| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-552 |
| Genomic Coordinates | chr1: 34669599 - 34669694 |
| Synonyms | MIRN552, hsa-mir-552, MIR552 |
| Description | Homo sapiens miR-552 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-552-5p | ||||||||||||||||||||||||
| Sequence | 25| GUUUAACCUUUUGCCUGUUGG |45 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PLAG1 | ||||||||||||||||||||
| Synonyms | PSA, SGPA, ZNF912 | ||||||||||||||||||||
| Description | PLAG1 zinc finger | ||||||||||||||||||||
| Transcript | NM_001114634 | ||||||||||||||||||||
| Other Transcripts | NM_001114635 , NM_002655 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PLAG1 | |||||||||||||||||||||
| 3'UTR of PLAG1 (miRNA target sites are highlighted) |
>PLAG1|NM_001114634|3'UTR 1 GATTCTGGGACATGGATTCATTACAGAAATGTATGTGTAGCTGTGCCCTAGATGACCATTTTTATTTTAGTGCCTACTTT 81 AAAACAGTATAAAAATTTCTGCTTTTGTATAATACAAATTTTCATTAAGCCAGTATAAAATAGAAACTAGCTTTTAAACT 161 GAGCTTTGGAACCATTTGTGTTCAGTTAAGTTTACCTGGGTATTTTGTCCTGATTCACTGCCAATTGTCACATTTTAAGA 241 CTTTTTTTTTTCCATATAGGAAAGCCATTATTAGTAGTAAACTTTTACAAATCCCATTTTCAAATTACTTTTAGATCTTA 321 AAATTTTCATTTTTGTCTAATAACAGTGGCTCTACCTTTTGACATCTGGCTCATTAAAAAATTTAGCAATAGAATGTAAA 401 TTGTATAAAAAGTTTGTGAATAACTCAAGGGTTTAAATTTTCTTACTAGCTTCTAAATGGATTAATAATCAAGTGCTTCA 481 AATGAATTAAGAGTCCAGTTTCGGAAGATAATAAATGTTTGTTAGATACACCATAATTTCAGATCAGTATATTCTGAAGA 561 CTCCCTGTTGTCTGGCTAAAATATTTGCCATCTTTATTATGAGCCTTTAAGGAAAACAAACCCTAAACACAAAGCATCAG 641 TATTTATAGCAAAAAGAGACTCTGTTAGGTGACATGGCATTTCGTGTCACTTAATAGTTGGCCCTAAATTAGTACACAGG 721 ATATTTTGTCGTGTTTCATCCTTCTTAACATGCTATCTTTTCATTTAATAATAGTAATAGTGTATGGCATTGGGGTCTTC 801 AGAGTCGATATATAGGTAGATCTCTTTAGTCTTTTCCACCTTTCACATCCAAGGGGTGGGTCAAGTGCAGCCAGCAATTT 881 ATTTTCATTGTTGGCCCACGGTTAGTCCATAATCTAGAGCCATTGTGGAACTGCAGCCATGAGGTGTGTTTATCCCACAG 961 TGGATTGACTCAGCCTCTGTGGGTGACAGACTTCTAAGCAGGAAGATAGACGTGAAGCACATGGTTACATTTGGGAACTT 1041 GTGTAGGGATCATGGCCCCTGTAGCCAGGGTTAAAAACTGGACTTTTTAGAAGTAAAGTAAAAGCATATCGCTTATATCA 1121 TTTCTTGCTGAATTTGATATGTTTTTCTTTCCCTTAAGAATCAAAAGCAGAAAACAAAAACAACAGTCCTACTCCGATGT 1201 TATCTTTCTGATTCAATGTGAATCCATCTTTCCTTGCAATATTTTGGATGGAGAATTTGAAGTTAAATGCATTAGAAAAC 1281 TACCTGATGAACTACCACAAAGTTTTAAGTGACTAGAAATATATACAGTAAAATCCCACTTTCATGCATCTCTGGGAAAT 1361 GATAGGAGTATTGCAAATAAGTTGAGTTTGTAGAGGGTAACAAAGTAAAGTAAAACAAACCTATCTTGGTTAACATGAAA 1441 ATAACAATTGAGAATATATTATATTCACTGAATAATTATAGGCTTTTCCTCACATTAGACAACCAACATAATCTTCTTAA 1521 AGGTCTAATTAATATATTTTTCTAAGGGTCAGTTGGGACATTAACCTAAGAAACATATCTATTAAGCACTTGTTAACACC 1601 TTATTTTAGGACCCTTTCCGTTGGGGATGGGGGCAAGGGTGGGAGGTTTTTAGAAGAGTATATATCTCTTTAAAAAAAAA 1681 CAGAAAGAAAAATATTTCTGAGCACTCATTAGCCCTATATGGAAACTTCTTTCCTTTTTGTAGGGCCAGTTATCACTGCA 1761 GATTGCAATGTTTACCAAGAATTTCTAAAAATGAGTGCAGATTACTGAATATAATACATTATTTAAAATATTTGGGAGTA 1841 GTATAATTTGTGGAGAAATGTAAATTGTAATAATGTAAATGGGGGCTTCAATATATATATATAATACACACACACACACA 1921 CATGCACACATACCGCACTTCATAGAATCAAAGTTGCTCTCTGAAGGAGCTTTGGCTCCTGATATTTTATCATGCTCCTA 2001 TATTTTTTTAATCCTTGGAGCAGTAGTTTTTATACTTATGTATTTAAATTTTATTATGAAAAATTACATTTATTAAAAAA 2081 GTGTGTTCCAAAGGCATTAAAATTATATATGTTAATAAGGAAGTACATTTTTAAATTTTTCAAACTGCTCCTAGCTTTTG 2161 ATTAGGAGAATATTTTTTCTGAAAGTAGGCTTTTCGCTCTGCTTCATTACTGCTTCCTTTAGTTTCTATGAAACAGATTG 2241 CTTACCTAAATCTTTAGTTGAATGATTAGTGTTCAATATTGCTTTAATCACCATATAAAAGGAAAAAAATTGGTGACAGA 2321 GCACAAATAGAAAACCTATTTTTAAATAGAAATCACAAATAGCAAGTGTGGAAGCACTACTTTATTCTGTTTAAAATGTA 2401 CTTAAGAAGTCATCAAATTAGTGAACTGAGACATTGGCCTTAGTAGGCTGTATTCACTGCTAATTTAAAAAAGGGAGTAC 2481 CAGGATTTATTAAGTAAAGCATTTTGGAAATGGGGAATAGCGCCATATATGTATGTATGTGTATGTGTGTGTGTGTGTGT 2561 GTATATATACACACACACACACATACTTAAATCTTGCCCTGCATGAAATTCAAATACATGGAGGCACATCTTCAGGGCAC 2641 CAGTGTTAAAATTTTGGAGTCTTAATTTTCATGTGTACACCTCTTTGCCTGTTCCCACCCCCAGACTTGAAATAACACTT 2721 CAGAGTAAGAGGGAATTCAGCTAATTTGTTTTTAAAATTGACTGTAGTGGTCACTAAACCCTTTTTGAGAGAATTTCTAT 2801 TAAAGATGAGGCAGACTCGCTTATTTGAATTGCACAATGTTCTAACAAGGATGTAACACAGAATTGGCTTTTTTTTCCCT 2881 AGAAAAAGATTGTTTGTTTCTATGTCAACTAGATATGATTAAAAATAAGTATTGCCAATGCTGTTTTCATTCTCTAGTGG 2961 CCAGAATCATTATCCTTGAAATTTCTGGTAGTGCCTTAGCTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAGGGATTAA 3041 CATTAAATAAAAGTAGTTTAGAATTTGGGCCTCAGACAAGATATTGAACCTCATTCAGTTTCACTTCCACATGTATGTAC 3121 AAGTTAGGTCACCAAACACGGAAGTGTGAGTGTGGAAGGATCTTGGCACTGTAAGCAATGCTATCCATTGATGTATACAA 3201 GTACCTTTATAGTTATCGATCACTGTTAAAACTTTCATTTTAAAATCCTATTACCAAGTTCAGTTTTTTAAAACTTCAAT 3281 TGTCCTGGCTGATTATGCATCACTCTGTGTGCAACTTTTTTATTTCATTTAGTGTTTCTTTCAAGCTGTGTATTTTTGCC 3361 TATTTGTTGCTTGTGCTTTATTTTTCTTAGTCATTTGTGGAATATAGTGATATATTGTGTTAATTTGGACAGTAGCGGTT 3441 TTTAAAAACCATATACTGACTGAAACATGAGCCAGAGCCGATTGCTTTATTAAGCTAATAATGAATGTTAAAGAGTACAT 3521 ATTTTCAGGATCGTTCATCTAGTGAGCAATACACATATTATAGGCCAATATTTTTTTAAAAAATAGAGCTTGGTCAACCT 3601 CTATACTACACATATTACAAGATATAGCACTTTCAAAATGAATCTAAACCTTTACAGAAACTTTCTTATAGGTTATGCCT 3681 TTTATTTTAAGACTTATTATAATTCAAGTGCCATTAGATGATATATATGTAGGCCTTTGATATATAATGCTTTGTGTACA 3761 AAAATGGTAGATGGTATTTTAAACAGGTACATTTTTACAGTGTTTTCTTATCAATTTGCTATATTGCACAGAATCAGTGT 3841 GTGTCTTTTCATAAGGTTTTACAATGGTTTATTTTTTTACAAGGTTTACGTGTCTCAAAGCACACTGTCTTCCCAGTACG 3921 TAAGTTAAAAAATACCAGTTCACCCAAGTTGCTTCTAGCCTACTGAGATCCATGTGACATTGGAGGAGATCTTTTAAATG 4001 TTTAGTATTCGTCATTAGCAATGGCTGGCTGTTAGTTCTGGTAAATGTGTGCCTAAGTTGAATTTGTCTTGTTTTTCTCA 4081 CACTGTGTCAGCAGCCATGTCTACAACACAGATAAGTCTGTTGTGATCACATAGATCTACATAAGTTGTGCAGTTTTGTG 4161 CTAAAAACCCATAGGGAGCTCCTTTGGGATCATAGAAAAGAAGATCATGCAACCAGCATTGGTGAAGGCACACTCAGATT 4241 GCACTTAGGGCCTTTCTATGATGTTGTCAACCCTCTGAGGATGGAAGGCAGTGTCTTTTGATGTTATCTAGCCTAGAAAT 4321 GACACAGAACTATTGCTAATGTATAAAACACTTCATTATATAAGCTTCAGTGGTACAGATGAACCAGAATGAATGTTTAT 4401 CTTCTCAGAAACACTCCTTCAATATTATATTGGATCATGCTGCTAATGTAACTTGGGCTACAACTCTTCATGGTGCTACA 4481 AACTTCTCTGTCTCATTCAGTCGTATTTTTTTATCCATAGAAAAAGGACTACATTAGGTGTAAAAGTGTACAATATATTT 4561 TTATACTGTGACTTAATTTGTCATTAACAAACTTTTACACCACCACAATGTATTCATGTGCACTTGCAAAAGGAGATCTC 4641 GGACATGCAAATGTTACCAGAACAAACCCAGCTTTTGTCCACAAGGTGACTGTAACTCAGAATGGAAAGTGGGCTTTATA 4721 ATAGGGTGTGGAGTGAAGAACATGCTGTATGTTACTAACAGCCCTTTGAATTTAACAAAAACTGGGAATCCATTAGGAAA 4801 CGGATTGCATCATACCTGAACATAAGCTGGACTGCTGAAATTGTATTTTTAGCTAATGAAAAAGTGTTTGGACTAGTACT 4881 CTAAAAATGTTCTAATGATAAAGTTTTGAGTCAAAATAGAAAAGAAAAAAATCTGCATTCCAGGCCGAATTTTGTATATT 4961 TTTATTGCATTTAAAATTGCTATTCTGTAATATTGGGAAATCAAGTGGCTTATCATGTATATCGTGTACTTAAAATGTAT 5041 TCACAAACTACTGTTGTATTTGTATAAAATATAGACAAAGATCATATTTTTTGTGTGTGTATAAGCTCTGTAAAATAGCA 5121 ATCACATTATGAAGCTGCAGTGATACTACATTTTAAACATTCACATCCAAAGAAGCAGACTATTTATTGTCCATATACCA 5201 GATTTAAAATATTAATTTGCTGCTAATTAAATAATAGTACTGCAGCTTCTTGTGGCCTACAGTGTTATGTTTGCTGTAAG 5281 AATAAGATATGTGAATTCCACAAAATATATGAATAAAATTATAGAATGGCTTTA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HeLa | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | BC-3 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796040. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293S |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb
HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb
HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb
HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb
HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb
HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb
HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb
HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb
HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
| Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Cardiac Tissues |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
| Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Liver Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2550631. RNA binding protein: AGO2. Condition:Patient 9 Tumor 1
... - Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al., 2017, Molecular cell. |
| Article |
- Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al. - Molecular cell, 2017
MicroRNA-122, an abundant and conserved liver-specific miRNA, regulates hepatic metabolism and functions as a tumor suppressor, yet systematic and direct biochemical elucidation of the miR-122 target network remains incomplete. To this end, we performed Argonaute crosslinking immunoprecipitation (Argonaute [Ago]-CLIP) sequencing in miR-122 knockout and control mouse livers, as well as in matched human hepatocellular carcinoma (HCC) and benign liver tissue to identify miRNA target sites transcriptome-wide in two species. We observed a majority of miR-122 binding on 3' UTRs and coding exons followed by extensive binding to other genic and non-genic sites. Motif analysis of miR-122-dependent binding revealed a G-bulged motif in addition to canonical motifs. A large number of miR-122 targets were found to be species specific. Upregulation of several common mouse and human targets, most notably BCL9, predicted survival in HCC patients. These results broadly define the molecular consequences of miR-122 downregulation in hepatocellular carcinoma.
LinkOut: [PMID: 28735896]
|
| CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | HeLa / HeLa cell Control B |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1084065 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAAAAAAAAAGGGAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1084066 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_noemetine_SantaCruzAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1084068 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_noemetine_SigmaAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1084069 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_emetine_SigmaAb |
| Location of target site | ENST00000316981.3 | 3UTR | CUUGGUUAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1084075 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAAAAAAAAAGGGAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1084079 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_AbnovaAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1084081 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1084082 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_SigmaAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM1084083 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_SigmaAb |
| Location of target site | ENST00000316981.3 | 3UTR | UGGUUAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM796040 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | BC-3 / 4-Thiouridine |
| Location of target site | ENST00000316981.3 | 3UTR | UUGGUUAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22100165 / GSE32109 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
118 hsa-miR-552-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT060509 | PPP6R3 | protein phosphatase 6 regulatory subunit 3 |  |
|
2 | 2 | ||||||
| MIRT061011 | C1ORF21 | chromosome 1 open reading frame 21 | |
|
2 | 6 | ||||||
| MIRT090823 | MBNL1 | muscleblind like splicing regulator 1 | |
|
2 | 4 | ||||||
| MIRT126569 | MASTL | microtubule associated serine/threonine kinase like | |
|
2 | 2 | ||||||
| MIRT147688 | CBX4 | chromobox 4 | |
|
2 | 4 | ||||||
| MIRT191746 | ELMSAN1 | ELM2 and Myb/SANT domain containing 1 | |
|
2 | 4 | ||||||
| MIRT202397 | GPCPD1 | glycerophosphocholine phosphodiesterase 1 | |
|
2 | 2 | ||||||
| MIRT231334 | XRRA1 | X-ray radiation resistance associated 1 | |
|
2 | 8 | ||||||
| MIRT241355 | SLC16A1 | solute carrier family 16 member 1 | |
|
2 | 2 | ||||||
| MIRT280627 | BCL11B | B-cell CLL/lymphoma 11B | |
|
2 | 2 | ||||||
| MIRT287408 | GPATCH8 | G-patch domain containing 8 | |
|
2 | 2 | ||||||
| MIRT314310 | FCHO2 | FCH domain only 2 | |
|
2 | 2 | ||||||
| MIRT321751 | ANKRD46 | ankyrin repeat domain 46 | |
|
2 | 2 | ||||||
| MIRT329335 | ETF1 | eukaryotic translation termination factor 1 | |
|
2 | 2 | ||||||
| MIRT346611 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | |
|
2 | 6 | ||||||
| MIRT349189 | ZNF557 | zinc finger protein 557 | |
|
2 | 2 | ||||||
| MIRT357416 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | |
|
2 | 2 | ||||||
| MIRT359670 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | |
|
2 | 2 | ||||||
| MIRT442751 | PLAG1 | PLAG1 zinc finger | |
|
2 | 6 | ||||||
| MIRT446639 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | |
|
2 | 2 | ||||||
| MIRT450820 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT452304 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | |
|
2 | 2 | ||||||
| MIRT468814 | RSRC2 | arginine and serine rich coiled-coil 2 | |
|
2 | 6 | ||||||
| MIRT471878 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 6 | ||||||
| MIRT472681 | MYCBP | MYC binding protein | |
|
2 | 4 | ||||||
| MIRT473123 | MLLT10 | MLLT10, histone lysine methyltransferase DOT1L cofactor | |
|
2 | 2 | ||||||
| MIRT477434 | EML4 | echinoderm microtubule associated protein like 4 | |
|
2 | 4 | ||||||
| MIRT501254 | SECISBP2L | SECIS binding protein 2 like | |
|
2 | 2 | ||||||
| MIRT501586 | PLCG1 | phospholipase C gamma 1 | |
|
2 | 2 | ||||||
| MIRT503371 | SCAMP1 | secretory carrier membrane protein 1 | |
|
2 | 2 | ||||||
| MIRT504358 | ARID1B | AT-rich interaction domain 1B | |
|
2 | 6 | ||||||
| MIRT504421 | SHC4 | SHC adaptor protein 4 | |
|
2 | 6 | ||||||
| MIRT505497 | SRSF1 | serine and arginine rich splicing factor 1 | |
|
2 | 4 | ||||||
| MIRT505792 | RSBN1 | round spermatid basic protein 1 | |
|
2 | 8 | ||||||
| MIRT506471 | NAA25 | N(alpha)-acetyltransferase 25, NatB auxiliary subunit | |
|
2 | 4 | ||||||
| MIRT507372 | EPS8 | epidermal growth factor receptor pathway substrate 8 | |
|
2 | 2 | ||||||
| MIRT510850 | RAN | RAN, member RAS oncogene family | |
|
2 | 8 | ||||||
| MIRT510986 | PER1 | period circadian clock 1 | |
|
2 | 4 | ||||||
| MIRT512987 | SEZ6L | seizure related 6 homolog like | |
|
2 | 4 | ||||||
| MIRT514937 | GPR141 | G protein-coupled receptor 141 | |
|
2 | 2 | ||||||
| MIRT522131 | NRBF2 | nuclear receptor binding factor 2 | |
|
2 | 6 | ||||||
| MIRT524300 | CTC1 | CST telomere replication complex component 1 | |
|
2 | 8 | ||||||
| MIRT526363 | LSAMP | limbic system-associated membrane protein | |
|
2 | 2 | ||||||
| MIRT526441 | RBM48 | RNA binding motif protein 48 | |
|
2 | 2 | ||||||
| MIRT526534 | MDM2 | MDM2 proto-oncogene | |
|
2 | 4 | ||||||
| MIRT528065 | HES2 | hes family bHLH transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT531043 | TIPARP | TCDD inducible poly(ADP-ribose) polymerase | |
|
2 | 2 | ||||||
| MIRT532313 | FKBP9 | FK506 binding protein 9 | |
|
2 | 4 | ||||||
| MIRT533196 | WASF3 | WAS protein family member 3 | |
|
2 | 4 | ||||||
| MIRT535701 | NAV1 | neuron navigator 1 | |
|
2 | 5 | ||||||
| MIRT536791 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
|
2 | 2 | ||||||
| MIRT537228 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | |
|
2 | 6 | ||||||
| MIRT538247 | CUX2 | cut like homeobox 2 | |
|
2 | 2 | ||||||
| MIRT538476 | CLOCK | clock circadian regulator | |
|
2 | 2 | ||||||
| MIRT538798 | C2CD5 | C2 calcium dependent domain containing 5 | |
|
2 | 2 | ||||||
| MIRT539031 | ATXN7L1 | ataxin 7 like 1 | |
|
2 | 2 | ||||||
| MIRT542043 | SLC25A46 | solute carrier family 25 member 46 | |
|
2 | 2 | ||||||
| MIRT543093 | TNFRSF11A | TNF receptor superfamily member 11a | |
|
2 | 2 | ||||||
| MIRT543545 | INTS2 | integrator complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT554332 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | |
|
2 | 4 | ||||||
| MIRT556070 | MRFAP1 | Morf4 family associated protein 1 | |
|
2 | 2 | ||||||
| MIRT558125 | ENPP4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) | |
|
2 | 2 | ||||||
| MIRT559132 | BTG3 | BTG anti-proliferation factor 3 | |
|
2 | 4 | ||||||
| MIRT559423 | ASF1A | anti-silencing function 1A histone chaperone | |
|
2 | 2 | ||||||
| MIRT560026 | ZNF780A | zinc finger protein 780A | |
|
2 | 2 | ||||||
| MIRT566128 | RACGAP1 | Rac GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT566441 | PHF13 | PHD finger protein 13 | |
|
2 | 2 | ||||||
| MIRT568541 | AKT3 | AKT serine/threonine kinase 3 | |
|
2 | 2 | ||||||
| MIRT568626 | ACVR2A | activin A receptor type 2A | |
|
2 | 2 | ||||||
| MIRT576599 | Nav1 | neuron navigator 1 | |
|
2 | 4 | ||||||
| MIRT609438 | USP27X | ubiquitin specific peptidase 27, X-linked | |
|
2 | 2 | ||||||
| MIRT611441 | NRIP3 | nuclear receptor interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT613007 | GABRB1 | gamma-aminobutyric acid type A receptor beta1 subunit | |
|
2 | 2 | ||||||
| MIRT614149 | CEP97 | centrosomal protein 97 | |
|
2 | 2 | ||||||
| MIRT614580 | LHX1 | LIM homeobox 1 | |
|
2 | 2 | ||||||
| MIRT615631 | ATF6 | activating transcription factor 6 | |
|
2 | 4 | ||||||
| MIRT616115 | NDUFS1 | NADH:ubiquinone oxidoreductase core subunit S1 | |
|
2 | 2 | ||||||
| MIRT620351 | WDR75 | WD repeat domain 75 | |
|
2 | 2 | ||||||
| MIRT621733 | TNPO2 | transportin 2 | |
|
2 | 2 | ||||||
| MIRT623718 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT626107 | MYLIP | myosin regulatory light chain interacting protein | |
|
2 | 2 | ||||||
| MIRT630779 | CRLS1 | cardiolipin synthase 1 | |
|
2 | 2 | ||||||
| MIRT632585 | PLCL1 | phospholipase C like 1 (inactive) | |
|
2 | 2 | ||||||
| MIRT635161 | HOXD12 | homeobox D12 | |
|
2 | 2 | ||||||
| MIRT635878 | SIX3 | SIX homeobox 3 | |
|
2 | 2 | ||||||
| MIRT636941 | LIMS3 | LIM zinc finger domain containing 3 | |
|
2 | 2 | ||||||
| MIRT637007 | LIMS3L | LIM zinc finger domain containing 4 | |
|
2 | 2 | ||||||
| MIRT639202 | LRRC9 | leucine rich repeat containing 9 | |
|
2 | 4 | ||||||
| MIRT639388 | PKHD1 | PKHD1, fibrocystin/polyductin | |
|
2 | 2 | ||||||
| MIRT639543 | SMCR7L | mitochondrial elongation factor 1 | |
1 | 1 | |||||||
| MIRT642071 | FUT11 | fucosyltransferase 11 | |
|
2 | 2 | ||||||
| MIRT642567 | GDPGP1 | GDP-D-glucose phosphorylase 1 | |
|
2 | 2 | ||||||
| MIRT643035 | SNX24 | sorting nexin 24 | |
|
2 | 2 | ||||||
| MIRT648372 | SMPD1 | sphingomyelin phosphodiesterase 1 | |
|
2 | 2 | ||||||
| MIRT648529 | KIAA1143 | KIAA1143 | |
|
2 | 2 | ||||||
| MIRT652184 | TRIM44 | tripartite motif containing 44 | |
|
2 | 2 | ||||||
| MIRT652945 | SYNC | syncoilin, intermediate filament protein | |
|
2 | 2 | ||||||
| MIRT657012 | KCNK5 | potassium two pore domain channel subfamily K member 5 | |
|
2 | 2 | ||||||
| MIRT658993 | DIP2C | disco interacting protein 2 homolog C | |
|
2 | 2 | ||||||
| MIRT659629 | CDKN2AIP | CDKN2A interacting protein | |
|
2 | 2 | ||||||
| MIRT659769 | CCBE1 | collagen and calcium binding EGF domains 1 | |
|
2 | 2 | ||||||
| MIRT660527 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT668526 | ERP44 | endoplasmic reticulum protein 44 | |
|
2 | 2 | ||||||
| MIRT687184 | PRKAR1A | protein kinase cAMP-dependent type I regulatory subunit alpha | |
|
2 | 2 | ||||||
| MIRT696280 | IER3IP1 | immediate early response 3 interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT697673 | WASL | Wiskott-Aldrich syndrome like | |
|
2 | 2 | ||||||
| MIRT697716 | VKORC1L1 | vitamin K epoxide reductase complex subunit 1 like 1 | |
|
2 | 2 | ||||||
| MIRT699719 | SESTD1 | SEC14 and spectrin domain containing 1 | |
|
2 | 2 | ||||||
| MIRT701220 | OGDH | oxoglutarate dehydrogenase | |
|
2 | 2 | ||||||
| MIRT701436 | NFYA | nuclear transcription factor Y subunit alpha | |
|
2 | 2 | ||||||
| MIRT701554 | NANOS1 | nanos C2HC-type zinc finger 1 | |
|
2 | 2 | ||||||
| MIRT707559 | CLVS2 | clavesin 2 | |
|
2 | 2 | ||||||
| MIRT707925 | PPP1R3D | protein phosphatase 1 regulatory subunit 3D | |
|
2 | 2 | ||||||
| MIRT711148 | NAA15 | N(alpha)-acetyltransferase 15, NatA auxiliary subunit | |
|
2 | 2 | ||||||
| MIRT719256 | CD44 | CD44 molecule (Indian blood group) | |
|
2 | 2 | ||||||
| MIRT719810 | TXNDC17 | thioredoxin domain containing 17 | |
|
2 | 2 | ||||||
| MIRT722650 | SIGLEC14 | sialic acid binding Ig like lectin 14 | |
|
2 | 2 | ||||||
| MIRT723901 | PEX11A | peroxisomal biogenesis factor 11 alpha | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|