miRTarBase - #MIRT443288


—
pre-miRNA Information
pre-miRNA hsa-mir-4753   
Genomic Coordinates chr1: 235190034 - 235190116
Description Homo sapiens miR-4753 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4753-5p
Sequence 10| CAAGGCCAAAGGAAGAGAACAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547986869 3 dbSNP
rs1007787337 7 dbSNP
rs1224263160 12 dbSNP
rs1256249071 13 dbSNP
rs1484015538 14 dbSNP
rs535678819 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZC3H12A   
Synonyms MCPIP, MCPIP-1, MCPIP1, Reg1, dJ423B22.1
Description zinc finger CCCH-type containing 12A
Transcript NM_025079   
Expression
Putative miRNA Targets on ZC3H12A
3'UTR of ZC3H12A
(miRNA target sites are highlighted)		 
>ZC3H12A|NM_025079|3'UTR
   1 GCTGCCTGTGGCTGGCAAGGGCAGCACCCCCAGCCTCCAAGGGCCGTCAGGCTGGGCTTTGGGCCATTGAGCAGCCCATT
  81 CCCAGCCCTGAGGCCCACCCCAGAGGCTGGACAGAGGGAGGATTCAAGTCGGGAAGGAAACCCACAAACCAAAGATACTG
 161 TAGGATTGGTTCTGGCCCATGCAGCACCTCTAGCTGTCTGCCTCAGTGGGTCAGAAGCGATCACCCTGTTGATACACATT
 241 GTATCTCTGTAGTTTAAGGAGACGCTGCCGGTAACGGCGTCGGTCCGTGGCTGAGGCCCAAACCGTCTTTTCTCTCAGAG
 321 GGTGGGGAGGGAGGTGGGGGCAGCAGAGGCCTGGGCTGGGTGCCCTGTGCACGCCACCCCACTTCCGCCCTACCCCTGGG
 401 ACGTTGGCCTTGGCTGGCTAGTTGGGCACCGTGTGCCTGCCCTCCAAGGGCCTCCTCTACGCCAATGAGGCCTCATCTGT
 481 GCTCTCGCTGGGCACGTGGCTTCATGTCAGTAAGCAAGATGCTTCTTAATAACCCACCTTCTGCCCCACTCTATTCCTTA
 561 TCCTGCTGCCCCTGTAGGGGTCAAGGGCCCTCCGTCTACACCCTCTTCTTCTCCTCCATCCTTTATTCAGAGTCATCTCG
 641 CCCTTCCCCATGGGTGGGGGAACCTGTGTTTGTTTGTGTGCACATGTAAATTTTAAATATTTTAAGCAGAAAGTCCTTAC
 721 CTCCTGTAACACATCAATAAAGTACAATCATTGTGAGCCCTTTCAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacaagagaagGAAACCGGAAc 5'
                     | |||||||| 
Target 5' tacccctgggaCGTTGGCCTTg 3'
 391 - 412 147.00 -16.30
2 
miRNA  3' gaCAAGAGAAGGA------AACCGGAac 5'
            || ||||  ||       ||||:|  
Target 5' ctGTGCTCTCGCTGGGCACGTGGCTTca 3'
 477 - 504 114.00 -13.40
3 
miRNA  3' gacaagagaaggaaACCGGAAc 5'
                        ||| ||| 
Target 5' aagggccgtcaggcTGGGCTTt 3'
 39 - 60 108.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30513334 24 COSMIC
COSN25838138 31 COSMIC
COSN31517437 38 COSMIC
COSN31605032 45 COSMIC
COSN20073826 46 COSMIC
COSN31519023 71 COSMIC
COSN30538324 72 COSMIC
COSN30529246 123 COSMIC
COSN30128493 141 COSMIC
COSN23014340 192 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1377885008 4 dbSNP
rs1442916232 10 dbSNP
rs1440408265 13 dbSNP
rs1303860655 15 dbSNP
rs912461661 16 dbSNP
rs1370222884 20 dbSNP
rs772958341 21 dbSNP
rs946679268 28 dbSNP
rs762964070 30 dbSNP
rs574631504 31 dbSNP
rs1204093572 32 dbSNP
rs774167500 35 dbSNP
rs199675868 36 dbSNP
rs753906858 43 dbSNP
rs371768832 46 dbSNP
rs201836892 47 dbSNP
rs3170940 51 dbSNP
rs777633519 51 dbSNP
rs369628768 52 dbSNP
rs1048096631 54 dbSNP
rs757114231 54 dbSNP
rs1222142320 57 dbSNP
rs1184869211 62 dbSNP
rs1289591571 67 dbSNP
rs780938838 68 dbSNP
rs3180364 82 dbSNP
rs1354528769 83 dbSNP
rs936996320 87 dbSNP
rs3180365 90 dbSNP
rs575314282 91 dbSNP
rs1222286597 93 dbSNP
rs891388394 95 dbSNP
rs546102310 109 dbSNP
rs1004845196 113 dbSNP
rs1275794291 113 dbSNP
rs1166149351 116 dbSNP
rs1344136063 123 dbSNP
rs1300645514 126 dbSNP
rs185618223 131 dbSNP
rs377046291 132 dbSNP
rs1157605823 133 dbSNP
rs1398608651 142 dbSNP
rs1426904000 148 dbSNP
rs1352057950 151 dbSNP
rs374662351 152 dbSNP
rs528380348 156 dbSNP
rs373963497 160 dbSNP
rs1297094736 166 dbSNP
rs1057232355 167 dbSNP
rs1411245298 169 dbSNP
rs1195797200 175 dbSNP
rs1488619837 179 dbSNP
rs961711889 180 dbSNP
rs1291265326 200 dbSNP
rs546660362 210 dbSNP
rs77186299 220 dbSNP
rs1314772444 226 dbSNP
rs1344051053 229 dbSNP
rs1374705558 244 dbSNP
rs1401149132 250 dbSNP
rs1052225 257 dbSNP
rs774764904 261 dbSNP
rs1428127068 264 dbSNP
rs904658911 265 dbSNP
rs1000380123 266 dbSNP
rs1176357199 268 dbSNP
rs1029059072 270 dbSNP
rs550363156 271 dbSNP
rs1172655911 277 dbSNP
rs1483527031 279 dbSNP
rs760086054 280 dbSNP
rs570246166 282 dbSNP
rs537219398 283 dbSNP
rs913804767 287 dbSNP
rs1209723589 288 dbSNP
rs946731731 293 dbSNP
rs1043741654 305 dbSNP
rs1260416577 305 dbSNP
rs1491287383 306 dbSNP
rs899919370 306 dbSNP
rs2174770 308 dbSNP
rs1212244848 311 dbSNP
rs1380745849 312 dbSNP
rs1019396699 318 dbSNP
rs965319929 323 dbSNP
rs973022005 324 dbSNP
rs145092946 325 dbSNP
rs570841895 331 dbSNP
rs1465981517 334 dbSNP
rs1372404976 335 dbSNP
rs1168266560 345 dbSNP
rs1425592946 347 dbSNP
rs1414635548 350 dbSNP
rs1183159644 355 dbSNP
rs1460143811 356 dbSNP
rs1240336020 365 dbSNP
rs1169187954 373 dbSNP
rs952517244 374 dbSNP
rs1390235464 380 dbSNP
rs983935052 381 dbSNP
rs368510379 386 dbSNP
rs189456134 387 dbSNP
rs937123177 388 dbSNP
rs1322935079 391 dbSNP
rs1312785034 393 dbSNP
rs1374396872 394 dbSNP
rs1244689520 395 dbSNP
rs1380081893 396 dbSNP
rs1311061186 398 dbSNP
rs370755174 403 dbSNP
rs916864037 404 dbSNP
rs574443644 407 dbSNP
rs945740643 414 dbSNP
rs1213887023 418 dbSNP
rs1041964742 420 dbSNP
rs904794869 425 dbSNP
rs980905210 431 dbSNP
rs1442903077 432 dbSNP
rs535961503 446 dbSNP
rs1278473517 452 dbSNP
rs936136132 454 dbSNP
rs987963608 455 dbSNP
rs564344352 461 dbSNP
rs1489090571 462 dbSNP
rs557149518 466 dbSNP
rs889198664 487 dbSNP
rs575675150 488 dbSNP
rs1019031582 496 dbSNP
rs376052789 497 dbSNP
rs1304581978 505 dbSNP
rs921238037 508 dbSNP
rs760326720 519 dbSNP
rs897784484 530 dbSNP
rs993525111 535 dbSNP
rs1052282 542 dbSNP
rs1368179763 547 dbSNP
rs1450793327 549 dbSNP
rs545714602 554 dbSNP
rs1025490528 561 dbSNP
rs142587998 567 dbSNP
rs1362541478 575 dbSNP
rs573222422 576 dbSNP
rs1034188360 584 dbSNP
rs1037160493 587 dbSNP
rs898758943 593 dbSNP
rs763697057 594 dbSNP
rs540486928 595 dbSNP
rs1489601487 600 dbSNP
rs1048737783 604 dbSNP
rs1367200020 609 dbSNP
rs1235118840 611 dbSNP
rs904879997 611 dbSNP
rs1312581771 617 dbSNP
rs1001861567 629 dbSNP
rs1403037324 634 dbSNP
rs796154209 638 dbSNP
rs111749716 640 dbSNP
rs112332298 640 dbSNP
rs917019114 640 dbSNP
rs945680781 643 dbSNP
rs1383042786 645 dbSNP
rs1174557354 646 dbSNP
rs977108579 654 dbSNP
rs1009404628 656 dbSNP
rs1174834719 664 dbSNP
rs1479081557 665 dbSNP
rs753369786 665 dbSNP
rs1264617240 667 dbSNP
rs550550473 667 dbSNP
rs375496656 671 dbSNP
rs561674930 671 dbSNP
rs568555585 671 dbSNP
rs1280936530 673 dbSNP
rs1262259941 676 dbSNP
rs936271441 685 dbSNP
rs954215736 688 dbSNP
rs1278819605 689 dbSNP
rs986812228 691 dbSNP
rs9136 692 dbSNP
rs1336326398 698 dbSNP
rs910671574 699 dbSNP
rs944900298 700 dbSNP
rs1335135910 708 dbSNP
rs1269340554 709 dbSNP
rs1466631437 710 dbSNP
rs1037173460 718 dbSNP
rs920070072 725 dbSNP
rs1040830150 730 dbSNP
rs897926458 736 dbSNP
rs769444093 738 dbSNP
rs1461483542 744 dbSNP
rs931463567 748 dbSNP
rs1201513844 755 dbSNP
rs1049076862 765 dbSNP
rs888363182 767 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaagagaaggaAACCGGAAc 5'
                       |||||||| 
Target 5' -------------UUGGCCUUg 3'
 		1 - 9
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_025079 | 3UTR | CCCCUGGGACGUUGGCCUUGGCUGGCUAGUUGGGCACCGUGUGCCUGCCCUCCAAGGGCCUCCUCUACGCCAAUGAGGCCUCAUCUGUGCUCUCGCUGGGCACGUGGCUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000373087.6 | 3UTR | UUGGCCUUGGCUGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4753-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064916 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT161166 SLC25A36 solute carrier family 25 member 36 2 2
MIRT285542 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT308266 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT311425 LMNB1 lamin B1 2 2
MIRT373989 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT383141 CRY2 cryptochrome circadian clock 2 2 2
MIRT405243 ADIPOR2 adiponectin receptor 2 2 2
MIRT441620 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 6
MIRT441789 SRPK1 SRSF protein kinase 1 2 2
MIRT441804 NOC3L NOC3 like DNA replication regulator 2 2
MIRT441832 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442005 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442411 LIMD1 LIM domains containing 1 2 2
MIRT442708 UBE4B ubiquitination factor E4B 2 2
MIRT442714 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT442738 SERINC5 serine incorporator 5 2 2
MIRT442793 CEP170 centrosomal protein 170 2 2
MIRT442984 ZNF736 zinc finger protein 736 2 2
MIRT443055 THRB thyroid hormone receptor beta 2 2
MIRT443288 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT443325 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443331 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT443593 ZNF439 zinc finger protein 439 2 4
MIRT443696 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT443748 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT443866 HDLBP high density lipoprotein binding protein 2 2
MIRT461185 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT464074 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT468738 SDC4 syndecan 4 2 2
MIRT470540 COASY Coenzyme A synthase 2 2
MIRT476458 GBA2 glucosylceramidase beta 2 2 2
MIRT479470 CDK6 cyclin dependent kinase 6 2 2
MIRT486351 TACC2 transforming acidic coiled-coil containing protein 2 2 8
MIRT495126 CXorf67 chromosome X open reading frame 67 2 2
MIRT495166 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495432 ATG7 autophagy related 7 2 2
MIRT495922 FBXO41 F-box protein 41 2 2
MIRT496572 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT498277 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT498431 DDX39A DExD-box helicase 39A 2 2
MIRT530149 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530313 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT530880 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT531177 ZNF626 zinc finger protein 626 2 2
MIRT533395 TYRP1 tyrosinase related protein 1 2 2
MIRT533709 TMEM64 transmembrane protein 64 2 2
MIRT533954 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT535616 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT539472 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT542878 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT559077 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT559465 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT561233 ZNF772 zinc finger protein 772 2 2
MIRT563477 POLE3 DNA polymerase epsilon 3, accessory subunit 2 2
MIRT563995 SLFN11 schlafen family member 11 2 2
MIRT564222 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT566017 RHOA ras homolog family member A 2 2
MIRT566028 RFX1 regulatory factor X1 2 2
MIRT566591 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT567874 CTDSP1 CTD small phosphatase 1 2 2
MIRT568552 AKT2 AKT serine/threonine kinase 2 2 2
MIRT569357 EFHC1 EF-hand domain containing 1 2 2
MIRT569973 DNAAF2 dynein axonemal assembly factor 2 2 2
MIRT614423 ZNF440 zinc finger protein 440 2 2
MIRT628831 SLC25A34 solute carrier family 25 member 34 2 2
MIRT630142 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT634479 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634498 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT637394 R3HDM2 R3H domain containing 2 2 2
MIRT641840 TCF7L2 transcription factor 7 like 2 2 2
MIRT644397 CDKL1 cyclin dependent kinase like 1 2 2
MIRT644888 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647124 ZNF446 zinc finger protein 446 2 2
MIRT647420 SSTR3 somatostatin receptor 3 2 2
MIRT650297 PYCARD PYD and CARD domain containing 2 2
MIRT655488 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT658185 FBXO9 F-box protein 9 2 2
MIRT660931 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT665317 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT670350 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT670823 NICN1 nicolin 1 2 2
MIRT671825 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT672732 NETO2 neuropilin and tolloid like 2 2 2
MIRT674841 GLRX2 glutaredoxin 2 2 2
MIRT675930 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT686786 AZF1 azoospermia factor 1 2 2
MIRT697723 USP8 ubiquitin specific peptidase 8 2 2
MIRT702357 KLHL26 kelch like family member 26 2 2
MIRT704361 DBR1 debranching RNA lariats 1 2 2
MIRT709242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT714433 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717000 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT720875 ADCY5 adenylate cyclase 5 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4753 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4753-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4753-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4753-5p Platinum 23939 resistant tissue
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission