miRTarBase - #MIRT442397


—
pre-miRNA Information
pre-miRNA hsa-mir-548f-1   
Genomic Coordinates chr10: 54607874 - 54607957
Synonyms MIR548F-1, MIRN548F1, hsa-mir-548f-1, MIR548F1
Description Homo sapiens miR-548f-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-548f-2   
Genomic Coordinates chr2: 212426263 - 212426360
Synonyms MIR548F-2, MIRN548F2, hsa-mir-548f-2, MIR548F2
Description Homo sapiens miR-548f-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-548f-3   
Genomic Coordinates chr5: 110513829 - 110513915
Synonyms MIR548F-3, MIRN548F3, hsa-mir-548f-3, MIR548F3
Description Homo sapiens miR-548f-3 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-548f-4   
Genomic Coordinates chr7: 147378017 - 147378121
Synonyms MIR548F-4, MIRN548F4, hsa-mir-548f-4, MIR548F4
Description Homo sapiens miR-548f-4 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-548f-5   
Genomic Coordinates chrX: 32641474 - 32641559
Synonyms MIR548F-5, MIRN548F5, hsa-mir-548f-5, MIR548F5
Description Homo sapiens miR-548f-5 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548f-3p
Sequence 59| AAAAACUGUAAUUACUUUU |77
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 10 - 54607905 29233923 MiREDiBase
A-to-I 4 10 - 54607904 29233923 MiREDiBase
A-to-I 5 10 - 54607903 29233923 MiREDiBase
A-to-I 10 10 - 54607898 29233923 MiREDiBase
A-to-I 3 2 - 212426300 29233923 MiREDiBase
A-to-I 4 2 - 212426299 29233923 MiREDiBase
A-to-I 5 2 - 212426298 29233923 MiREDiBase
A-to-I 3 5 - 110513860 29233923 MiREDiBase
A-to-I 4 5 - 110513859 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26988089 5 COSMIC
COSN30456990 6 COSMIC
COSN15625252 6 COSMIC
COSN31522782 7 COSMIC
COSN31545996 8 COSMIC
COSN31570212 9 COSMIC
COSN1084275 12 COSMIC
COSN15625251 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs966876049 1 dbSNP
rs1321394893 2 dbSNP
rs923504759 3 dbSNP
rs1168522027 5 dbSNP
rs1187070531 5 dbSNP
rs1485986292 6 dbSNP
rs776299100 6 dbSNP
rs1421488925 6 dbSNP
rs748224431 6 dbSNP
rs1262049804 7 dbSNP
rs1258250226 7 dbSNP
rs568151991 8 dbSNP
rs1233367754 8 dbSNP
rs778777095 9 dbSNP
rs760758823 9 dbSNP
rs1330282349 10 dbSNP
rs749737324 10 dbSNP
rs760103713 10 dbSNP
rs754285569 10 dbSNP
rs756628155 10 dbSNP
rs1380895949 10 dbSNP
rs768673400 12 dbSNP
rs1478761955 13 dbSNP
rs1437534303 15 dbSNP
rs749009182 15 dbSNP
rs773271422 15 dbSNP
rs747569615 15 dbSNP
rs779944053 16 dbSNP
rs771761319 16 dbSNP
rs1159501553 18 dbSNP
rs757404662 19 dbSNP
rs1191871489 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ILDR1   
Synonyms DFNB42, ILDR1alpha, ILDR1alpha', ILDR1beta
Description immunoglobulin like domain containing receptor 1
Transcript NM_175924   
Expression
Putative miRNA Targets on ILDR1
3'UTR of ILDR1
(miRNA target sites are highlighted)		 
>ILDR1|NM_175924|3'UTR
   1 TCACCAAGCACAGCACAACTTCTGTGGCTACTTCTCGGCTCCTGTGTGTCATCAGCATCACCTAGGTTTCCAGCTGACTT
  81 GGGAACTGCAAGTCTGAGTCTAACAGTTTTTGGCTTAGATTCTGAGAATCAAATAGAAGAATTTTAAATACAAGAGTTTG
 161 AGATTGGGTATAGTGGCTCACACCTGTAATCACAGCACTTTGGGAGGCTAAGAATCACTTGAGACTAGGAGTTCAAGATC
 241 AGCCTGGGAAACATAGTGAGACCCCGTCTCTACAAAAAATATAAAAATTAGTTAGGTGTGGTGGCATGCACTTGTAGTCC
 321 CAGCTACTCAAGAGGCTGAGGCAGAAGGATCCCTTGAGCCCAGGAGTGCAAGGCTGCAATGAGCCAGGATCCCATGATCA
 401 CACATCTGTATTCCAGCCTGGGCAATAGAGCAAGTCCCCATTACTAAAAAACCCAAAAGGCCAAAAAACAAAAAAGTTAG
 481 AGTTCGAGGAATTACCAACTGTAGTTTTAGCCTTGGTTCATGCTCTCTTGCATATTTATATAATCTCTGACTTGTAATGG
 561 ACCCTGACTGGAATGTGATCCCTCAGGAACTTAGTAGCCTGAGTCTTTCAGTAGACTACACTGCCCAGAACCCTGGCCAT
 641 TCTCAAAATGAGAACTTGGGAATGTTTAAGAAGAAATCAAACATGTTTCAGGAAAAGGAAATCTATGGAGTATTATAGGG
 721 ACATTCCCATGGGAATGTATCTTCCTCCATGGCATGTCTTGAGGGTCCTTTCTTGTTAGGAGTTTATCCTGCCAGCCCAT
 801 AAATGGACTATTTATTGTAAGTGTAGAAAATCACAGAGAAGCAGTTTTGCACCAGCCTTATTCCTGTGCCTTGTTTTCCT
 881 CTTGCTCTTTTTTTACCTGTATATCTAATTTATATTTTCATATATATTGTGTATTGATTGAAGTCACTTTAAATCCTTCT
 961 TGGGAATGACACAGTATATAAATAAGGAAGAAAGAAAACATGCCAAGCTGAGCATGCTGCTCCAAATAAATATCTGCTTT
1041 CCTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuUUCA---UUA-A-UGUCAAAAa 5'
            ||||   |:| | |||||||| 
Target 5' gcAAGTCTGAGTCTAACAGTTTTt 3'
 88 - 111 153.00 -8.00
2 
miRNA  3' uuUUCAUUAAUGUCAAAAa 5'
            :|| ||  :||||||| 
Target 5' caGAG-AA--GCAGTTTTg 3'
 834 - 849 144.00 -5.30
3 
miRNA  3' uuuuCAUUAAU---GUCAAAaa 5'
              ||||| |   || |||  
Target 5' acctGTAATCACAGCACTTTgg 3'
 182 - 203 103.00 -5.35
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
667248 11 ClinVar
1203287 266 ClinVar
COSN31482179 36 COSMIC
COSN30507104 42 COSMIC
COSN31511695 66 COSMIC
COSN30450884 70 COSMIC
COSN30453107 83 COSMIC
COSN30155597 94 COSMIC
COSN30451144 106 COSMIC
COSN31530545 107 COSMIC
COSN30167858 139 COSMIC
COSN1083322 142 COSMIC
COSN26494605 728 COSMIC
COSN9234277 994 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1191276930 6 dbSNP
rs775202902 11 dbSNP
rs150481354 15 dbSNP
rs1478259133 16 dbSNP
rs1239773407 17 dbSNP
rs372428576 19 dbSNP
rs776792036 20 dbSNP
rs1330769400 24 dbSNP
rs1465610620 25 dbSNP
rs1285978544 26 dbSNP
rs771356103 31 dbSNP
rs747424761 37 dbSNP
rs894413796 41 dbSNP
rs1398494643 52 dbSNP
rs999250175 53 dbSNP
rs202226862 55 dbSNP
rs1341571953 60 dbSNP
rs1218845091 61 dbSNP
rs1183120795 71 dbSNP
rs1442824983 72 dbSNP
rs1324737190 79 dbSNP
rs867664610 83 dbSNP
rs201749129 91 dbSNP
rs778320546 92 dbSNP
rs185522579 94 dbSNP
rs748223411 99 dbSNP
rs755137709 105 dbSNP
rs903932637 106 dbSNP
rs754067165 119 dbSNP
rs767179327 128 dbSNP
rs1378159683 130 dbSNP
rs757100881 131 dbSNP
rs754309930 132 dbSNP
rs141335434 133 dbSNP
rs1196029831 134 dbSNP
rs763038125 136 dbSNP
rs1466013297 138 dbSNP
rs1037619352 148 dbSNP
rs775080019 154 dbSNP
rs1207588772 167 dbSNP
rs759223170 170 dbSNP
rs941380433 173 dbSNP
rs1418383192 181 dbSNP
rs1275973261 187 dbSNP
rs571262745 190 dbSNP
rs1047474505 191 dbSNP
rs1329848609 192 dbSNP
rs930052001 193 dbSNP
rs1290221778 195 dbSNP
rs1365093984 196 dbSNP
rs776379104 197 dbSNP
rs922641725 206 dbSNP
rs976240063 209 dbSNP
rs753549007 212 dbSNP
rs550947393 216 dbSNP
rs1488460646 219 dbSNP
rs1218548577 237 dbSNP
rs910836218 243 dbSNP
rs964199018 244 dbSNP
rs911492468 254 dbSNP
rs1269538361 257 dbSNP
rs1437977474 262 dbSNP
rs1158515519 263 dbSNP
rs1381504068 265 dbSNP
rs181628071 266 dbSNP
rs371813355 266 dbSNP
rs549594681 266 dbSNP
rs565610957 268 dbSNP
rs764562889 278 dbSNP
rs1435294005 280 dbSNP
rs1299736060 291 dbSNP
rs1372459991 292 dbSNP
rs1443952115 296 dbSNP
rs1462286273 307 dbSNP
rs761032107 309 dbSNP
rs1371448050 311 dbSNP
rs1163128819 312 dbSNP
rs1308379564 312 dbSNP
rs1354363256 314 dbSNP
rs951787435 329 dbSNP
rs373788728 333 dbSNP
rs138335629 361 dbSNP
rs189041551 363 dbSNP
rs1419074136 368 dbSNP
rs1248688619 373 dbSNP
rs1249020225 376 dbSNP
rs999114876 377 dbSNP
rs1178141531 383 dbSNP
rs1238911737 384 dbSNP
rs1442069056 386 dbSNP
rs970455560 394 dbSNP
rs1024679873 396 dbSNP
rs1406326983 399 dbSNP
rs563334520 404 dbSNP
rs1164964406 407 dbSNP
rs1396248077 408 dbSNP
rs1012071018 426 dbSNP
rs772444510 445 dbSNP
rs1330049778 452 dbSNP
rs775889751 452 dbSNP
rs768023200 454 dbSNP
rs1444277796 458 dbSNP
rs1403730 460 dbSNP
rs1290615496 461 dbSNP
rs1403729 462 dbSNP
rs574405506 465 dbSNP
rs1219732238 469 dbSNP
rs1037912911 470 dbSNP
rs1006149312 471 dbSNP
rs759586255 475 dbSNP
rs1316262003 479 dbSNP
rs1024124235 485 dbSNP
rs530892554 486 dbSNP
rs1439704350 488 dbSNP
rs1208561864 490 dbSNP
rs958864459 501 dbSNP
rs1034308459 511 dbSNP
rs1237694203 513 dbSNP
rs1315108357 514 dbSNP
rs1000523178 517 dbSNP
rs1476620909 520 dbSNP
rs565305925 521 dbSNP
rs1400384732 524 dbSNP
rs1047095709 530 dbSNP
rs1332058363 531 dbSNP
rs929957411 532 dbSNP
rs1391790004 533 dbSNP
rs1043721475 534 dbSNP
rs746000667 536 dbSNP
rs1009583474 540 dbSNP
rs892575339 545 dbSNP
rs145679236 552 dbSNP
rs1294878015 559 dbSNP
rs1338228093 574 dbSNP
rs1302797123 591 dbSNP
rs1279087545 602 dbSNP
rs774388190 603 dbSNP
rs1217566546 619 dbSNP
rs1278484322 623 dbSNP
rs771213886 625 dbSNP
rs1403268325 627 dbSNP
rs1213697339 634 dbSNP
rs1040509110 639 dbSNP
rs911412928 644 dbSNP
rs1163970934 649 dbSNP
rs990026660 651 dbSNP
rs1453114884 655 dbSNP
rs958322828 658 dbSNP
rs924150893 662 dbSNP
rs1423917477 664 dbSNP
rs1414957949 684 dbSNP
rs1362606812 687 dbSNP
rs1161858710 693 dbSNP
rs1420071144 697 dbSNP
rs749499621 703 dbSNP
rs944929814 706 dbSNP
rs970362185 707 dbSNP
rs1024710777 712 dbSNP
rs910794198 713 dbSNP
rs1050662412 716 dbSNP
rs1231384023 716 dbSNP
rs1345871572 717 dbSNP
rs1237136185 720 dbSNP
rs1490757194 726 dbSNP
rs930901682 727 dbSNP
rs920232907 732 dbSNP
rs1016104679 735 dbSNP
rs1204080120 739 dbSNP
rs547429137 753 dbSNP
rs1448350483 758 dbSNP
rs1262445728 767 dbSNP
rs1245624663 778 dbSNP
rs1454338890 778 dbSNP
rs886396639 782 dbSNP
rs1378433220 786 dbSNP
rs1418819195 795 dbSNP
rs1158989472 803 dbSNP
rs573592263 817 dbSNP
rs773364992 822 dbSNP
rs867131362 832 dbSNP
rs1281223394 835 dbSNP
rs1026226638 836 dbSNP
rs994198774 848 dbSNP
rs1443212877 849 dbSNP
rs185105870 850 dbSNP
rs1376773167 857 dbSNP
rs1241568904 860 dbSNP
rs1347677112 875 dbSNP
rs901155248 888 dbSNP
rs1381750437 895 dbSNP
rs961775437 898 dbSNP
rs1207635211 901 dbSNP
rs542859126 908 dbSNP
rs1041044345 912 dbSNP
rs942813262 913 dbSNP
rs771165221 922 dbSNP
rs1053961726 930 dbSNP
rs936834404 939 dbSNP
rs1456203796 944 dbSNP
rs574224717 949 dbSNP
rs1162830069 954 dbSNP
rs747936869 956 dbSNP
rs958525163 959 dbSNP
rs557265701 968 dbSNP
rs924231632 977 dbSNP
rs1174794046 978 dbSNP
rs1000089468 984 dbSNP
rs142327740 999 dbSNP
rs781039803 1012 dbSNP
rs949081784 1018 dbSNP
rs537185248 1019 dbSNP
rs1377876118 1022 dbSNP
rs1309797176 1024 dbSNP
rs571233269 1036 dbSNP
rs1191965466 1037 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000273691.3 | 3UTR | UUGGCUUAGAUUCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000273691.3 | 3UTR | UUGGCUUAGAUUCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.984 0.01 0.800 0.1 4 Click to see details
UCEC 0.982 0.06 0.500 0.33 3 Click to see details
STAD 0.98 0.06 0.500 0.33 3 Click to see details
HNSC 0.781 0.11 0.800 0.1 4 Click to see details
BLCA -0.849 0.18 -1.000 0.5 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
LUSC 0.661 0.27 0.500 0.33 3 Click to see details
153 hsa-miR-548f-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT075032 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 2
MIRT076422 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT077732 ZNF652 zinc finger protein 652 2 2
MIRT097425 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT099605 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT105530 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT109834 MID1IP1 MID1 interacting protein 1 2 8
MIRT132952 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT134169 KLHL42 kelch like family member 42 2 4
MIRT138721 MPP5 membrane palmitoylated protein 5 2 2
MIRT187755 ESYT1 extended synaptotagmin 1 2 2
MIRT208054 LRRC58 leucine rich repeat containing 58 2 2
MIRT222029 PURB purine rich element binding protein B 2 2
MIRT243457 LMLN leishmanolysin like peptidase 2 2
MIRT266062 FJX1 four jointed box 1 2 6
MIRT279835 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT285122 TERF2IP TERF2 interacting protein 2 6
MIRT323906 TMEM245 transmembrane protein 245 2 2
MIRT325430 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT338909 HMGN2 high mobility group nucleosomal binding domain 2 2 6
MIRT350498 MRGBP MRG domain binding protein 2 6
MIRT405877 CALM1 calmodulin 1 2 2
MIRT442081 NDRG1 N-myc downstream regulated 1 2 2
MIRT442371 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT442397 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT444255 INTS8 integrator complex subunit 8 2 2
MIRT444875 ISPD isoprenoid synthase domain containing 2 2
MIRT445407 PTCHD1 patched domain containing 1 2 4
MIRT445493 HMGN4 high mobility group nucleosomal binding domain 4 2 2
MIRT446136 ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 2 2
MIRT446261 GRAMD1C GRAM domain containing 1C 2 2
MIRT446353 EML6 echinoderm microtubule associated protein like 6 2 2
MIRT446403 SNX1 sorting nexin 1 2 2
MIRT446826 STK17A serine/threonine kinase 17a 2 2
MIRT447222 ABI2 abl interactor 2 2 2
MIRT447705 ERP44 endoplasmic reticulum protein 44 2 2
MIRT448248 ZNF774 zinc finger protein 774 2 2
MIRT448819 FKBP1A FK506 binding protein 1A 2 4
MIRT449060 ZNF558 zinc finger protein 558 2 2
MIRT449668 ZNF451 zinc finger protein 451 2 2
MIRT449974 ZNF555 zinc finger protein 555 2 2
MIRT450476 TRMT5 tRNA methyltransferase 5 2 4
MIRT450483 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT467980 SKIL SKI like proto-oncogene 2 4
MIRT470733 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT475012 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT490478 FEM1C fem-1 homolog C 2 2
MIRT497368 DIRAS2 DIRAS family GTPase 2 2 2
MIRT497561 PRLR prolactin receptor 2 2
MIRT497943 ABCB7 ATP binding cassette subfamily B member 7 2 2
MIRT498014 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498206 ACVR2B activin A receptor type 2B 2 2
MIRT502637 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT505633 SLC16A1 solute carrier family 16 member 1 2 6
MIRT512261 ARPP19 cAMP regulated phosphoprotein 19 2 6
MIRT518247 SCIN scinderin 2 4
MIRT520483 TRIM13 tripartite motif containing 13 2 4
MIRT521196 SBNO1 strawberry notch homolog 1 2 6
MIRT522764 LARP1 La ribonucleoprotein domain family member 1 2 4
MIRT525021 ABHD13 abhydrolase domain containing 13 2 4
MIRT525100 FRK fyn related Src family tyrosine kinase 2 2
MIRT525268 CD226 CD226 molecule 2 4
MIRT528662 FUNDC2 FUN14 domain containing 2 2 2
MIRT529353 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 2
MIRT529651 ZNF81 zinc finger protein 81 2 2
MIRT529815 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT530316 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT532775 LDHD lactate dehydrogenase D 2 2
MIRT533888 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT535657 NLN neurolysin 2 4
MIRT536351 LEFTY1 left-right determination factor 1 2 2
MIRT538089 DGKE diacylglycerol kinase epsilon 2 2
MIRT538118 DDX6 DEAD-box helicase 6 2 2
MIRT538950 BMP2K BMP2 inducible kinase 2 2
MIRT539086 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 4
MIRT539374 ADSS adenylosuccinate synthase 2 6
MIRT539860 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 4
MIRT539976 SPRY1 sprouty RTK signaling antagonist 1 2 2
MIRT541264 GPC4 glypican 4 2 4
MIRT543374 CYB5B cytochrome b5 type B 2 2
MIRT543472 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543685 HHLA1 HERV-H LTR-associating 1 2 2
MIRT543877 SLC16A9 solute carrier family 16 member 9 2 2
MIRT544021 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544119 TTLL11 tubulin tyrosine ligase like 11 2 4
MIRT545311 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545769 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT545991 XKR4 XK related 4 2 2
MIRT546078 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546717 RNPS1 RNA binding protein with serine rich domain 1 2 4
MIRT548964 CCNT2 cyclin T2 2 2
MIRT552133 MED10 mediator complex subunit 10 2 2
MIRT553941 STARD3NL STARD3 N-terminal like 2 2
MIRT554148 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT555009 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT555495 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT555651 PHF12 PHD finger protein 12 2 2
MIRT557631 GJD3 gap junction protein delta 3 2 2
MIRT557989 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT558838 CDCA4 cell division cycle associated 4 2 4
MIRT563344 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT563902 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564263 DEPDC1B DEP domain containing 1B 2 2
MIRT565516 SOX4 SRY-box 4 2 2
MIRT565847 SCML2 Scm polycomb group protein like 2 2 2
MIRT567174 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT573142 ABT1 activator of basal transcription 1 2 2
MIRT573248 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT573740 KHSRP KH-type splicing regulatory protein 2 2
MIRT573983 DDX21 DExD-box helicase 21 2 2
MIRT574478 RPS16 ribosomal protein S16 2 2
MIRT608343 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT609782 NHSL1 NHS like 1 2 2
MIRT612536 RSF1 remodeling and spacing factor 1 2 2
MIRT613193 CLOCK clock circadian regulator 2 2
MIRT617539 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT617779 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT620252 PCK1 phosphoenolpyruvate carboxykinase 1 2 2
MIRT621740 TNPO2 transportin 2 2 2
MIRT628105 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT629471 CRLS1 cardiolipin synthase 1 2 6
MIRT638139 TTC26 tetratricopeptide repeat domain 26 2 2
MIRT641039 PITPNB phosphatidylinositol transfer protein beta 2 2
MIRT642453 CLUAP1 clusterin associated protein 1 2 2
MIRT643159 NCK1 NCK adaptor protein 1 2 2
MIRT643260 ZNF566 zinc finger protein 566 2 2
MIRT649827 LIPG lipase G, endothelial type 2 2
MIRT651199 ZNF280B zinc finger protein 280B 2 2
MIRT654633 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 2
MIRT656633 LRRC15 leucine rich repeat containing 15 2 2
MIRT660588 APP amyloid beta precursor protein 2 2
MIRT660865 AFAP1 actin filament associated protein 1 2 2
MIRT664141 ATP6V1G3 ATPase H+ transporting V1 subunit G3 2 2
MIRT666130 SPATS2L spermatogenesis associated serine rich 2 like 2 2
MIRT666391 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT667143 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT673834 SPPL2A signal peptide peptidase like 2A 2 2
MIRT675539 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT693450 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 2
MIRT694852 KRT80 keratin 80 2 2
MIRT696047 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT696951 CERK ceramide kinase 2 2
MIRT697839 UBL3 ubiquitin like 3 2 2
MIRT700270 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT702733 INSIG1 insulin induced gene 1 2 2
MIRT705310 AVL9 AVL9 cell migration associated 2 2
MIRT705325 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT707735 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT711798 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT713736 SUCO SUN domain containing ossification factor 2 2
MIRT715766 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT719186 KCNS2 potassium voltage-gated channel modifier subfamily S member 2 2 2
MIRT719478 PECR peroxisomal trans-2-enoyl-CoA reductase 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-548f 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-548f-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-548f-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-548f-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-548f-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-548f-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (500nM)
hsa-miR-548f-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-548f-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (500nM)
hsa-miR-548f-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-548f-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548f-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-548f-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-548f-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-548f-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548f-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission