pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-921 |
Genomic Coordinates | chr1: 166154743 - 166154798 |
Synonyms | MIRN921, hsa-mir-921, MIR921 |
Description | Homo sapiens miR-921 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-921 | ||||||||||||
Sequence | 2| CUAGUGAGGGACAGAACCAGGAUUC |26 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RNF20 | ||||||||||||||||||||
Synonyms | BRE1, BRE1A, hBRE1 | ||||||||||||||||||||
Description | ring finger protein 20 | ||||||||||||||||||||
Transcript | NM_019592 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on RNF20 | |||||||||||||||||||||
3'UTR of RNF20 (miRNA target sites are highlighted) |
>RNF20|NM_019592|3'UTR 1 TCTAAGTCAAGAGAAGAAGAGGAGCTGGCTAGTCAGGAACTTATTCATTAACCACCAAACCTCTACCTCTTCTCTCCTTG 81 ACTGTCACCTGTAGGACAGTTTATCAGTCAACTACCTTTCCTCCAGACTTTACTTCCAGGCTCTCCTCTTCAGTAGCTGG 161 ATGACTTTAGCAGAAAGGACTGGTAAATACAAGCCTTGGGTTTCAGAATGAATTAGAAACAAATAACTCTTACTGTCTTC 241 CCTCCCAGCTTTGTTTATTTTGTGCTTTTAGACTTTTCAGTGTTTTCTTTTTCCAGCCCACTGTATAAACTTGGATTGTC 321 CATTCCTCCTGAAGAAATCAAGTTGGTATTTTTGATGTGGAAAAGGGAACAAAAGTGGAAACATGGCTACTTTTGGGGAG 401 TGATATTTTAAAAAATAAGTTGTCTATGGGCACAAAGTTTTCTTCATTTGTGTAGCAAACTTCTTGTGAATGTGGATTAC 481 AAAATGGTATAATTGTGCTACTCTCCCCTGGGTGGTTTGCAGCCCTAATGAAATTATGTCTAGGATGATTCAGTCTATTT 561 CCCATTTACTAGCAGAGTAACTTGTTAAGATCAGCTGGCTTTCTTGTTAAAGTTATTTAAGTTTTGAATGCTCTACTACT 641 TCAAGTCTTTAAATTTCTTGAGACTAGAATAATTTTAAATAATATGACCCTTTGTCTTCTAATGAAATAAAGATTGAAGA 721 GGTTGAGTCAGGACTGAGCTGGTGAAGAAATCTTGTGGGTATTCTGGAAATTTGATACGGAGAGAACTTGGTGAGCTATG 801 AATTACTCTCAGTCTCCTTTTTACAGGGTTGTTGTGATCCCTCTTTTCCAGAAAATTCTGTGGAATGTTTCTGTAGGACT 881 TTGTTCTCCACAAGCTTGAATTAAAGCAGGATTCAGTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | BC-3 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
CLIP-seq Support 1 for dataset GSM796039 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-3 / 4-Thiouridine |
Location of target site | ENST00000389120.3 | 3UTR | UUGGCUUCUCUCACUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
63 hsa-miR-921 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT054764 | ANGPTL1 | angiopoietin like 1 | 3 | 1 | ||||||||
MIRT066171 | PIP4K2C | phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | 2 | 2 | ||||||||
MIRT069409 | ZFYVE21 | zinc finger FYVE-type containing 21 | 2 | 8 | ||||||||
MIRT102284 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | 2 | 4 | ||||||||
MIRT107595 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | 2 | 6 | ||||||||
MIRT178618 | HIAT1 | major facilitator superfamily domain containing 14A | 2 | 2 | ||||||||
MIRT182407 | TIPRL | TOR signaling pathway regulator | 2 | 4 | ||||||||
MIRT186552 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT273662 | HOXC8 | homeobox C8 | 2 | 2 | ||||||||
MIRT283191 | C16ORF52 | chromosome 16 open reading frame 52 | 2 | 2 | ||||||||
MIRT284890 | NFAT5 | nuclear factor of activated T-cells 5 | 2 | 2 | ||||||||
MIRT347670 | LSM14A | LSM14A, mRNA processing body assembly factor | 2 | 2 | ||||||||
MIRT400222 | SLC35F6 | solute carrier family 35 member F6 | 2 | 2 | ||||||||
MIRT403517 | ASPH | aspartate beta-hydroxylase | 2 | 2 | ||||||||
MIRT442251 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT443023 | SDR39U1 | short chain dehydrogenase/reductase family 39U member 1 | 2 | 2 | ||||||||
MIRT443097 | RNF20 | ring finger protein 20 | 2 | 2 | ||||||||
MIRT444560 | TRA2B | transformer 2 beta homolog | 2 | 2 | ||||||||
MIRT445696 | PRKG1 | protein kinase, cGMP-dependent, type I | 2 | 2 | ||||||||
MIRT454084 | TMEM209 | transmembrane protein 209 | 2 | 2 | ||||||||
MIRT455463 | LYPLA2 | lysophospholipase II | 2 | 2 | ||||||||
MIRT456653 | TIFA | TRAF interacting protein with forkhead associated domain | 2 | 2 | ||||||||
MIRT458147 | LYRM4 | LYR motif containing 4 | 2 | 6 | ||||||||
MIRT467073 | SRRD | SRR1 domain containing | 2 | 4 | ||||||||
MIRT467245 | SPPL2A | signal peptide peptidase like 2A | 2 | 2 | ||||||||
MIRT468246 | SFXN4 | sideroflexin 4 | 2 | 2 | ||||||||
MIRT471589 | PAQR5 | progestin and adipoQ receptor family member 5 | 2 | 19 | ||||||||
MIRT476639 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT482433 | ADM | adrenomedullin | 2 | 10 | ||||||||
MIRT486848 | PERP | PERP, TP53 apoptosis effector | 2 | 6 | ||||||||
MIRT489656 | SHMT1 | serine hydroxymethyltransferase 1 | 2 | 2 | ||||||||
MIRT493441 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | 2 | 6 | ||||||||
MIRT493841 | FOXN3 | forkhead box N3 | 2 | 4 | ||||||||
MIRT501378 | RBFOX2 | RNA binding protein, fox-1 homolog 2 | 2 | 10 | ||||||||
MIRT509679 | ATAD5 | ATPase family, AAA domain containing 5 | 2 | 4 | ||||||||
MIRT510280 | MED28 | mediator complex subunit 28 | 2 | 2 | ||||||||
MIRT512221 | ATXN3 | ataxin 3 | 2 | 6 | ||||||||
MIRT514030 | BNIP2 | BCL2 interacting protein 2 | 2 | 2 | ||||||||
MIRT521375 | RDX | radixin | 2 | 4 | ||||||||
MIRT521444 | RAD51 | RAD51 recombinase | 2 | 2 | ||||||||
MIRT526055 | CBR1 | carbonyl reductase 1 | 2 | 2 | ||||||||
MIRT528658 | FUNDC2 | FUN14 domain containing 2 | 2 | 2 | ||||||||
MIRT529975 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | 2 | 2 | ||||||||
MIRT544098 | IPMK | inositol polyphosphate multikinase | 2 | 2 | ||||||||
MIRT545579 | SNRPA1 | small nuclear ribonucleoprotein polypeptide A' | 2 | 2 | ||||||||
MIRT547424 | MED4 | mediator complex subunit 4 | 2 | 2 | ||||||||
MIRT548955 | CD2AP | CD2 associated protein | 2 | 2 | ||||||||
MIRT549537 | NDUFA6 | NADH:ubiquinone oxidoreductase subunit A6 | 2 | 4 | ||||||||
MIRT552550 | ZFP36L2 | ZFP36 ring finger protein like 2 | 2 | 4 | ||||||||
MIRT554640 | ROBO1 | roundabout guidance receptor 1 | 2 | 2 | ||||||||
MIRT564904 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | 2 | 2 | ||||||||
MIRT565578 | SLC6A8 | solute carrier family 6 member 8 | 2 | 2 | ||||||||
MIRT568312 | BAG4 | BCL2 associated athanogene 4 | 2 | 2 | ||||||||
MIRT617891 | PTCHD3 | patched domain containing 3 | 2 | 2 | ||||||||
MIRT621892 | TAF13 | TATA-box binding protein associated factor 13 | 2 | 2 | ||||||||
MIRT642850 | RNF135 | ring finger protein 135 | 2 | 2 | ||||||||
MIRT665395 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 2 | ||||||||
MIRT697879 | UBE2B | ubiquitin conjugating enzyme E2 B | 2 | 2 | ||||||||
MIRT698492 | THOC2 | THO complex 2 | 2 | 2 | ||||||||
MIRT701227 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | 2 | 2 | ||||||||
MIRT701872 | MPLKIP | M-phase specific PLK1 interacting protein | 2 | 2 | ||||||||
MIRT707045 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | 2 | 2 | ||||||||
MIRT715216 | NPVF | neuropeptide VF precursor | 2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|