2 | 2 | ||||||||
MIRT443332 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | 2 | 2 | ||||||||
MIRT443602 | ZNF91 | zinc finger protein 91 | 2 | 2 | ||||||||
MIRT443695 | KCNN3 | potassium calcium-activated channel subfamily N member 3 | 2 | 2 | ||||||||
MIRT443749 | ELL2 | elongation factor for RNA polymerase II 2 | 2 | 2 | ||||||||
MIRT446376 | THSD4 | thrombospondin type 1 domain containing 4 | 2 | 2 | ||||||||
MIRT452491 | BANK1 | B-cell scaffold protein with ankyrin repeats 1 | 2 | 16 | ||||||||
MIRT456028 | PSMA7 | proteasome subunit alpha 7 | 2 | 2 | ||||||||
MIRT461191 | TRIP4 | thyroid hormone receptor interactor 4 | 2 | 16 | ||||||||
MIRT464498 | UCK2 | uridine-cytidine kinase 2 | 2 | 2 | ||||||||
MIRT466640 | TAOK1 | TAO kinase 1 | 2 | 16 | ||||||||
MIRT466703 | TAF13 | TATA-box binding protein associated factor 13 | 2 | 4 | ||||||||
MIRT467765 | SLC30A7 | solute carrier family 30 member 7 | 2 | 2 | ||||||||
MIRT469973 | PTPRF | protein tyrosine phosphatase, receptor type F | 2 | 2 | ||||||||
MIRT470539 | COASY | Coenzyme A synthase | 2 | 2 | ||||||||
MIRT474827 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | 2 | 2 | ||||||||
MIRT475961 | GXYLT1 | glucoside xylosyltransferase 1 | 2 | 4 | ||||||||
MIRT476459 | GBA2 | glucosylceramidase beta 2 | 2 | 2 | ||||||||
MIRT477658 | EFNA1 | ephrin A1 | 2 | 2 | ||||||||
MIRT485320 | MZT1 | mitotic spindle organizing protein 1 | 2 | 4 | ||||||||
MIRT485656 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | 2 | 2 | ||||||||
MIRT494145 | CTC1 | CST telomere replication complex component 1 | 2 | 10 | ||||||||
MIRT495127 | CXorf67 | chromosome X open reading frame 67 | 2 | 2 | ||||||||
MIRT498279 | POFUT1 | protein O-fucosyltransferase 1 | 2 | 2 | ||||||||
MIRT498432 | DDX39A | DExD-box helicase 39A | 2 | 2 | ||||||||
MIRT498853 | LITAF | lipopolysaccharide induced TNF factor | 2 | 4 | ||||||||
MIRT499661 | SDR42E1 | short chain dehydrogenase/reductase family 42E, member 1 | 2 | 2 | ||||||||
MIRT502927 | CDC42SE1 | CDC42 small effector 1 | 2 | 4 | ||||||||
MIRT503758 | CEP19 | centrosomal protein 19 | 2 | 6 | ||||||||
MIRT507753 | CERS2 | ceramide synthase 2 | 2 | 4 | ||||||||
MIRT507893 | CAMSAP2 | calmodulin regulated spectrin associated protein family member 2 | 2 | 4 | ||||||||
MIRT510091 | PPWD1 | peptidylprolyl isomerase domain and WD repeat containing 1 | 2 | 8 | ||||||||
MIRT527065 | PPP6R1 | protein phosphatase 6 regulatory subunit 1 | 2 | 2 | ||||||||
MIRT530314 | TNFRSF10D | TNF receptor superfamily member 10d | 2 | 2 | ||||||||
MIRT530702 | P2RY1 | purinergic receptor P2Y1 | 2 | 2 | ||||||||
MIRT532378 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT532969 | ZNF148 | zinc finger protein 148 | 2 | 2 | ||||||||
MIRT533958 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | 2 | 2 | ||||||||
MIRT535186 | PLEKHA8 | pleckstrin homology domain containing A8 | 2 | 2 | ||||||||
MIRT538751 | CADM1 | cell adhesion molecule 1 | 2 | 2 | ||||||||
MIRT539473 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | 2 | 2 | ||||||||
MIRT543858 | APIP | APAF1 interacting protein | 2 | 2 | ||||||||
MIRT558802 | CDON | cell adhesion associated, oncogene regulated | 2 | 2 | ||||||||
MIRT560208 | AK4 | adenylate kinase 4 | 2 | 2 | ||||||||
MIRT560318 | EFHD2 | EF-hand domain family member D2 | 2 | 2 | ||||||||
MIRT560439 | GOLGA7B | golgin A7 family member B | 2 | 2 | ||||||||
MIRT560846 | SUV39H2 | suppressor of variegation 3-9 homolog 2 | 2 | 2 | ||||||||
MIRT562787 | LIMA1 | LIM domain and actin binding 1 | 2 | 2 | ||||||||
MIRT563476 | POLE3 | DNA polymerase epsilon 3, accessory subunit | 2 | 2 | ||||||||
MIRT563829 | RIPK4 | receptor interacting serine/threonine kinase 4 | 2 | 2 | ||||||||
MIRT563996 | SLFN11 | schlafen family member 11 | 2 | 2 | ||||||||
MIRT564596 | ZNF791 | zinc finger protein 791 | 2 | 2 | ||||||||
MIRT565442 | SURF4 | surfeit 4 | 2 | 2 | ||||||||
MIRT566020 | RHOA | ras homolog family member A | 2 | 2 | ||||||||
MIRT566185 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT567643 | FAM160A1 | family with sequence similarity 160 member A1 | 2 | 2 | ||||||||
MIRT568484 | ARL5B | ADP ribosylation factor like GTPase 5B | 2 | 2 | ||||||||
MIRT568553 | AKT2 | AKT serine/threonine kinase 2 | 2 | 2 | ||||||||
MIRT613420 | XRCC3 | X-ray repair cross complementing 3 | 2 | 2 | ||||||||
MIRT613638 | ARHGAP35 | Rho GTPase activating protein 35 | 2 | 2 | ||||||||
MIRT614841 | POU2F2 | POU class 2 homeobox 2 | 2 | 2 | ||||||||
MIRT630143 | ZFYVE9 | zinc finger FYVE-type containing 9 | 2 | 2 | ||||||||
MIRT634123 | ZMYM1 | zinc finger MYM-type containing 1 | 2 | 4 | ||||||||
MIRT641841 | TCF7L2 | transcription factor 7 like 2 | 2 | 2 | ||||||||
MIRT647123 | ZNF446 | zinc finger protein 446 | 2 | 2 | ||||||||
MIRT647968 | FBXO31 | F-box protein 31 | 2 | 2 | ||||||||
MIRT658186 | FBXO9 | F-box protein 9 | 2 | 2 | ||||||||
MIRT659097 | DENR | density regulated re-initiation and release factor | 2 | 2 | ||||||||
MIRT668980 | CLCN3 | chloride voltage-gated channel 3 | 2 | 2 | ||||||||
MIRT670351 | C1orf106 | chromosome 1 open reading frame 106 | 2 | 4 | ||||||||
MIRT671826 | TRPM6 | transient receptor potential cation channel subfamily M member 6 | 2 | 2 | ||||||||
MIRT695610 | GATAD1 | GATA zinc finger domain containing 1 | 2 | 2 | ||||||||
MIRT697722 | USP8 | ubiquitin specific peptidase 8 | 2 | 2 | ||||||||
MIRT700069 | RPL14 | ribosomal protein L14 | 2 | 2 | ||||||||
MIRT708474 | MAPKAPK5 | mitogen-activated protein kinase-activated protein kinase 5 | 2 | 2 | ||||||||
MIRT717001 | ARL6IP4 | ADP ribosylation factor like GTPase 6 interacting protein 4 | 2 | 2 | ||||||||
MIRT719591 | TFCP2L1 | transcription factor CP2 like 1 | 2 | 2 | ||||||||
MIRT722026 | CBY3 | chibby family member 3 | 2 | 2 | ||||||||
MIRT722901 | LRRC20 | leucine rich repeat containing 20 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|