>SRP68|NM_014230|3'UTR
   1 CCAGGCTCTTCCTCGGGGGCGGGGGAGATTCTGACTCTTAATCTGTATTGTGAGAAAATCCCAGCAAGTTCCATGATATT
  81 AAATCCAGGTCTGCATTGGCCCGGGGCAAGAGTTTAACATCTTCGGCCCTGCATTCCTACATCTTGTGTCTGTACACGTT
 161 CTTAAGCAGCGTGTCAGGAGAGCACCCTGTTGTCTTCTGGTAAATGTGTGCAGGGTCATCCTGTCTCCTGTACCTCCTGG
 241 GAAAGGGGCCGCTGCTGTCTGGTGCCCTGTGAGCTGTGATTGATTGCCTTTGGTCAGTAATGCGTTCAGGAGTCCACACC
 321 AGGCACAGATGGGGCCTTGAAACGCTTTGTCATGCTTCTTCAGTACCATGGATTTGAAATGAACTCATCCTTGCTGTGAG
 401 CATCCAGGAGCCCTTGAGAAGTTTATCTATGACTATGAAACTGGCAACGTCACCCCAGAATTACGGTCAGCCTTATTCCC
 481 CTTCACCTCCCAGTGAACGCTAAGAAGTTTCAGACAAGCAGAGAGCTCTATTTTTAGAAGAAATATGTTACACTCAGAAA
 561 TGATGAAACCAAATCTTATATTAAAAGGCAAAGATGACGGAGACTGTGCCCATTTCTTATATGCCCTCCCTCATGTCCAG
 641 TCCCCGTTCTCTCCTCGGGAGCCTAGTTGCGTGAAGCCGGTGAGGTCAAGTGTAACCTGACTTACCGGCAACTAGGTGAG
 721 GCTGATGCCAGATACACATGTTAGAGGCACTATTTTTCAGGACTTCCCAATGTGTAATTTTTAGATGCCATTATATTTTA
 801 ATCCCCTTCGTTACCCCCCGTTTTTCCTTAGTCATCCCTTTTCACTTCTATTATAACATCAATAATAGAAGTCACAAAAA
 881 CAATGTAAGAAAGCAAGGAATAAAAGTGATTTAAACATGTACCTGACACTT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuuCGAAAACCA-----U---UAAGUCCa 5' || |||||| | :|||||| Target 5' attGCCTTTGGTCAGTAATGCGTTCAGGa 3'	283 - 311	138.00	-12.00
2	miRNA 3' uuucgaaaaccauuAAGUCCa 5' |||||| Target 5' tagaggcactatttTTCAGGa 3'	742 - 762	120.00	-8.09
3	miRNA 3' uuuCGAAAACCAUUAAGUCCa 5' | | || ||| |||| Target 5' catGATATT--AAATCCAGGt 3'	72 - 90	114.00	-6.00

Mutant ID	Mutant Position	Mutant Source
COSN30501538	14	COSMIC
COSN30505581	15	COSMIC
COSN13748145	20	COSMIC
COSN30164981	33	COSMIC
COSN30106799	146	COSMIC
COSN31574239	147	COSMIC
COSN31601363	148	COSMIC
COSN28632914	244	COSMIC
COSN31515322	250	COSMIC
COSN31540141	293	COSMIC
COSN20833398	389	COSMIC
COSN31542567	398	COSMIC
COSN21137044	454	COSMIC
COSN30166407	471	COSMIC
COSN6112142	599	COSMIC
COSN25843966	600	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs761596184	6	dbSNP
rs1466594976	7	dbSNP
rs112089079	9	dbSNP
rs374662066	14	dbSNP
rs768642199	15	dbSNP
rs1194391640	18	dbSNP
rs760214725	19	dbSNP
rs575532025	20	dbSNP
rs759623224	21	dbSNP
rs778723592	24	dbSNP
rs780422282	26	dbSNP
rs1178949036	27	dbSNP
rs1045404174	36	dbSNP
rs1256025804	37	dbSNP
rs771354753	42	dbSNP
rs1321765805	43	dbSNP
rs1461322944	47	dbSNP
rs1296174417	49	dbSNP
rs948427428	57	dbSNP
rs1426292019	63	dbSNP
rs895390691	65	dbSNP
rs1055749719	66	dbSNP
rs561797576	68	dbSNP
rs942298849	73	dbSNP
rs1490642923	74	dbSNP
rs1291547290	77	dbSNP
rs759767479	86	dbSNP
rs893009095	88	dbSNP
rs909360933	89	dbSNP
rs16968440	96	dbSNP
rs372558258	101	dbSNP
rs746195039	102	dbSNP
rs766573217	103	dbSNP
rs148213973	104	dbSNP
rs143358764	107	dbSNP
rs1334749522	108	dbSNP
rs948720776	109	dbSNP
rs976107987	110	dbSNP
rs1427500540	115	dbSNP
rs965108777	123	dbSNP
rs1017614088	124	dbSNP
rs534330976	125	dbSNP
rs1038422784	133	dbSNP
rs760727336	139	dbSNP
rs1454650331	141	dbSNP
rs1031482839	146	dbSNP
rs908745049	149	dbSNP
rs1361597482	156	dbSNP
rs578031125	157	dbSNP
rs773326228	158	dbSNP
rs771359003	161	dbSNP
rs1024093176	163	dbSNP
rs193095455	170	dbSNP
rs189224939	171	dbSNP
rs1326195193	172	dbSNP
rs1038057648	176	dbSNP
rs976167468	183	dbSNP
rs1485380156	185	dbSNP
rs1184378767	189	dbSNP
rs749252996	194	dbSNP
rs888058459	209	dbSNP
rs1047871677	212	dbSNP
rs1460135093	217	dbSNP
rs764457133	226	dbSNP
rs929509452	230	dbSNP
rs1427124581	234	dbSNP
rs7409	244	dbSNP
rs775165111	245	dbSNP
rs1344652084	249	dbSNP
rs957103323	250	dbSNP
rs1290878847	251	dbSNP
rs568050997	252	dbSNP
rs1404725901	257	dbSNP
rs976532504	264	dbSNP
rs943472742	269	dbSNP
rs1226249723	273	dbSNP
rs1220314482	276	dbSNP
rs1378072745	285	dbSNP
rs1309532236	288	dbSNP
rs1447903667	290	dbSNP
rs1379599822	296	dbSNP
rs758753433	299	dbSNP
rs910512948	300	dbSNP
rs990182553	301	dbSNP
rs1442168195	303	dbSNP
rs773765318	304	dbSNP
rs1167075374	310	dbSNP
rs1403682125	313	dbSNP
rs1384781238	315	dbSNP
rs907127916	317	dbSNP
rs555594281	318	dbSNP
rs1441273940	319	dbSNP
rs1236179238	326	dbSNP
rs1013334869	329	dbSNP
rs750691748	334	dbSNP
rs1247947217	335	dbSNP
rs1218650923	337	dbSNP
rs1478990519	339	dbSNP
rs1358118020	341	dbSNP
rs17498898	343	dbSNP
rs1241907876	344	dbSNP
rs1271175518	352	dbSNP
rs1038372221	354	dbSNP
rs1230112139	363	dbSNP
rs1363408985	368	dbSNP
rs1031630102	388	dbSNP
rs1305371253	392	dbSNP
rs778400917	393	dbSNP
rs1369000025	394	dbSNP
rs1295817779	399	dbSNP
rs1434336964	401	dbSNP
rs1365071845	406	dbSNP
rs1367819386	407	dbSNP
rs756619254	410	dbSNP
rs977252724	411	dbSNP
rs1279517133	417	dbSNP
rs566173675	418	dbSNP
rs183926322	425	dbSNP
rs1024153732	429	dbSNP
rs1310792124	433	dbSNP
rs934149758	435	dbSNP
rs922854623	436	dbSNP
rs1442193720	441	dbSNP
rs1289386007	442	dbSNP
rs975654646	448	dbSNP
rs781082742	449	dbSNP
rs1444259635	452	dbSNP
rs1232239859	453	dbSNP
rs780885220	454	dbSNP
rs989754147	455	dbSNP
rs1013053756	464	dbSNP
rs1444284793	465	dbSNP
rs75533415	471	dbSNP
rs1416175350	479	dbSNP
rs1407758520	491	dbSNP
rs570440866	498	dbSNP
rs977666939	499	dbSNP
rs757020999	506	dbSNP
rs1376965312	508	dbSNP
rs1451217209	511	dbSNP
rs1312503921	515	dbSNP
rs1024555388	517	dbSNP
rs1016993628	525	dbSNP
rs1012871610	543	dbSNP
rs1272011013	546	dbSNP
rs781247230	546	dbSNP
rs550765776	554	dbSNP
rs1200424053	555	dbSNP
rs1171377898	560	dbSNP
rs530590031	563	dbSNP
rs1181755594	565	dbSNP
rs1239441936	571	dbSNP
rs1473240115	575	dbSNP
rs1048005241	578	dbSNP
rs1467687102	579	dbSNP
rs887205838	586	dbSNP
rs1181482720	594	dbSNP
rs1047145196	598	dbSNP
rs934157391	599	dbSNP
rs376294563	609	dbSNP
rs1448296405	615	dbSNP
rs149195459	619	dbSNP
rs777459498	626	dbSNP
rs1040558566	632	dbSNP
rs1258632826	634	dbSNP
rs915467700	638	dbSNP
rs943422460	645	dbSNP
rs910657972	646	dbSNP
rs1443252504	655	dbSNP
rs924365773	656	dbSNP
rs1479024883	660	dbSNP
rs1194754787	667	dbSNP
rs755260173	670	dbSNP
rs191968491	671	dbSNP
rs1384710382	677	dbSNP
rs924611153	678	dbSNP
rs1337059735	689	dbSNP
rs1451419711	690	dbSNP
rs977304551	701	dbSNP
rs1319661605	705	dbSNP
rs187572832	706	dbSNP
rs958630654	707	dbSNP
rs1016834513	709	dbSNP
rs1402979850	710	dbSNP
rs1276736183	711	dbSNP
rs560518350	712	dbSNP
rs1158364615	714	dbSNP
rs917047450	715	dbSNP
rs753273931	716	dbSNP
rs540241325	717	dbSNP
rs1489360944	721	dbSNP
rs1438305319	722	dbSNP
rs1387438760	725	dbSNP
rs1217880926	727	dbSNP
rs1479766846	730	dbSNP
rs991362043	737	dbSNP
rs1184496230	738	dbSNP
rs1461004456	740	dbSNP
rs958687039	742	dbSNP
rs1478089410	744	dbSNP
rs769352217	746	dbSNP
rs1447530857	752	dbSNP
rs1283548478	762	dbSNP
rs1026064604	763	dbSNP
rs1364707634	769	dbSNP
rs146598115	770	dbSNP
rs1331542100	776	dbSNP
rs1238439434	785	dbSNP
rs901232721	793	dbSNP
rs1039889984	795	dbSNP
rs1315446037	796	dbSNP
rs1291572179	806	dbSNP
rs182618167	809	dbSNP
rs76087693	810	dbSNP
rs1437740168	817	dbSNP
rs1180549759	818	dbSNP
rs1025271654	819	dbSNP
rs575708898	820	dbSNP
rs776194002	820	dbSNP
rs1158894165	821	dbSNP
rs935582300	832	dbSNP
rs1456202735	835	dbSNP
rs766598331	836	dbSNP
rs760925509	837	dbSNP
rs1007763596	838	dbSNP
rs1329441522	839	dbSNP
rs34618582	839	dbSNP
rs555532927	839	dbSNP
rs889199616	846	dbSNP
rs977479066	847	dbSNP
rs1314673150	848	dbSNP
rs1054507725	850	dbSNP
rs1247512754	854	dbSNP
rs770845907	856	dbSNP
rs936080245	858	dbSNP
rs1194560693	862	dbSNP
rs1240515096	877	dbSNP
rs1458736225	894	dbSNP
rs958495297	894	dbSNP
rs535795208	897	dbSNP
rs1242160249	908	dbSNP
rs566805207	917	dbSNP
rs746715622	918	dbSNP
rs1421676827	919	dbSNP
rs1189442142	922	dbSNP

- Cell host & microbe, 2011

Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.

- Nature methods, 2013

High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.