miRTarBase - #MIRT442694


—
pre-miRNA Information
pre-miRNA hsa-mir-548s   
Genomic Coordinates chr2: 11767444 - 11767525
Description Homo sapiens miR-548s stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548s
Sequence 52| AUGGCCAAAACUGCAGUUAUUUU |74
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 2 + 11767495 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1187825186 1 dbSNP
rs1161985266 4 dbSNP
rs1476642595 6 dbSNP
rs772377981 6 dbSNP
rs1427306684 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF646   
Synonyms -
Description zinc finger protein 646
Transcript NM_014699   
Expression
Putative miRNA Targets on ZNF646
3'UTR of ZNF646
(miRNA target sites are highlighted)		 
>ZNF646|NM_014699|3'UTR
   1 ACTTCAAGTCTCCAAAGATCAGAATCTGGGGGAGGGAGCGCGTGCAGGGAGGGGCTTGATCTCCACATTTTCTCAGGAGT
  81 AGTTCGGGCATCCCCATATCTTCTCCTCTCCCCTTGTGAAGAGGACCCAGATCTGGCTTCTTTCCCAAGGAGGGGGTGGG
 161 GTGTTCCTCGCGTCCCTGTCCTTGAAGGACCTCCTTCCCCCAGCCTCATCACCGTGCTCTTCTCAGCGCCACCCTCAGCA
 241 GCCAGATTGCAACACCAGGGAGAGGCGGATGCAGAGCCCCACCGGTGGGAAAGTTGCCTGTGGAAGGGAGCCTTTTGCTA
 321 CAATTTGTAACTTATTTTCTAAAGTCTATTTTGTAACAATTTATTTAAGTTTAAAAAAAGGAAAACTGCTGCCCCCCAAA
 401 AAAAGAAATTTTCAAAACAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuUUAUUGACGUCAAAACCGGua 5'
            :| :||  ||| | ||||:  
Target 5' aaGAGGAC-CCAGATCTGGCTtc 3'
 119 - 140 92.00 -7.00
2 
miRNA  3' uuuuauuGACGUCA--AAACCGGUa 5'
                 | | |||  || || || 
Target 5' attttctCAGGAGTAGTTCGGGCAt 3'
 67 - 91 90.00 -11.20
3 
miRNA  3' uuUUAUUGACGUCAAAACCGGua 5'
            :| ||||||     || ||  
Target 5' agGAAAACTGC-----TGCCCcc 3'
 379 - 396 79.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5759730 8 COSMIC
COSN31597868 9 COSMIC
COSN30156445 23 COSMIC
COSN30448222 31 COSMIC
COSN30101526 42 COSMIC
COSN30105355 54 COSMIC
COSN31574220 73 COSMIC
COSN13667143 86 COSMIC
COSN31483128 87 COSMIC
COSN26960547 113 COSMIC
COSN15627146 128 COSMIC
COSN31583735 171 COSMIC
COSN31488366 198 COSMIC
COSN32058013 239 COSMIC
COSN31536378 284 COSMIC
COSN20078655 422 COSMIC
COSN30125137 440 COSMIC
COSN31574969 473 COSMIC
COSN5857296 487 COSMIC
COSN31561641 513 COSMIC
COSN31536827 547 COSMIC
COSN31526568 549 COSMIC
COSN30101801 602 COSMIC
COSN19666182 611 COSMIC
COSN30490189 650 COSMIC
COSN26504792 664 COSMIC
COSN30101955 669 COSMIC
COSN30479845 671 COSMIC
COSN31493952 678 COSMIC
COSN27006373 684 COSMIC
COSN28644772 759 COSMIC
COSN28653316 792 COSMIC
COSN28671397 839 COSMIC
COSN24384971 997 COSMIC
COSN18094736 1007 COSMIC
COSM6426541 1019 COSMIC
COSM3741894 1025 COSMIC
COSM5559721 1039 COSMIC
COSM4435928 1054 COSMIC
COSM4606723 1055 COSMIC
COSM6416246 1055 COSMIC
COSM5761046 1062 COSMIC
COSM4060363 1079 COSMIC
COSM2917502 1080 COSMIC
COSM4597054 1087 COSMIC
COSM1242724 1089 COSMIC
rs11865038 759 GWAS
rs11864839 839 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs377285471 7 dbSNP
rs200722390 8 dbSNP
rs1315398797 9 dbSNP
rs927059250 12 dbSNP
rs1356210410 13 dbSNP
rs758159152 15 dbSNP
rs1008417276 16 dbSNP
rs554752165 18 dbSNP
rs751047437 24 dbSNP
rs937095647 27 dbSNP
rs756629002 28 dbSNP
rs778207644 29 dbSNP
rs375780069 31 dbSNP
rs1258116712 40 dbSNP
rs201480729 41 dbSNP
rs746048387 42 dbSNP
rs772284833 43 dbSNP
rs775536855 47 dbSNP
rs760734060 49 dbSNP
rs768607922 53 dbSNP
rs1457554217 64 dbSNP
rs1000718213 66 dbSNP
rs1156503359 75 dbSNP
rs780575889 75 dbSNP
rs1175220393 86 dbSNP
rs1456433277 87 dbSNP
rs1032220597 96 dbSNP
rs891062590 99 dbSNP
rs1471541314 101 dbSNP
rs554489262 110 dbSNP
rs1439968843 111 dbSNP
rs1465603114 114 dbSNP
rs2077633 115 dbSNP
rs1207239023 121 dbSNP
rs1316492680 128 dbSNP
rs1290904052 144 dbSNP
rs1373149199 145 dbSNP
rs1314255902 147 dbSNP
rs1012243715 153 dbSNP
rs1433553828 156 dbSNP
rs1025017689 165 dbSNP
rs1335460023 170 dbSNP
rs558875864 171 dbSNP
rs577151863 172 dbSNP
rs983972974 173 dbSNP
rs1166499894 176 dbSNP
rs1403070451 176 dbSNP
rs34896559 180 dbSNP
rs1412489753 181 dbSNP
rs1163498577 189 dbSNP
rs1440496039 197 dbSNP
rs907967493 200 dbSNP
rs1250454700 203 dbSNP
rs749541035 214 dbSNP
rs973545971 215 dbSNP
rs544619657 224 dbSNP
rs1247491172 225 dbSNP
rs562965499 227 dbSNP
rs1224109353 228 dbSNP
rs922155440 229 dbSNP
rs2007636 239 dbSNP
rs1229249885 250 dbSNP
rs1378070631 254 dbSNP
rs1049382773 259 dbSNP
rs912243087 261 dbSNP
rs72785535 267 dbSNP
rs748624117 268 dbSNP
rs746971112 279 dbSNP
rs1364389718 284 dbSNP
rs1431141026 284 dbSNP
rs1301518619 285 dbSNP
rs1428257531 286 dbSNP
rs1347248957 319 dbSNP
rs1219824888 329 dbSNP
rs902261609 330 dbSNP
rs772458282 332 dbSNP
rs3180955 335 dbSNP
rs1193126772 338 dbSNP
rs1487595938 341 dbSNP
rs1268449736 342 dbSNP
rs1053652034 343 dbSNP
rs972094555 345 dbSNP
rs1226649853 358 dbSNP
rs1272359522 358 dbSNP
rs1312548225 359 dbSNP
rs1303210435 360 dbSNP
rs895058925 362 dbSNP
rs926955923 363 dbSNP
rs1444024920 367 dbSNP
rs1308286490 372 dbSNP
rs1012192768 376 dbSNP
rs1368213587 378 dbSNP
rs937084292 380 dbSNP
rs1461974887 381 dbSNP
rs1024964946 384 dbSNP
rs919708518 386 dbSNP
rs929795614 392 dbSNP
rs971109945 393 dbSNP
rs1473595856 398 dbSNP
rs773578863 399 dbSNP
rs558617816 401 dbSNP
rs963438931 413 dbSNP
rs1483502147 416 dbSNP
rs1392807619 431 dbSNP
rs1207702835 432 dbSNP
rs943959601 438 dbSNP
rs1400175884 445 dbSNP
rs45599534 449 dbSNP
rs149766718 450 dbSNP
rs776712436 452 dbSNP
rs1348074777 453 dbSNP
rs555821985 453 dbSNP
rs900518478 456 dbSNP
rs1396114347 459 dbSNP
rs759747587 462 dbSNP
rs146889052 473 dbSNP
rs1468543822 482 dbSNP
rs745388683 483 dbSNP
rs1459070802 485 dbSNP
rs1401564427 486 dbSNP
rs1362290662 487 dbSNP
rs1395604771 488 dbSNP
rs751117 506 dbSNP
rs1258158092 515 dbSNP
rs893248659 520 dbSNP
rs1460704878 524 dbSNP
rs953616987 525 dbSNP
rs1268591871 527 dbSNP
rs1210372265 529 dbSNP
rs1326562984 546 dbSNP
rs1199761661 549 dbSNP
rs1010405619 552 dbSNP
rs532008374 556 dbSNP
rs550202731 566 dbSNP
rs1370461373 567 dbSNP
rs748628214 574 dbSNP
rs987654462 579 dbSNP
rs912164505 590 dbSNP
rs1315398744 593 dbSNP
rs1451183340 605 dbSNP
rs1020497894 606 dbSNP
rs1321567061 610 dbSNP
rs943662749 615 dbSNP
rs1437316748 618 dbSNP
rs1158265675 625 dbSNP
rs199847920 626 dbSNP
rs201790796 627 dbSNP
rs1337502130 636 dbSNP
rs1370343887 636 dbSNP
rs1042062079 643 dbSNP
rs1212799576 644 dbSNP
rs1257344310 647 dbSNP
rs761835858 651 dbSNP
rs371892937 660 dbSNP
rs762639556 662 dbSNP
rs766189014 667 dbSNP
rs751073555 669 dbSNP
rs1352400817 671 dbSNP
rs1190227273 673 dbSNP
rs754483204 676 dbSNP
rs778318277 679 dbSNP
rs1260579325 681 dbSNP
rs3179595 683 dbSNP
rs1173828885 684 dbSNP
rs1210104857 685 dbSNP
rs754250106 693 dbSNP
rs757792526 694 dbSNP
rs182093647 703 dbSNP
rs746243018 709 dbSNP
rs1210055869 712 dbSNP
rs1244615124 713 dbSNP
rs1359263885 715 dbSNP
rs772278899 717 dbSNP
rs369832167 718 dbSNP
rs1177457315 721 dbSNP
rs371896509 722 dbSNP
rs1417719764 729 dbSNP
rs768571446 738 dbSNP
rs776807301 739 dbSNP
rs769868163 740 dbSNP
rs1172293430 745 dbSNP
rs919677713 749 dbSNP
rs1442976315 757 dbSNP
rs11865038 759 dbSNP
rs1371369717 760 dbSNP
rs566965645 767 dbSNP
rs746131691 767 dbSNP
rs1301301624 769 dbSNP
rs758367610 771 dbSNP
rs1424135287 774 dbSNP
rs1046721621 776 dbSNP
rs139279003 776 dbSNP
rs775305793 777 dbSNP
rs906455200 782 dbSNP
rs982546601 785 dbSNP
rs1199116315 791 dbSNP
rs11864806 792 dbSNP
rs1221033691 802 dbSNP
rs1014962050 815 dbSNP
rs1424892049 816 dbSNP
rs943944147 819 dbSNP
rs1467529618 830 dbSNP
rs1216902073 835 dbSNP
rs558961382 837 dbSNP
rs11864839 839 dbSNP
rs899777354 840 dbSNP
rs1390421955 848 dbSNP
rs931951433 849 dbSNP
rs994906263 858 dbSNP
rs1029046527 859 dbSNP
rs1406218422 875 dbSNP
rs953522751 876 dbSNP
rs1324833956 881 dbSNP
rs1010329692 883 dbSNP
rs1478903025 883 dbSNP
rs987658583 884 dbSNP
rs1198292063 888 dbSNP
rs907378366 907 dbSNP
rs1277508459 908 dbSNP
rs1341001313 909 dbSNP
rs1019579880 911 dbSNP
rs1436510270 912 dbSNP
rs140712721 923 dbSNP
rs1271081994 930 dbSNP
rs1201341704 931 dbSNP
rs757001114 934 dbSNP
rs1326162984 938 dbSNP
rs867326329 952 dbSNP
rs187128221 956 dbSNP
rs1351167420 957 dbSNP
rs923652318 958 dbSNP
rs192462257 961 dbSNP
rs989202269 962 dbSNP
rs542360591 964 dbSNP
rs1334770252 969 dbSNP
rs1415936394 970 dbSNP
rs1026617716 976 dbSNP
rs1388736023 978 dbSNP
rs1175248144 982 dbSNP
rs1305423465 988 dbSNP
rs1371432285 995 dbSNP
rs1233525823 998 dbSNP
rs1278051146 999 dbSNP
rs1308770471 1000 dbSNP
rs766095880 1003 dbSNP
rs773919860 1006 dbSNP
rs745489677 1007 dbSNP
rs766897143 1009 dbSNP
rs1408575645 1010 dbSNP
rs1254077037 1012 dbSNP
rs752254845 1013 dbSNP
rs947831141 1014 dbSNP
rs757702602 1015 dbSNP
rs765802332 1016 dbSNP
rs750757570 1018 dbSNP
rs182194525 1019 dbSNP
rs572932075 1021 dbSNP
rs1459682629 1023 dbSNP
rs1261334604 1025 dbSNP
rs747163233 1027 dbSNP
rs1371500945 1030 dbSNP
rs755237563 1031 dbSNP
rs1301176611 1037 dbSNP
rs975295513 1038 dbSNP
rs921177528 1039 dbSNP
rs1363905443 1040 dbSNP
rs748300074 1041 dbSNP
rs540467463 1042 dbSNP
rs1305237781 1045 dbSNP
rs1215222661 1050 dbSNP
rs1273385908 1053 dbSNP
rs1468339733 1059 dbSNP
rs773320432 1061 dbSNP
rs770579035 1062 dbSNP
rs1476059056 1064 dbSNP
rs774231704 1065 dbSNP
rs759043891 1070 dbSNP
rs1425589036 1073 dbSNP
rs377498752 1076 dbSNP
rs946085550 1077 dbSNP
rs1435590142 1078 dbSNP
rs774966273 1079 dbSNP
rs760220212 1080 dbSNP
rs765712600 1084 dbSNP
rs76684867 1087 dbSNP
rs758936608 1092 dbSNP
rs766589568 1094 dbSNP
rs1234539711 1100 dbSNP
rs1293548540 1101 dbSNP
rs751971327 1102 dbSNP
rs755144609 1105 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuuuauugacgucaaAACCGGUa 5'
                         ||||||| 
Target 5' ---------------UUGGCCAg 3'
 		1 - 8
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC
Disease MIMAT0014987
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020023. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020023
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000300850.5 | 3UTR | uuggccaggcagcuucc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000300850.5 | 3UTR | uuggccaggcagcuucc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM796040
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000300850.5 | 3UTR | uuggccaggcagcuucc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.623 0.03 0.455 0.09 10 Click to see details
LIHC 0.26 0.07 0.258 0.07 34 Click to see details
BRCA -0.208 0.12 -0.222 0.1 35 Click to see details
PRAD 0.599 0.14 0.300 0.31 5 Click to see details
HNSC -0.299 0.19 -0.382 0.12 11 Click to see details
KICH -0.295 0.19 -0.300 0.19 11 Click to see details
PAAD 0.793 0.21 1.000 0.5 3 Click to see details
ESCA 0.778 0.22 0.500 0.33 3 Click to see details
THCA 0.115 0.26 0.052 0.39 34 Click to see details
UCEC 0.144 0.34 0.355 0.14 11 Click to see details
CHOL -0.319 0.34 -0.200 0.4 4 Click to see details
KIRP -0.064 0.45 -0.107 0.41 7 Click to see details
KIRC 0.033 0.45 0.041 0.44 16 Click to see details
LUSC 0.008 0.49 -0.046 0.44 14 Click to see details
LUSC 0.008 0.49 -0.046 0.44 14 Click to see details
LUSC 0.008 0.49 -0.046 0.44 14 Click to see details
LUSC 0.008 0.49 -0.046 0.44 14 Click to see details
LUSC 0.008 0.49 -0.046 0.44 14 Click to see details
374 hsa-miR-548s Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT075229 PHF13 PHD finger protein 13 2 4
MIRT090370 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT096411 C5ORF22 chromosome 5 open reading frame 22 2 2
MIRT153366 MAVS mitochondrial antiviral signaling protein 2 2
MIRT194890 DCTN5 dynactin subunit 5 2 8
MIRT195549 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT219209 LYRM4 LYR motif containing 4 2 2
MIRT234472 ZNF652 zinc finger protein 652 2 2
MIRT235966 BACH1 BTB domain and CNC homolog 1 2 2
MIRT271874 ZNF678 zinc finger protein 678 2 2
MIRT294224 U2AF2 U2 small nuclear RNA auxiliary factor 2 2 2
MIRT334729 BTG2 BTG anti-proliferation factor 2 2 4
MIRT441397 SOX5 SRY-box 5 2 2
MIRT441551 TBCEL tubulin folding cofactor E like 2 2
MIRT441568 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT441581 POLR1B RNA polymerase I subunit B 2 2
MIRT441681 GABRB2 gamma-aminobutyric acid type A receptor beta2 subunit 2 2
MIRT442049 KLHDC10 kelch domain containing 10 2 2
MIRT442633 TBC1D12 TBC1 domain family member 12 2 2
MIRT442694 ZNF646 zinc finger protein 646 2 4
MIRT443108 DENND5B DENN domain containing 5B 2 2
MIRT443110 VLDLR very low density lipoprotein receptor 2 2
MIRT443423 MAPT microtubule associated protein tau 2 2
MIRT443464 ACPP acid phosphatase, prostate 2 2
MIRT443763 HLF HLF, PAR bZIP transcription factor 2 2
MIRT443806 SIDT2 SID1 transmembrane family member 2 2 2
MIRT451031 ZNF610 zinc finger protein 610 2 2
MIRT451275 ZNF101 zinc finger protein 101 2 6
MIRT451671 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 6
MIRT454144 FLYWCH2 FLYWCH family member 2 2 8
MIRT454595 MAG myelin associated glycoprotein 2 4
MIRT459352 AGXT alanine-glyoxylate aminotransferase 2 2
MIRT460053 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460737 HEXA hexosaminidase subunit alpha 2 2
MIRT463084 ZNF618 zinc finger protein 618 2 2
MIRT465757 TMPPE transmembrane protein with metallophosphoesterase domain 2 8
MIRT471102 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT472939 MSMO1 methylsterol monooxygenase 1 2 6
MIRT473686 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT474288 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT476935 FAM83G family with sequence similarity 83 member G 2 2
MIRT477130 FAM118A family with sequence similarity 118 member A 2 2
MIRT477321 EPHA2 EPH receptor A2 2 2
MIRT478310 DDN dendrin 2 2
MIRT494936 IFFO2 intermediate filament family orphan 2 2 2
MIRT495287 RASL10B RAS like family 10 member B 2 2
MIRT495310 GDF11 growth differentiation factor 11 2 2
MIRT495323 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 2 4
MIRT496580 RGMA repulsive guidance molecule family member a 2 2
MIRT496647 TNPO2 transportin 2 2 2
MIRT496804 SLC16A10 solute carrier family 16 member 10 2 2
MIRT496850 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 2
MIRT496910 RTKN rhotekin 2 2
MIRT496955 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT497149 PRDM15 PR/SET domain 15 2 2
MIRT498253 ELAVL1 ELAV like RNA binding protein 1 2 2
MIRT498380 GPRC5B G protein-coupled receptor class C group 5 member B 2 2
MIRT500426 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500482 ZBTB4 zinc finger and BTB domain containing 4 2 6
MIRT505372 TMEM154 transmembrane protein 154 2 4
MIRT505674 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT509787 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT512344 ZNF665 zinc finger protein 665 2 4
MIRT512404 CD84 CD84 molecule 2 2
MIRT512526 ATCAY ATCAY, caytaxin 2 4
MIRT513223 RYK receptor-like tyrosine kinase 2 2
MIRT514247 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514276 ZNF345 zinc finger protein 345 2 4
MIRT514426 SLC38A7 solute carrier family 38 member 7 2 2
MIRT514551 PTGR2 prostaglandin reductase 2 2 2
MIRT514776 RBM4B RNA binding motif protein 4B 2 2
MIRT514854 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 2
MIRT515033 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515265 CSNK1E casein kinase 1 epsilon 2 2
MIRT515283 MSRB1 methionine sulfoxide reductase B1 2 2
MIRT515587 FBXL13 F-box and leucine rich repeat protein 13 2 2
MIRT515898 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT515945 C9orf156 tRNA methyltransferase O 2 2
MIRT516281 DBT dihydrolipoamide branched chain transacylase E2 2 2
MIRT516517 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516932 THAP1 THAP domain containing 1 2 4
MIRT517201 OTUD6A OTU deubiquitinase 6A 2 2
MIRT517379 METTL7A methyltransferase like 7A 2 2
MIRT517467 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT517564 SNX22 sorting nexin 22 2 2
MIRT517617 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT518210 TRMT10B tRNA methyltransferase 10B 2 2
MIRT518545 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT519089 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 4
MIRT519103 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT519138 C2orf49 chromosome 2 open reading frame 49 2 2
MIRT519316 TIMELESS timeless circadian clock 2 2
MIRT519393 DNASE2 deoxyribonuclease 2, lysosomal 2 4
MIRT519441 GLA galactosidase alpha 2 2
MIRT519465 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT519705 ZNF584 zinc finger protein 584 2 4
MIRT519822 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 2 2
MIRT520236 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520259 URGCP upregulator of cell proliferation 2 2
MIRT520409 TXNL1 thioredoxin like 1 2 4
MIRT521401 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT521511 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT522644 MANEAL mannosidase endo-alpha like 2 2
MIRT522789 KPNA4 karyopherin subunit alpha 4 2 4
MIRT523502 GMPS guanine monophosphate synthase 2 4
MIRT523686 FHL2 four and a half LIM domains 2 2 2
MIRT523902 EMC7 ER membrane protein complex subunit 7 2 4
MIRT524126 DMXL1 Dmx like 1 2 2
MIRT524770 BCKDK branched chain ketoacid dehydrogenase kinase 2 2
MIRT528264 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT528675 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT529138 CLCC1 chloride channel CLIC like 1 2 4
MIRT530704 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT531620 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT533399 TXNIP thioredoxin interacting protein 2 2
MIRT535650 NLN neurolysin 2 2
MIRT539958 SPRY1 sprouty RTK signaling antagonist 1 2 2
MIRT551760 MED21 mediator complex subunit 21 2 2
MIRT552021 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT557187 HOXA10 homeobox A10 2 2
MIRT560435 GOLGA7B golgin A7 family member B 2 2
MIRT561596 SKI SKI proto-oncogene 2 2
MIRT563915 STAT2 signal transducer and activator of transcription 2 2 2
MIRT565964 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT567313 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT572687 NCMAP non-compact myelin associated protein 2 2
MIRT574419 SOX4 SRY-box 4 2 2
MIRT575235 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576186 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576301 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576477 Lhx4 LIM homeobox protein 4 2 3
MIRT576576 Ptbp1 polypyrimidine tract binding protein 1 2 2
MIRT576602 Ccdc117 coiled-coil domain containing 117 2 2
MIRT576655 Fam216a family with sequence similarity 216, member A 2 2
MIRT576666 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT576703 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576845 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576944 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT608646 ABCF3 ATP binding cassette subfamily F member 3 2 2
MIRT609892 C1S complement C1s 2 2
MIRT613517 ANAPC7 anaphase promoting complex subunit 7 2 2
MIRT614073 XRCC2 X-ray repair cross complementing 2 2 2
MIRT618202 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT618350 CDKL1 cyclin dependent kinase like 1 2 2
MIRT618619 GREB1 growth regulation by estrogen in breast cancer 1 2 4
MIRT618826 PHF20 PHD finger protein 20 2 2
MIRT619371 SYT2 synaptotagmin 2 2 2
MIRT620103 HARBI1 harbinger transposase derived 1 2 2
MIRT620220 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT621183 FAM153B family with sequence similarity 153 member B 2 2
MIRT621477 GPKOW G-patch domain and KOW motifs 2 2
MIRT621874 TAZ tafazzin 2 2
MIRT624054 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT624689 AR androgen receptor 2 2
MIRT625234 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626070 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT629490 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT629861 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630995 ZNF573 zinc finger protein 573 2 2
MIRT631087 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631279 SGSM1 small G protein signaling modulator 1 2 2
MIRT631526 MYO6 myosin VI 2 2
MIRT631637 WDR91 WD repeat domain 91 2 4
MIRT632773 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633272 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633588 ABRACL ABRA C-terminal like 2 2
MIRT634152 YME1L1 YME1 like 1 ATPase 2 2
MIRT634920 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635848 PRR11 proline rich 11 2 2
MIRT636006 SAMD15 sterile alpha motif domain containing 15 2 4
MIRT639203 RAD51 RAD51 recombinase 2 2
MIRT639378 FFAR4 free fatty acid receptor 4 2 2
MIRT639535 GSG2 histone H3 associated protein kinase 2 2
MIRT639635 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT640224 TOMM40 translocase of outer mitochondrial membrane 40 2 2
MIRT640297 PRR13 proline rich 13 2 2
MIRT640683 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641118 NPHP3 nephrocystin 3 2 2
MIRT641451 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT642306 FPR1 formyl peptide receptor 1 2 2
MIRT642712 ZNF273 zinc finger protein 273 2 2
MIRT642840 ZNF891 zinc finger protein 891 2 2
MIRT643694 KIAA0586 KIAA0586 2 2
MIRT644309 NFKBID NFKB inhibitor delta 2 2
MIRT644504 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT645171 NOL9 nucleolar protein 9 2 4
MIRT645728 POLR3A RNA polymerase III subunit A 2 2
MIRT646120 SLC26A9 solute carrier family 26 member 9 2 2
MIRT647725 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT647991 PDE12 phosphodiesterase 12 2 2
MIRT648053 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648172 TMEM192 transmembrane protein 192 2 2
MIRT648789 VPS8 VPS8, CORVET complex subunit 2 2
MIRT649285 NEK8 NIMA related kinase 8 2 2
MIRT649837 LIPG lipase G, endothelial type 2 2
MIRT650004 KLB klotho beta 2 2
MIRT650563 YIPF4 Yip1 domain family member 4 2 2
MIRT651782 UTP6 UTP6, small subunit processome component 2 2
MIRT652076 TSPAN14 tetraspanin 14 2 2
MIRT653397 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT654540 RAB3C RAB3C, member RAS oncogene family 2 2
MIRT655362 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT655386 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT657139 ITGA1 integrin subunit alpha 1 2 2
MIRT657754 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT658821 EEF1E1 eukaryotic translation elongation factor 1 epsilon 1 2 2
MIRT659082 DENR density regulated re-initiation and release factor 2 2
MIRT659106 DENND6A DENN domain containing 6A 2 2
MIRT659409 CORO2A coronin 2A 2 2
MIRT659829 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT660252 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT660260 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 2 4
MIRT660933 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662986 TMEM59 transmembrane protein 59 2 2
MIRT663064 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663256 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT663583 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT663755 ZNF285 zinc finger protein 285 2 2
MIRT664135 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT665143 PTK6 protein tyrosine kinase 6 2 2
MIRT665394 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665978 SYT11 synaptotagmin 11 2 2
MIRT666186 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666568 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT666772 PTGES3L prostaglandin E synthase 3 like 2 2
MIRT667018 PDF peptide deformylase, mitochondrial 2 2
MIRT667098 SLC25A2 solute carrier family 25 member 2 2 2
MIRT667134 NT5DC3 5'-nucleotidase domain containing 3 2 4
MIRT669790 GAN gigaxonin 2 2
MIRT669920 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT669998 GPR156 G protein-coupled receptor 156 2 4
MIRT670291 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670380 EMP2 epithelial membrane protein 2 2 2
MIRT670453 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670564 GLTP glycolipid transfer protein 2 2
MIRT670859 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671055 KIF1B kinesin family member 1B 2 2
MIRT671078 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT671299 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671801 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT671851 APOL2 apolipoprotein L2 2 2
MIRT671950 SPPL3 signal peptide peptidase like 3 2 2
MIRT671990 OSTF1 osteoclast stimulating factor 1 2 2
MIRT672163 FANCF Fanconi anemia complementation group F 2 2
MIRT672267 SHE Src homology 2 domain containing E 2 2
MIRT672444 TTPAL alpha tocopherol transfer protein like 2 2
MIRT672870 TTC28 tetratricopeptide repeat domain 28 2 2
MIRT673643 CYCS cytochrome c, somatic 2 4
MIRT674049 ATXN3 ataxin 3 2 2
MIRT674240 NUP62 nucleoporin 62 2 2
MIRT674276 LMOD3 leiomodin 3 2 2
MIRT674430 MIOX myo-inositol oxygenase 2 4
MIRT674473 BCL2L15 BCL2 like 15 2 2
MIRT674493 TIRAP TIR domain containing adaptor protein 2 2
MIRT674846 GINM1 glycoprotein integral membrane 1 2 2
MIRT675706 EMC3 ER membrane protein complex subunit 3 2 2
MIRT675972 FAM126B family with sequence similarity 126 member B 2 2
MIRT676235 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676737 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT677426 DDX19B DEAD-box helicase 19B 2 2
MIRT677454 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677576 TRIM65 tripartite motif containing 65 2 2
MIRT677639 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677827 TSPYL1 TSPY like 1 2 2
MIRT678937 MYADM myeloid associated differentiation marker 2 2
MIRT680405 SFT2D2 SFT2 domain containing 2 2 2
MIRT680475 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683260 ZNF329 zinc finger protein 329 2 2
MIRT683564 CARD8 caspase recruitment domain family member 8 2 2
MIRT683812 CBS cystathionine-beta-synthase 2 2
MIRT684532 ZNF460 zinc finger protein 460 2 2
MIRT684939 PLA2G16 phospholipase A2 group XVI 2 2
MIRT685127 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT685164 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685429 PM20D2 peptidase M20 domain containing 2 2 2
MIRT685437 SLC10A6 solute carrier family 10 member 6 2 2
MIRT685676 TRIM45 tripartite motif containing 45 2 2
MIRT685991 NEK4 NIMA related kinase 4 2 2
MIRT687311 OTUD7B OTU deubiquitinase 7B 2 2
MIRT687535 MOB1B MOB kinase activator 1B 2 2
MIRT687710 KLF2 Kruppel like factor 2 2 2
MIRT687902 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT688044 GLUL glutamate-ammonia ligase 2 2
MIRT688891 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689242 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT689519 ORC6 origin recognition complex subunit 6 2 2
MIRT689582 NUDT7 nudix hydrolase 7 2 2
MIRT689611 AKAP6 A-kinase anchoring protein 6 2 2
MIRT689665 RBM23 RNA binding motif protein 23 2 2
MIRT689911 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT690005 LUZP2 leucine zipper protein 2 2 2
MIRT690027 CCDC90B coiled-coil domain containing 90B 2 2
MIRT690309 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT690503 MDM2 MDM2 proto-oncogene 2 2
MIRT691056 CRCP CGRP receptor component 2 2
MIRT691441 CXorf36 chromosome X open reading frame 36 2 2
MIRT691918 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT692269 GPR157 G protein-coupled receptor 157 2 2
MIRT692631 SUSD1 sushi domain containing 1 2 2
MIRT693378 ZNF528 zinc finger protein 528 2 2
MIRT693858 IYD iodotyrosine deiodinase 2 2
MIRT693971 ZNF70 zinc finger protein 70 2 2
MIRT694137 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT694288 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT694608 CXorf56 chromosome X open reading frame 56 2 2
MIRT694988 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695160 TCTN2 tectonic family member 2 2 2
MIRT695359 PHAX phosphorylated adaptor for RNA export 2 2
MIRT695538 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695884 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696015 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696052 ZNF264 zinc finger protein 264 2 2
MIRT696119 GLP2R glucagon like peptide 2 receptor 2 2
MIRT696154 SLC11A2 solute carrier family 11 member 2 2 2
MIRT696158 TIPIN TIMELESS interacting protein 2 2
MIRT696295 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT696394 CORO7 coronin 7 2 2
MIRT696675 APOC3 apolipoprotein C3 2 2
MIRT696696 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT696742 RBM28 RNA binding motif protein 28 2 2
MIRT696842 WDR13 WD repeat domain 13 2 2
MIRT697179 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT697876 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT698134 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT698352 TMEM127 transmembrane protein 127 2 2
MIRT698698 TBC1D15 TBC1 domain family member 15 2 2
MIRT698824 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT699111 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT699657 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT699845 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT699954 RSBN1 round spermatid basic protein 1 2 2
MIRT700447 PURB purine rich element binding protein B 2 2
MIRT700887 PER2 period circadian clock 2 2 2
MIRT700906 PDXK pyridoxal kinase 2 2
MIRT701001 PCSK6 proprotein convertase subtilisin/kexin type 6 2 2
MIRT701082 PAPOLG poly(A) polymerase gamma 2 2
MIRT701138 PANK1 pantothenate kinase 1 2 2
MIRT701204 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT701374 NOA1 nitric oxide associated 1 2 2
MIRT701627 MYO10 myosin X 2 2
MIRT701847 MRO maestro 2 2
MIRT702074 PCDHB11 protocadherin beta 11 2 2
MIRT702265 LHX4 LIM homeobox 4 2 3
MIRT702350 KLHL26 kelch like family member 26 2 2
MIRT702417 KIF5B kinesin family member 5B 2 2
MIRT702553 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT702769 IFNLR1 interferon lambda receptor 1 2 2
MIRT703300 GGCX gamma-glutamyl carboxylase 2 2
MIRT703408 FYTTD1 forty-two-three domain containing 1 2 2
MIRT703467 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT703549 FKBP14 FK506 binding protein 14 2 2
MIRT703953 ENAH ENAH, actin regulator 2 2
MIRT703969 EMC10 ER membrane protein complex subunit 10 2 2
MIRT704307 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704455 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT705028 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT705113 C4orf29 abhydrolase domain containing 18 2 2
MIRT705837 AHCY adenosylhomocysteinase 2 2
MIRT708432 CPM carboxypeptidase M 2 2
MIRT710340 ZNF669 zinc finger protein 669 2 2
MIRT710828 PLEKHO2 pleckstrin homology domain containing O2 2 2
MIRT712615 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714275 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT718942 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT719748 RRP8 ribosomal RNA processing 8 2 2
MIRT720035 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT720432 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT720632 SPA17 sperm autoantigenic protein 17 2 2
MIRT720728 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT722882 MOB3A MOB kinase activator 3A 2 2
MIRT723045 YTHDC1 YTH domain containing 1 2 2
MIRT723441 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 2 2
MIRT724404 WWC1 WW and C2 domain containing 1 2 2
MIRT725459 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-548s Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-548s Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-548s Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548s Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548s Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-548s Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-548s Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548s Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission