miRTarBase - #MIRT442181


—
pre-miRNA Information
pre-miRNA hsa-mir-3653   
Genomic Coordinates chr22: 29333158 - 29333267
Description Homo sapiens miR-3653 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3653-5p
Sequence 23| CCUCCUGAUGAUUCUUCUUC |42
Evidence Not_experimental
Experiments
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SRP68   
Synonyms -
Description signal recognition particle 68
Transcript NM_014230   
Expression
Putative miRNA Targets on SRP68
3'UTR of SRP68
(miRNA target sites are highlighted)		 
>SRP68|NM_014230|3'UTR
   1 CCAGGCTCTTCCTCGGGGGCGGGGGAGATTCTGACTCTTAATCTGTATTGTGAGAAAATCCCAGCAAGTTCCATGATATT
  81 AAATCCAGGTCTGCATTGGCCCGGGGCAAGAGTTTAACATCTTCGGCCCTGCATTCCTACATCTTGTGTCTGTACACGTT
 161 CTTAAGCAGCGTGTCAGGAGAGCACCCTGTTGTCTTCTGGTAAATGTGTGCAGGGTCATCCTGTCTCCTGTACCTCCTGG
 241 GAAAGGGGCCGCTGCTGTCTGGTGCCCTGTGAGCTGTGATTGATTGCCTTTGGTCAGTAATGCGTTCAGGAGTCCACACC
 321 AGGCACAGATGGGGCCTTGAAACGCTTTGTCATGCTTCTTCAGTACCATGGATTTGAAATGAACTCATCCTTGCTGTGAG
 401 CATCCAGGAGCCCTTGAGAAGTTTATCTATGACTATGAAACTGGCAACGTCACCCCAGAATTACGGTCAGCCTTATTCCC
 481 CTTCACCTCCCAGTGAACGCTAAGAAGTTTCAGACAAGCAGAGAGCTCTATTTTTAGAAGAAATATGTTACACTCAGAAA
 561 TGATGAAACCAAATCTTATATTAAAAGGCAAAGATGACGGAGACTGTGCCCATTTCTTATATGCCCTCCCTCATGTCCAG
 641 TCCCCGTTCTCTCCTCGGGAGCCTAGTTGCGTGAAGCCGGTGAGGTCAAGTGTAACCTGACTTACCGGCAACTAGGTGAG
 721 GCTGATGCCAGATACACATGTTAGAGGCACTATTTTTCAGGACTTCCCAATGTGTAATTTTTAGATGCCATTATATTTTA
 801 ATCCCCTTCGTTACCCCCCGTTTTTCCTTAGTCATCCCTTTTCACTTCTATTATAACATCAATAATAGAAGTCACAAAAA
 881 CAATGTAAGAAAGCAAGGAATAAAAGTGATTTAAACATGTACCTGACACTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUCUUCUUAGUAGUCCUCc 5'
            || || :| :||||||| 
Target 5' taAGCAGCGT-GTCAGGAGa 3'
 163 - 181 153.00 -12.40
2 
miRNA  3' cuucUUCUUA-GU-AGUCCUCc 5'
              |: ||| |: ||||||| 
Target 5' ggtcAGTAATGCGTTCAGGAGt 3'
 292 - 313 148.00 -10.50
3 
miRNA  3' cuUCUUC----UUAGUAGUCCUcc 5'
            |||:|    | |: ||||||  
Target 5' ttAGAGGCACTATTTTTCAGGAct 3'
 741 - 764 132.00 -9.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30501538 14 COSMIC
COSN30505581 15 COSMIC
COSN13748145 20 COSMIC
COSN30164981 33 COSMIC
COSN30106799 146 COSMIC
COSN31574239 147 COSMIC
COSN31601363 148 COSMIC
COSN28632914 244 COSMIC
COSN31515322 250 COSMIC
COSN31540141 293 COSMIC
COSN20833398 389 COSMIC
COSN31542567 398 COSMIC
COSN21137044 454 COSMIC
COSN30166407 471 COSMIC
COSN6112142 599 COSMIC
COSN25843966 600 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761596184 6 dbSNP
rs1466594976 7 dbSNP
rs112089079 9 dbSNP
rs374662066 14 dbSNP
rs768642199 15 dbSNP
rs1194391640 18 dbSNP
rs760214725 19 dbSNP
rs575532025 20 dbSNP
rs759623224 21 dbSNP
rs778723592 24 dbSNP
rs780422282 26 dbSNP
rs1178949036 27 dbSNP
rs1045404174 36 dbSNP
rs1256025804 37 dbSNP
rs771354753 42 dbSNP
rs1321765805 43 dbSNP
rs1461322944 47 dbSNP
rs1296174417 49 dbSNP
rs948427428 57 dbSNP
rs1426292019 63 dbSNP
rs895390691 65 dbSNP
rs1055749719 66 dbSNP
rs561797576 68 dbSNP
rs942298849 73 dbSNP
rs1490642923 74 dbSNP
rs1291547290 77 dbSNP
rs759767479 86 dbSNP
rs893009095 88 dbSNP
rs909360933 89 dbSNP
rs16968440 96 dbSNP
rs372558258 101 dbSNP
rs746195039 102 dbSNP
rs766573217 103 dbSNP
rs148213973 104 dbSNP
rs143358764 107 dbSNP
rs1334749522 108 dbSNP
rs948720776 109 dbSNP
rs976107987 110 dbSNP
rs1427500540 115 dbSNP
rs965108777 123 dbSNP
rs1017614088 124 dbSNP
rs534330976 125 dbSNP
rs1038422784 133 dbSNP
rs760727336 139 dbSNP
rs1454650331 141 dbSNP
rs1031482839 146 dbSNP
rs908745049 149 dbSNP
rs1361597482 156 dbSNP
rs578031125 157 dbSNP
rs773326228 158 dbSNP
rs771359003 161 dbSNP
rs1024093176 163 dbSNP
rs193095455 170 dbSNP
rs189224939 171 dbSNP
rs1326195193 172 dbSNP
rs1038057648 176 dbSNP
rs976167468 183 dbSNP
rs1485380156 185 dbSNP
rs1184378767 189 dbSNP
rs749252996 194 dbSNP
rs888058459 209 dbSNP
rs1047871677 212 dbSNP
rs1460135093 217 dbSNP
rs764457133 226 dbSNP
rs929509452 230 dbSNP
rs1427124581 234 dbSNP
rs7409 244 dbSNP
rs775165111 245 dbSNP
rs1344652084 249 dbSNP
rs957103323 250 dbSNP
rs1290878847 251 dbSNP
rs568050997 252 dbSNP
rs1404725901 257 dbSNP
rs976532504 264 dbSNP
rs943472742 269 dbSNP
rs1226249723 273 dbSNP
rs1220314482 276 dbSNP
rs1378072745 285 dbSNP
rs1309532236 288 dbSNP
rs1447903667 290 dbSNP
rs1379599822 296 dbSNP
rs758753433 299 dbSNP
rs910512948 300 dbSNP
rs990182553 301 dbSNP
rs1442168195 303 dbSNP
rs773765318 304 dbSNP
rs1167075374 310 dbSNP
rs1403682125 313 dbSNP
rs1384781238 315 dbSNP
rs907127916 317 dbSNP
rs555594281 318 dbSNP
rs1441273940 319 dbSNP
rs1236179238 326 dbSNP
rs1013334869 329 dbSNP
rs750691748 334 dbSNP
rs1247947217 335 dbSNP
rs1218650923 337 dbSNP
rs1478990519 339 dbSNP
rs1358118020 341 dbSNP
rs17498898 343 dbSNP
rs1241907876 344 dbSNP
rs1271175518 352 dbSNP
rs1038372221 354 dbSNP
rs1230112139 363 dbSNP
rs1363408985 368 dbSNP
rs1031630102 388 dbSNP
rs1305371253 392 dbSNP
rs778400917 393 dbSNP
rs1369000025 394 dbSNP
rs1295817779 399 dbSNP
rs1434336964 401 dbSNP
rs1365071845 406 dbSNP
rs1367819386 407 dbSNP
rs756619254 410 dbSNP
rs977252724 411 dbSNP
rs1279517133 417 dbSNP
rs566173675 418 dbSNP
rs183926322 425 dbSNP
rs1024153732 429 dbSNP
rs1310792124 433 dbSNP
rs934149758 435 dbSNP
rs922854623 436 dbSNP
rs1442193720 441 dbSNP
rs1289386007 442 dbSNP
rs975654646 448 dbSNP
rs781082742 449 dbSNP
rs1444259635 452 dbSNP
rs1232239859 453 dbSNP
rs780885220 454 dbSNP
rs989754147 455 dbSNP
rs1013053756 464 dbSNP
rs1444284793 465 dbSNP
rs75533415 471 dbSNP
rs1416175350 479 dbSNP
rs1407758520 491 dbSNP
rs570440866 498 dbSNP
rs977666939 499 dbSNP
rs757020999 506 dbSNP
rs1376965312 508 dbSNP
rs1451217209 511 dbSNP
rs1312503921 515 dbSNP
rs1024555388 517 dbSNP
rs1016993628 525 dbSNP
rs1012871610 543 dbSNP
rs1272011013 546 dbSNP
rs781247230 546 dbSNP
rs550765776 554 dbSNP
rs1200424053 555 dbSNP
rs1171377898 560 dbSNP
rs530590031 563 dbSNP
rs1181755594 565 dbSNP
rs1239441936 571 dbSNP
rs1473240115 575 dbSNP
rs1048005241 578 dbSNP
rs1467687102 579 dbSNP
rs887205838 586 dbSNP
rs1181482720 594 dbSNP
rs1047145196 598 dbSNP
rs934157391 599 dbSNP
rs376294563 609 dbSNP
rs1448296405 615 dbSNP
rs149195459 619 dbSNP
rs777459498 626 dbSNP
rs1040558566 632 dbSNP
rs1258632826 634 dbSNP
rs915467700 638 dbSNP
rs943422460 645 dbSNP
rs910657972 646 dbSNP
rs1443252504 655 dbSNP
rs924365773 656 dbSNP
rs1479024883 660 dbSNP
rs1194754787 667 dbSNP
rs755260173 670 dbSNP
rs191968491 671 dbSNP
rs1384710382 677 dbSNP
rs924611153 678 dbSNP
rs1337059735 689 dbSNP
rs1451419711 690 dbSNP
rs977304551 701 dbSNP
rs1319661605 705 dbSNP
rs187572832 706 dbSNP
rs958630654 707 dbSNP
rs1016834513 709 dbSNP
rs1402979850 710 dbSNP
rs1276736183 711 dbSNP
rs560518350 712 dbSNP
rs1158364615 714 dbSNP
rs917047450 715 dbSNP
rs753273931 716 dbSNP
rs540241325 717 dbSNP
rs1489360944 721 dbSNP
rs1438305319 722 dbSNP
rs1387438760 725 dbSNP
rs1217880926 727 dbSNP
rs1479766846 730 dbSNP
rs991362043 737 dbSNP
rs1184496230 738 dbSNP
rs1461004456 740 dbSNP
rs958687039 742 dbSNP
rs1478089410 744 dbSNP
rs769352217 746 dbSNP
rs1447530857 752 dbSNP
rs1283548478 762 dbSNP
rs1026064604 763 dbSNP
rs1364707634 769 dbSNP
rs146598115 770 dbSNP
rs1331542100 776 dbSNP
rs1238439434 785 dbSNP
rs901232721 793 dbSNP
rs1039889984 795 dbSNP
rs1315446037 796 dbSNP
rs1291572179 806 dbSNP
rs182618167 809 dbSNP
rs76087693 810 dbSNP
rs1437740168 817 dbSNP
rs1180549759 818 dbSNP
rs1025271654 819 dbSNP
rs575708898 820 dbSNP
rs776194002 820 dbSNP
rs1158894165 821 dbSNP
rs935582300 832 dbSNP
rs1456202735 835 dbSNP
rs766598331 836 dbSNP
rs760925509 837 dbSNP
rs1007763596 838 dbSNP
rs1329441522 839 dbSNP
rs34618582 839 dbSNP
rs555532927 839 dbSNP
rs889199616 846 dbSNP
rs977479066 847 dbSNP
rs1314673150 848 dbSNP
rs1054507725 850 dbSNP
rs1247512754 854 dbSNP
rs770845907 856 dbSNP
rs936080245 858 dbSNP
rs1194560693 862 dbSNP
rs1240515096 877 dbSNP
rs1458736225 894 dbSNP
rs958495297 894 dbSNP
rs535795208 897 dbSNP
rs1242160249 908 dbSNP
rs566805207 917 dbSNP
rs746715622 918 dbSNP
rs1421676827 919 dbSNP
rs1189442142 922 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions EF3D-AGO2 , LCL-BAC
Disease MIMAT0032110
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020021. RNA binding protein: AGO2. Condition:EBV B95-8-infected "PAR-CLIP data was present in GSM1020023. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1020021
Method / RBP PAR-CLIP / AGO2
Cell line / Condition EF3D-AGO2 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000307877.2 | 3UTR | UUGGUCAGUAAUGCGUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1020023
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000307877.2 | 3UTR | UUGGUCAGUAAUGCGUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000307877.2 | 3UTR | UUGGUCAGUAAUGCGUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000307877.2 | 3UTR | UUGGUCAGUAAUGCGUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000307877.2 | 3UTR | UUGGUCAGUAAUGCGUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
543 hsa-miR-3653-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118037 SLC1A5 solute carrier family 1 member 5 2 2
MIRT134378 E2F2 E2F transcription factor 2 2 2
MIRT171365 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT174716 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT250468 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 2
MIRT261002 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 4
MIRT306045 SKIL SKI like proto-oncogene 2 4
MIRT352741 CSNK1E casein kinase 1 epsilon 2 2
MIRT380445 SLC2A1 solute carrier family 2 member 1 2 2
MIRT442181 SRP68 signal recognition particle 68 2 6
MIRT448534 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT451362 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT451444 ZNF556 zinc finger protein 556 2 4
MIRT452667 PPIA peptidylprolyl isomerase A 2 2
MIRT458768 CES2 carboxylesterase 2 2 2
MIRT460268 SLC26A2 solute carrier family 26 member 2 2 2
MIRT460535 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT460602 FEM1A fem-1 homolog A 2 4
MIRT463622 YY1 YY1 transcription factor 2 2
MIRT473708 MAPK1 mitogen-activated protein kinase 1 2 6
MIRT474922 KCTD20 potassium channel tetramerization domain containing 20 2 2
MIRT478532 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT482760 TMEM126B transmembrane protein 126B 2 2
MIRT491029 FDX1 ferredoxin 1 2 4
MIRT492753 PER1 period circadian clock 1 2 8
MIRT494140 CTC1 CST telomere replication complex component 1 2 10
MIRT497863 UBA5 ubiquitin like modifier activating enzyme 5 2 4
MIRT512405 CD84 CD84 molecule 2 2
MIRT512529 ATCAY ATCAY, caytaxin 2 4
MIRT513039 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT517888 SSTR2 somatostatin receptor 2 2 2
MIRT520420 TXNL1 thioredoxin like 1 2 6
MIRT521826 POLR1D RNA polymerase I subunit D 2 2
MIRT534072 SRPK1 SRSF protein kinase 1 2 2
MIRT534240 SLC23A1 solute carrier family 23 member 1 2 2
MIRT538794 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT538980 BCL2L2 BCL2 like 2 2 2
MIRT542111 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 4
MIRT546462 SLC39A14 solute carrier family 39 member 14 2 2
MIRT552217 SSPN sarcospan 2 2
MIRT552224 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 2 2
MIRT554420 SATB2 SATB homeobox 2 2 2
MIRT555385 PPP1CC protein phosphatase 1 catalytic subunit gamma 2 2
MIRT569625 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT573895 MKI67 marker of proliferation Ki-67 2 2
MIRT575161 Fam120c family with sequence similarity 120, member C 2 2
MIRT607347 YAE1D1 Yae1 domain containing 1 2 6
MIRT607413 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT608320 SYK spleen associated tyrosine kinase 2 4
MIRT608473 RRP36 ribosomal RNA processing 36 2 2
MIRT608523 TMOD3 tropomodulin 3 2 4
MIRT608572 RNF149 ring finger protein 149 2 2
MIRT608609 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT608676 STPG1 sperm tail PG-rich repeat containing 1 2 2
MIRT608724 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT610392 FOXE1 forkhead box E1 2 2
MIRT610537 FAM46A family with sequence similarity 46 member A 2 4
MIRT610664 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT611258 EHD3 EH domain containing 3 2 2
MIRT612247 MICALL1 MICAL like 1 2 2
MIRT613500 ZNF488 zinc finger protein 488 2 2
MIRT613790 RPS6 ribosomal protein S6 2 2
MIRT613832 SPIRE2 spire type actin nucleation factor 2 2 2
MIRT614357 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT614539 NOA1 nitric oxide associated 1 2 2
MIRT615947 SORD sorbitol dehydrogenase 2 2
MIRT616144 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT617103 MPPE1 metallophosphoesterase 1 2 2
MIRT617383 FAM227A family with sequence similarity 227 member A 2 2
MIRT618126 LACTB lactamase beta 2 4
MIRT618236 PGBD4 piggyBac transposable element derived 4 2 2
MIRT618262 DDX51 DEAD-box helicase 51 2 2
MIRT618286 ZNF682 zinc finger protein 682 2 4
MIRT618316 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT618678 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT619206 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT619658 CORO2A coronin 2A 2 2
MIRT619726 FPR2 formyl peptide receptor 2 2 2
MIRT619870 ZNF347 zinc finger protein 347 2 2
MIRT620129 ZNF283 zinc finger protein 283 2 2
MIRT621087 WDR12 WD repeat domain 12 2 2
MIRT621114 SP110 SP110 nuclear body protein 2 2
MIRT621129 EMC7 ER membrane protein complex subunit 7 2 4
MIRT621236 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT621421 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT621576 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT621689 TSPYL1 TSPY like 1 2 2
MIRT621794 TMEM233 transmembrane protein 233 2 2
MIRT621929 SYAP1 synapse associated protein 1 2 4
MIRT621965 STRIP2 striatin interacting protein 2 2 2
MIRT622102 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT622184 SLC7A14 solute carrier family 7 member 14 2 2
MIRT622238 SLC25A45 solute carrier family 25 member 45 2 2
MIRT622473 RNF11 ring finger protein 11 2 2
MIRT622514 RBM20 RNA binding motif protein 20 2 2
MIRT622523 RAD51 RAD51 recombinase 2 2
MIRT622665 POLQ DNA polymerase theta 2 4
MIRT622699 PLEKHO1 pleckstrin homology domain containing O1 2 2
MIRT622831 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT622873 PDE12 phosphodiesterase 12 2 2
MIRT623031 OCIAD2 OCIA domain containing 2 2 2
MIRT623083 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623303 MARCH7 membrane associated ring-CH-type finger 7 2 2
MIRT623932 FKBP14 FK506 binding protein 14 2 2
MIRT624060 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT624295 COMMD2 COMM domain containing 2 2 2
MIRT624521 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT624824 ACO1 aconitase 1 2 2
MIRT624908 CTCFL CCCTC-binding factor like 2 2
MIRT625154 ZCCHC8 zinc finger CCHC-type containing 8 2 4
MIRT625382 ZNF716 zinc finger protein 716 2 2
MIRT625771 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 4
MIRT625808 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT625835 NXPE2 neurexophilin and PC-esterase domain family member 2 2 2
MIRT626010 ZNF517 zinc finger protein 517 2 2
MIRT626058 AP3M1 adaptor related protein complex 3 mu 1 subunit 2 2
MIRT626116 IL23R interleukin 23 receptor 2 2
MIRT626252 RBM43 RNA binding motif protein 43 2 2
MIRT626350 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT626888 ANGEL1 angel homolog 1 2 2
MIRT627303 WDR31 WD repeat domain 31 2 2
MIRT627597 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT627618 SF3B1 splicing factor 3b subunit 1 2 2
MIRT627630 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT627642 SEC23IP SEC23 interacting protein 2 2
MIRT627651 SAR1A secretion associated Ras related GTPase 1A 2 4
MIRT628388 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628675 C2orf72 chromosome 2 open reading frame 72 2 2
MIRT628780 TMEM154 transmembrane protein 154 2 2
MIRT629181 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT629266 NXPE1 neurexophilin and PC-esterase domain family member 1 2 2
MIRT629307 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT629322 ZNF487P zinc finger protein 487 1 1
MIRT629524 ZNF37A zinc finger protein 37A 2 2
MIRT629611 NOL10 nucleolar protein 10 2 2
MIRT629659 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT629671 USP1 ubiquitin specific peptidase 1 2 2
MIRT629765 STK25 serine/threonine kinase 25 2 2
MIRT630447 IDE insulin degrading enzyme 2 2
MIRT630903 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT631001 ZNF573 zinc finger protein 573 2 2
MIRT631157 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT631178 HCAR1 hydroxycarboxylic acid receptor 1 2 2
MIRT631339 ZNF84 zinc finger protein 84 2 2
MIRT631342 LATS1 large tumor suppressor kinase 1 2 2
MIRT631359 ZFP30 ZFP30 zinc finger protein 2 4
MIRT631461 FBXO47 F-box protein 47 2 2
MIRT631585 ITGAL integrin subunit alpha L 2 2
MIRT631597 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT631643 WDR91 WD repeat domain 91 2 4
MIRT631781 IL17RA interleukin 17 receptor A 2 2
MIRT631858 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT632040 ZNF430 zinc finger protein 430 2 2
MIRT632094 SSR1 signal sequence receptor subunit 1 2 2
MIRT632153 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT632234 VTA1 vesicle trafficking 1 2 2
MIRT632287 TTPAL alpha tocopherol transfer protein like 2 2
MIRT632328 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT632392 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT632412 SLC30A5 solute carrier family 30 member 5 2 2
MIRT632557 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT633066 DENND5B DENN domain containing 5B 2 2
MIRT633185 AAK1 AP2 associated kinase 1 2 2
MIRT633196 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT633220 ZNF584 zinc finger protein 584 2 2
MIRT633343 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT633407 ZNF566 zinc finger protein 566 2 2
MIRT633479 ZNF724P zinc finger protein 724 2 2
MIRT633485 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT633516 LRRC27 leucine rich repeat containing 27 2 2
MIRT633556 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT633659 SLC28A1 solute carrier family 28 member 1 2 2
MIRT633681 ZNF576 zinc finger protein 576 2 2
MIRT633758 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633771 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633776 F2 coagulation factor II, thrombin 2 2
MIRT633803 ZNF91 zinc finger protein 91 2 2
MIRT633813 WDR92 WD repeat domain 92 2 2
MIRT633948 TMEM231 transmembrane protein 231 2 2
MIRT634000 RTN2 reticulon 2 2 2
MIRT634024 MOB4 MOB family member 4, phocein 2 2
MIRT634228 TMEM132B transmembrane protein 132B 2 2
MIRT634320 SLC43A2 solute carrier family 43 member 2 2 2
MIRT634355 RNF157 ring finger protein 157 2 2
MIRT634586 KIAA1958 KIAA1958 2 2
MIRT634748 CRCP CGRP receptor component 2 2
MIRT635409 KIAA1614 KIAA1614 2 2
MIRT635461 GBP4 guanylate binding protein 4 2 2
MIRT635501 CCR4 C-C motif chemokine receptor 4 2 2
MIRT635627 CDT1 chromatin licensing and DNA replication factor 1 2 4
MIRT635646 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT635750 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT635824 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT635969 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT636121 YPEL1 yippee like 1 2 2
MIRT636171 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636194 TCEB1 elongin C 2 2
MIRT636772 CLUAP1 clusterin associated protein 1 2 2
MIRT636799 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT636955 APTX aprataxin 2 2
MIRT637096 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637149 PCDHA6 protocadherin alpha 6 2 2
MIRT637207 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637321 FAM9B family with sequence similarity 9 member B 2 2
MIRT637544 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637632 ZNF431 zinc finger protein 431 2 2
MIRT637658 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637704 ZNF439 zinc finger protein 439 2 2
MIRT637807 GGPS1 geranylgeranyl diphosphate synthase 1 2 2
MIRT637831 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT637907 FAM153B family with sequence similarity 153 member B 2 4
MIRT637953 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT637974 IRF1 interferon regulatory factor 1 2 2
MIRT638026 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT638066 KCNN1 potassium calcium-activated channel subfamily N member 1 2 2
MIRT638197 TAOK1 TAO kinase 1 2 2
MIRT638403 PRR11 proline rich 11 2 2
MIRT638625 GSR glutathione-disulfide reductase 2 4
MIRT638651 GK5 glycerol kinase 5 (putative) 2 2
MIRT638993 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT639000 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT642200 SMAGP small cell adhesion glycoprotein 2 2
MIRT642537 CERS4 ceramide synthase 4 2 2
MIRT643021 LETM2 leucine zipper and EF-hand containing transmembrane protein 2 2 2
MIRT643423 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643459 LAX1 lymphocyte transmembrane adaptor 1 2 4
MIRT643766 NAGK N-acetylglucosamine kinase 2 2
MIRT643892 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT644097 SIAH3 siah E3 ubiquitin protein ligase family member 3 2 2
MIRT644680 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644710 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT644726 SEPT14 septin 14 2 2
MIRT645138 HES2 hes family bHLH transcription factor 2 2 2
MIRT645314 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645561 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT645737 POLR3A RNA polymerase III subunit A 2 2
MIRT646042 NPR1 natriuretic peptide receptor 1 2 2
MIRT646150 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT646362 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT646566 ALDH5A1 aldehyde dehydrogenase 5 family member A1 2 2
MIRT646871 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT647022 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT647104 GNL3L G protein nucleolar 3 like 2 2
MIRT647363 WDR5B WD repeat domain 5B 2 2
MIRT648059 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648088 FAM192A family with sequence similarity 192 member A 2 2
MIRT648152 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT648432 MYOZ3 myozenin 3 2 2
MIRT648451 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT648920 ZNF551 zinc finger protein 551 2 2
MIRT649104 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT649109 RPL37 ribosomal protein L37 2 2
MIRT649259 IMPA2 inositol monophosphatase 2 2 2
MIRT649742 GNB5 G protein subunit beta 5 2 2
MIRT650092 TERF2 telomeric repeat binding factor 2 2 2
MIRT650578 TTR transthyretin 2 2
MIRT650739 FKTN fukutin 2 2
MIRT650871 APOH apolipoprotein H 2 2
MIRT651024 ZNF699 zinc finger protein 699 2 2
MIRT651391 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651526 WNT2B Wnt family member 2B 2 2
MIRT652640 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653261 SOGA3 SOGA family member 3 2 2
MIRT653285 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT653526 SLC38A9 solute carrier family 38 member 9 2 2
MIRT653708 SLC25A33 solute carrier family 25 member 33 2 2
MIRT653826 SHROOM4 shroom family member 4 2 2
MIRT653888 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT654217 RNF19B ring finger protein 19B 2 2
MIRT654848 PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K 2 2
MIRT655370 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT655520 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT656962 KIAA0408 KIAA0408 2 2
MIRT657048 KCNH6 potassium voltage-gated channel subfamily H member 6 2 2
MIRT657113 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT657198 IKZF3 IKAROS family zinc finger 3 2 2
MIRT657269 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT657317 HOOK3 hook microtubule tethering protein 3 2 2
MIRT657365 HMGB1 high mobility group box 1 2 2
MIRT657522 GTF2H5 general transcription factor IIH subunit 5 2 4
MIRT657535 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT659037 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659590 CEP135 centrosomal protein 135 2 2
MIRT659801 CAV2 caveolin 2 2 2
MIRT659947 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT660693 ANAPC1 anaphase promoting complex subunit 1 2 4
MIRT660951 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT660989 ABHD2 abhydrolase domain containing 2 2 2
MIRT661410 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 2 2
MIRT661524 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT661752 ATM ATM serine/threonine kinase 2 2
MIRT662158 ALDH7A1 aldehyde dehydrogenase 7 family member A1 2 2
MIRT663363 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT663513 AGMO alkylglycerol monooxygenase 2 2
MIRT663533 ZNF70 zinc finger protein 70 2 2
MIRT663633 HM13 histocompatibility minor 13 2 2
MIRT663760 ZNF285 zinc finger protein 285 2 2
MIRT663841 TRIM72 tripartite motif containing 72 2 2
MIRT664024 C9orf139 chromosome 9 open reading frame 139 2 2
MIRT664049 ANKRD62 ankyrin repeat domain 62 2 2
MIRT664118 C4orf32 family with sequence similarity 241 member A 2 2
MIRT664280 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT664642 GALM galactose mutarotase 2 2
MIRT664685 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT664764 MESDC2 mesoderm development LRP chaperone 2 2
MIRT665281 ZFP14 ZFP14 zinc finger protein 2 2
MIRT665874 TGOLN2 trans-golgi network protein 2 2 2
MIRT666194 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666416 SH3D19 SH3 domain containing 19 2 2
MIRT666917 POC1A POC1 centriolar protein A 2 2
MIRT666946 PLSCR1 phospholipid scramblase 1 2 2
MIRT667064 PAOX polyamine oxidase 2 2
MIRT667090 OSTF1 osteoclast stimulating factor 1 2 2
MIRT667677 KPNA6 karyopherin subunit alpha 6 2 2
MIRT667790 KARS lysyl-tRNA synthetase 2 2
MIRT668268 FOXO3 forkhead box O3 2 2
MIRT668555 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT668830 CYCS cytochrome c, somatic 2 2
MIRT669087 CDX2 caudal type homeobox 2 2 2
MIRT669397 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT669571 AKIRIN1 akirin 1 2 2
MIRT669761 ZNF101 zinc finger protein 101 2 2
MIRT669802 GAN gigaxonin 2 2
MIRT669811 STOML1 stomatin like 1 2 2
MIRT669869 MELK maternal embryonic leucine zipper kinase 2 2
MIRT669928 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT669952 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT670052 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670100 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT670302 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670391 EMP2 epithelial membrane protein 2 2 2
MIRT670487 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670537 KIF1C kinesin family member 1C 2 2
MIRT670608 NPHP1 nephrocystin 1 2 2
MIRT670789 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT670885 CYTIP cytohesin 1 interacting protein 2 2
MIRT670936 LIPG lipase G, endothelial type 2 2
MIRT671267 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671307 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671518 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 2
MIRT671628 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT671683 ADK adenosine kinase 2 2
MIRT671786 RGS17 regulator of G protein signaling 17 2 2
MIRT671811 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT672006 SLC35F6 solute carrier family 35 member F6 2 4
MIRT672106 TLCD2 TLC domain containing 2 2 2
MIRT672238 ABHD15 abhydrolase domain containing 15 2 2
MIRT672274 SHE Src homology 2 domain containing E 2 2
MIRT672325 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT672696 ZNF677 zinc finger protein 677 2 2
MIRT672817 VEZT vezatin, adherens junctions transmembrane protein 2 2
MIRT672863 C22orf29 retrotransposon Gag like 10 2 2
MIRT672891 FXN frataxin 2 2
MIRT672980 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT673256 INO80 INO80 complex subunit 2 2
MIRT673400 WNT7B Wnt family member 7B 2 2
MIRT673527 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT673544 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674004 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674018 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT674249 NUP62 nucleoporin 62 2 4
MIRT674358 SLC35E3 solute carrier family 35 member E3 2 2
MIRT674708 FAM73A mitoguardin 1 2 2
MIRT674911 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT675200 ZNF554 zinc finger protein 554 2 2
MIRT675295 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT675374 DCTN5 dynactin subunit 5 2 2
MIRT675446 TPCN2 two pore segment channel 2 2 2
MIRT675473 NUBPL nucleotide binding protein like 2 2
MIRT675672 TMOD2 tropomodulin 2 2 2
MIRT675684 SLC35F5 solute carrier family 35 member F5 2 2
MIRT675789 MED28 mediator complex subunit 28 2 2
MIRT675834 DHODH dihydroorotate dehydrogenase (quinone) 2 4
MIRT675979 FAM126B family with sequence similarity 126 member B 2 2
MIRT676090 DPP9 dipeptidyl peptidase 9 2 2
MIRT676100 ZNF667 zinc finger protein 667 2 2
MIRT676132 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT676171 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT676243 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676293 SLC25A37 solute carrier family 25 member 37 2 2
MIRT676310 GTF2H2C GTF2H2 family member C 2 2
MIRT676341 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT676389 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676441 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676520 RNF216 ring finger protein 216 2 2
MIRT676584 RDH13 retinol dehydrogenase 13 2 4
MIRT676611 KDSR 3-ketodihydrosphingosine reductase 2 2
MIRT676692 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT676699 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT676745 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT676765 SNX2 sorting nexin 2 2 2
MIRT676778 NPHS1 NPHS1, nephrin 2 2
MIRT676799 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT676859 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT676881 ENSA endosulfine alpha 2 2
MIRT676948 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT676962 HFE hemochromatosis 2 2
MIRT677010 HINFP histone H4 transcription factor 2 2
MIRT677049 ZNF34 zinc finger protein 34 2 2
MIRT677075 VMAC vimentin type intermediate filament associated coiled-coil protein 2 2
MIRT677097 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677130 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 2 2
MIRT677170 ZNF786 zinc finger protein 786 2 2
MIRT677219 RASSF6 Ras association domain family member 6 2 2
MIRT677238 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677408 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT677428 DDX19B DEAD-box helicase 19B 2 2
MIRT677436 NSMCE2 NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase 2 2
MIRT677467 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677489 GTF2H2 general transcription factor IIH subunit 2 2 2
MIRT677555 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677583 TRIM65 tripartite motif containing 65 2 2
MIRT677602 PRKX protein kinase, X-linked 2 2
MIRT677650 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677702 GINS2 GINS complex subunit 2 2 2
MIRT677764 GRM6 glutamate metabotropic receptor 6 2 2
MIRT677788 CEACAM5 carcinoembryonic antigen related cell adhesion molecule 5 2 2
MIRT677814 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT677891 DCP1A decapping mRNA 1A 2 2
MIRT677921 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT677944 ZNF519 zinc finger protein 519 2 2
MIRT677989 GATC glutamyl-tRNA amidotransferase subunit C 2 2
MIRT678015 SPIC Spi-C transcription factor 2 2
MIRT678068 UBN2 ubinuclein 2 2 2
MIRT678084 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678128 METTL21A methyltransferase like 21A 2 2
MIRT678147 SLC4A4 solute carrier family 4 member 4 2 2
MIRT678156 IRGQ immunity related GTPase Q 2 2
MIRT678224 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT678327 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678357 PPAP2B phospholipid phosphatase 3 2 2
MIRT678401 MYPN myopalladin 2 2
MIRT678421 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678434 PDE4C phosphodiesterase 4C 2 2
MIRT678444 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT678493 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678507 LCTL lactase like 2 2
MIRT678526 P2RX7 purinergic receptor P2X 7 2 2
MIRT678534 TMEM78 transmembrane protein 78 2 2
MIRT678570 CDK4 cyclin dependent kinase 4 2 2
MIRT678608 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT678642 PDCD4 programmed cell death 4 2 2
MIRT678702 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT678724 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678764 CEP76 centrosomal protein 76 2 2
MIRT678814 HRH4 histamine receptor H4 2 2
MIRT678880 FAM118A family with sequence similarity 118 member A 2 2
MIRT678905 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT678946 MYADM myeloid associated differentiation marker 2 2
MIRT678960 ZNF329 zinc finger protein 329 2 2
MIRT678972 OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 2 2
MIRT679067 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT679072 MANEAL mannosidase endo-alpha like 2 2
MIRT679084 PURB purine rich element binding protein B 2 2
MIRT679115 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT679155 ZDHHC15 zinc finger DHHC-type containing 15 2 2
MIRT679177 FFAR4 free fatty acid receptor 4 2 2
MIRT679183 XIAP X-linked inhibitor of apoptosis 2 4
MIRT679224 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679234 LRP10 LDL receptor related protein 10 2 2
MIRT679271 POLM DNA polymerase mu 2 2
MIRT679279 MIPOL1 mirror-image polydactyly 1 2 2
MIRT679345 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT679352 LRG1 leucine rich alpha-2-glycoprotein 1 2 2
MIRT679365 SIK2 salt inducible kinase 2 2 2
MIRT679493 ZNF106 zinc finger protein 106 2 2
MIRT679600 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT679636 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT679650 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT679713 RPL24 ribosomal protein L24 2 2
MIRT679762 TLR6 toll like receptor 6 2 2
MIRT679766 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT679807 APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A 2 2
MIRT679821 TMEM106B transmembrane protein 106B 2 2
MIRT679949 AS3MT arsenite methyltransferase 2 2
MIRT679967 FGFR1OP FGFR1 oncogene partner 2 2
MIRT679992 RUNDC1 RUN domain containing 1 2 2
MIRT680063 CD96 CD96 molecule 2 2
MIRT680079 THAP1 THAP domain containing 1 2 2
MIRT680100 PXMP4 peroxisomal membrane protein 4 2 2
MIRT680138 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT680146 TOP3A DNA topoisomerase III alpha 2 2
MIRT680324 LRRC58 leucine rich repeat containing 58 2 2
MIRT680414 RNF165 ring finger protein 165 2 2
MIRT680451 PDE6A phosphodiesterase 6A 2 2
MIRT680460 TAS2R5 taste 2 receptor member 5 2 2
MIRT683249 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT685083 HPSE heparanase 2 2
MIRT686255 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT687366 NUP155 nucleoporin 155 2 2
MIRT688320 FAM151B family with sequence similarity 151 member B 2 2
MIRT688390 ENAH ENAH, actin regulator 2 2
MIRT688430 DNAL1 dynein axonemal light chain 1 2 2
MIRT688643 CREM cAMP responsive element modulator 2 2
MIRT688739 CNDP1 carnosine dipeptidase 1 2 2
MIRT689335 FPR1 formyl peptide receptor 1 2 4
MIRT690685 PTCHD3 patched domain containing 3 2 2
MIRT690956 APOL1 apolipoprotein L1 2 2
MIRT691727 LARS leucyl-tRNA synthetase 2 2
MIRT693472 ZNF707 zinc finger protein 707 2 2
MIRT693959 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT695487 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT696596 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT697024 EPDR1 ependymin related 1 2 2
MIRT698140 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT699106 SNIP1 Smad nuclear interacting protein 1 2 2
MIRT699817 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT701535 NCKAP1 NCK associated protein 1 2 2
MIRT702897 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT705035 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT706023 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706039 F2R coagulation factor II thrombin receptor 2 2
MIRT706102 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706311 CCDC30 coiled-coil domain containing 30 2 2
MIRT706345 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706400 HAS2 hyaluronan synthase 2 2 2
MIRT706436 LIAS lipoic acid synthetase 2 2
MIRT709396 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT710345 ZNF669 zinc finger protein 669 2 2
MIRT710725 C19orf68 zinc finger SWIM-type containing 9 2 2
MIRT711276 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 2 2
MIRT711862 TRAF2 TNF receptor associated factor 2 2 2
MIRT711921 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT712060 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT712593 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT712903 TGFA transforming growth factor alpha 2 2
MIRT713297 DCP2 decapping mRNA 2 2 2
MIRT714801 WDPCP WD repeat containing planar cell polarity effector 2 2
MIRT715314 POLR2E RNA polymerase II subunit E 2 2
MIRT715727 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT717606 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT717877 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT718484 TMEM151A transmembrane protein 151A 2 2
MIRT720439 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT721563 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT721698 TFAP2B transcription factor AP-2 beta 2 2
MIRT722525 PLXNA2 plexin A2 2 2
MIRT722758 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723297 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT723407 NLRP10 NLR family pyrin domain containing 10 2 2
MIRT724218 RAB6B RAB6B, member RAS oncogene family 2 2
MIRT724422 FGF2 fibroblast growth factor 2 2 2
MIRT756017 AMBRA1 autophagy and beclin 1 regulator 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3653 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-3653 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3653 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3653 Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-3653 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-3653 Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-3653 Platinum 23939 resistant tissue
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3653 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3653-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-3653-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission