>OIP5|NM_007280|3'UTR
   1 TCCTGTACCAAAGCTTGAGTGTCAGGTTCAGGCTTTATTGCTGTCTTCAACAACAGGTGCTGCTTAGTCATTTCTTGAAA
  81 AAGATTGGCTTCAAGAATGGAGGGGAAATGCAGTTTCTATTTACCTTTAGGCTGATTTTCCAAATTATTTGTGAAGCTGT
 161 TTTTAGAAGATGAGAGACTAAGGATTCTTCTCTTTTATAGCTATTTGCCTTAAGAACTTACTTTAGATTCTTATTGAATT
 241 CATAATACTTATCTCTGAAAATGTCTTTGACTGTAAATTTAGGAATTAAGATGCAGAGTCCCATGTGTCCTCTGATCTAA
 321 AGTTGCATGGTTGGTCTGAAAATAGAGTTGGGCTTAATGTTGACTTCTATTACTCCTGCATGGAGCAGTTGTTATGAATA
 401 CTAATACATCACTTTTTAACTTCTGTAAAATACAGATCATAATATTCTATAGGTAATGTTTAATAAATTGCCTGAATAAT
 481 ATACAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' auuUCAUUGAAGG-------UGAACCGa 5' ||| |:|||: : ||||| Target 5' cttAGTCATTTCTTGAAAAAGATTGGCt 3'	63 - 90	106.00	-10.20
2	miRNA 3' auuucAUUGAAGGUGAAccga 5' |||: |: |||| Target 5' gggctTAATGTTGACTTctat 3'	350 - 370	96.00	-6.82
3	miRNA 3' auuucAUUGAAGG--UGAAccga 5' | ||||:: |||| Target 5' atacaTCACTTTTTAACTTctgt 3'	404 - 426	94.00	-5.12

Mutant ID	Mutant Position	Mutant Source
COSN30473749	33	COSMIC
COSN21237638	45	COSMIC
COSN30465008	56	COSMIC
COSN509790	105	COSMIC
COSN28861890	257	COSMIC
COSN22039620	311	COSMIC
COSN22545655	367	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs746045476	3	dbSNP
rs1372876994	9	dbSNP
rs1171765451	13	dbSNP
rs1412585926	13	dbSNP
rs1479125618	15	dbSNP
rs1416285226	18	dbSNP
rs779224961	19	dbSNP
rs886979666	20	dbSNP
rs369999957	21	dbSNP
rs777623267	26	dbSNP
rs756041383	31	dbSNP
rs752690691	38	dbSNP
rs780549481	48	dbSNP
rs539236117	53	dbSNP
rs1162700716	54	dbSNP
rs1020448965	56	dbSNP
rs1317961001	57	dbSNP
rs1332382513	64	dbSNP
rs1436552215	68	dbSNP
rs868008277	69	dbSNP
rs1276006678	83	dbSNP
rs750000747	83	dbSNP
rs530171073	85	dbSNP
rs867273568	86	dbSNP
rs899136394	104	dbSNP
rs1270353456	108	dbSNP
rs1330089325	112	dbSNP
rs1208416757	119	dbSNP
rs1259899209	121	dbSNP
rs1453448280	128	dbSNP
rs1199630123	129	dbSNP
rs1246086482	143	dbSNP
rs1479387404	164	dbSNP
rs1161114909	166	dbSNP
rs561066097	172	dbSNP
rs1039029484	173	dbSNP
rs943398550	174	dbSNP
rs74012259	209	dbSNP
rs900490991	214	dbSNP
rs1240603561	217	dbSNP
rs1192809824	226	dbSNP
rs1051892154	234	dbSNP
rs74012258	237	dbSNP
rs115325774	251	dbSNP
rs1047649575	265	dbSNP
rs1334771617	269	dbSNP
rs1259223202	271	dbSNP
rs1273226578	291	dbSNP
rs979391065	293	dbSNP
rs1229555477	297	dbSNP
rs1289166228	312	dbSNP
rs1489839589	314	dbSNP
rs770839588	317	dbSNP
rs915555460	335	dbSNP
rs1269193436	350	dbSNP
rs545422681	358	dbSNP
rs146239241	360	dbSNP
rs1367080605	361	dbSNP
rs1369863796	365	dbSNP
rs991131917	369	dbSNP
rs959720337	378	dbSNP
rs1363246031	380	dbSNP
rs1035431196	383	dbSNP
rs982591857	391	dbSNP
rs183523074	401	dbSNP
rs1395173786	407	dbSNP
rs1409631998	420	dbSNP
rs1305244863	421	dbSNP
rs951248652	432	dbSNP
rs1245706400	435	dbSNP
rs1283810007	444	dbSNP
rs924927886	468	dbSNP
rs1324231367	469	dbSNP
rs1026826424	476	dbSNP
rs543221614	478	dbSNP

- Cell host & microbe, 2011

Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.

- Nature methods, 2013

High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.