pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PPIC   
Synonyms CYPC
Description peptidylprolyl isomerase C
Transcript NM_000943   
Expression
Putative miRNA Targets on PPIC
3'UTR of PPIC
(miRNA target sites are highlighted)
>PPIC|NM_000943|3'UTR
   1 CACAACTGGCAGAAAACAAGGATATGCTTTGGCAGGGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGTGTTGTCTTTC
  81 AATTATTTGCTTTTTTTTTTTTACTTTCTTTTTGTATTCTATCCCAGATCACAGGAAAGTTATAAAAATCAAACCGTCAC
 161 CCTTTAGTTTGCTTGAACTTTAGTAAACCACCTGCTTAGGGACTTTGAACTTAAATATATCCCCTTCCTCAAGTGGTGCT
 241 ATTTTAAAACTAAAAAAAACTTTGAATTGGCTATTTTTTTAATGCAATATTTTTTTTCTGAATTCATTATGATCCCCATA
 321 TTGGGTAATGCTGAACATTTATCTGAAACAGATGAGGATATTATTATTTTGTATCCAAACAGAAATTCAGATAAAGGGAA
 401 ATTTGACTAGTGTAATCTGAGATATGTCATAGGGATTTCTTTCTGACAAAAGGGTGCTTTGCTGTTCTTTATATTAAATA
 481 CTTTTAGATCAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agugguAAC-GAUUUCACGUUAa 5'
                ||| ||  ||||:||| 
Target 5' ggaaatTTGACT--AGTGTAATc 3'
397 - 417 136.00 -7.10
2
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            :|:||| :|  | |||||| 
Target 5' tgGCTATTTTTTTAATGCAATa 3'
268 - 289 132.00 -7.20
3
miRNA  3' aguGGUAACGAUUU---CACGUUAa 5'
             || || || ||   |||| || 
Target 5' atcCCCTTCCTCAAGTGGTGCTATt 3'
219 - 243 127.00 -6.45
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5068179 2 COSMIC
COSN30483451 21 COSMIC
COSN6510237 41 COSMIC
COSN20050036 66 COSMIC
COSN20050034 67 COSMIC
COSN30470072 80 COSMIC
COSN1306243 91 COSMIC
COSN24787946 108 COSMIC
COSN15665927 109 COSMIC
COSN30162499 119 COSMIC
COSN22088707 155 COSMIC
COSN26574747 156 COSMIC
COSN31548185 265 COSMIC
COSN31563790 273 COSMIC
COSN28767871 380 COSMIC
COSN16730628 428 COSMIC
COSN14791497 567 COSMIC
COSN29323315 603 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1407480023 6 dbSNP
rs1446109445 7 dbSNP
rs367741833 13 dbSNP
rs754818746 19 dbSNP
rs370559562 21 dbSNP
rs766018743 22 dbSNP
rs760961856 24 dbSNP
rs966611319 32 dbSNP
rs1022532778 34 dbSNP
rs750629331 36 dbSNP
rs146229593 37 dbSNP
rs776662400 37 dbSNP
rs397999141 38 dbSNP
rs889673529 38 dbSNP
rs534440216 39 dbSNP
rs750956100 39 dbSNP
rs1276792180 41 dbSNP
rs1402259967 44 dbSNP
rs566741336 44 dbSNP
rs757629304 44 dbSNP
rs1341630855 46 dbSNP
rs1476610386 46 dbSNP
rs371305785 48 dbSNP
rs1389183109 64 dbSNP
rs546924735 64 dbSNP
rs10552214 67 dbSNP
rs1165001978 68 dbSNP
rs1366095543 68 dbSNP
rs1404740701 68 dbSNP
rs1427190555 68 dbSNP
rs1431234627 68 dbSNP
rs1491249003 68 dbSNP
rs70988555 68 dbSNP
rs776432929 68 dbSNP
rs879117036 68 dbSNP
rs759094553 69 dbSNP
rs1328194378 71 dbSNP
rs1401011719 72 dbSNP
rs374923857 73 dbSNP
rs1388165287 78 dbSNP
rs1433233167 86 dbSNP
rs1217395423 103 dbSNP
rs528773387 103 dbSNP
rs879309374 103 dbSNP
rs1293309453 104 dbSNP
rs1052129559 108 dbSNP
rs375067091 112 dbSNP
rs1375782890 113 dbSNP
rs1313748779 127 dbSNP
rs984369909 133 dbSNP
rs1436758212 134 dbSNP
rs1184789583 135 dbSNP
rs952975270 143 dbSNP
rs1373856169 146 dbSNP
rs1472911038 148 dbSNP
rs370088217 155 dbSNP
rs41471149 156 dbSNP
rs1470852697 157 dbSNP
rs1338876227 158 dbSNP
rs1462534862 160 dbSNP
rs994767969 162 dbSNP
rs960255813 170 dbSNP
rs940769022 181 dbSNP
rs144971686 188 dbSNP
rs1049679405 194 dbSNP
rs751815540 201 dbSNP
rs567307852 202 dbSNP
rs764327393 207 dbSNP
rs1327466828 215 dbSNP
rs1225754707 220 dbSNP
rs45605533 221 dbSNP
rs1010767619 232 dbSNP
rs893751784 239 dbSNP
rs568220009 240 dbSNP
rs990495191 246 dbSNP
rs1252110486 250 dbSNP
rs939035257 255 dbSNP
rs935135822 259 dbSNP
rs1176608534 260 dbSNP
rs1189639407 260 dbSNP
rs1481256607 260 dbSNP
rs1378411095 261 dbSNP
rs927614009 273 dbSNP
rs1465770575 274 dbSNP
rs901018027 280 dbSNP
rs1277469134 281 dbSNP
rs977862191 283 dbSNP
rs966848797 287 dbSNP
rs1340832647 290 dbSNP
rs1307902023 296 dbSNP
rs1041158533 298 dbSNP
rs1349184091 298 dbSNP
rs942504488 298 dbSNP
rs910883156 307 dbSNP
rs569167704 309 dbSNP
rs745623572 310 dbSNP
rs1230658907 317 dbSNP
rs983818433 320 dbSNP
rs1342193106 322 dbSNP
rs45560934 327 dbSNP
rs989695576 333 dbSNP
rs918821021 336 dbSNP
rs953991548 353 dbSNP
rs1191533297 357 dbSNP
rs1355858600 358 dbSNP
rs1266453724 362 dbSNP
rs1431258020 369 dbSNP
rs1294965268 372 dbSNP
rs15577 380 dbSNP
rs1338966840 384 dbSNP
rs1333729034 390 dbSNP
rs1369235826 395 dbSNP
rs565854333 396 dbSNP
rs998049379 410 dbSNP
rs901890796 412 dbSNP
rs1035868498 415 dbSNP
rs1398682685 419 dbSNP
rs1297191658 426 dbSNP
rs1166670643 428 dbSNP
rs980589450 436 dbSNP
rs1294830317 442 dbSNP
rs1018883508 443 dbSNP
rs1465513194 447 dbSNP
rs1004994190 464 dbSNP
rs1419191378 464 dbSNP
rs1167632264 467 dbSNP
rs374302222 467 dbSNP
rs868222264 472 dbSNP
rs1206681800 478 dbSNP
rs45561935 485 dbSNP
rs1236582437 497 dbSNP
rs1450391259 499 dbSNP
rs1011555424 502 dbSNP
rs1425668673 506 dbSNP
rs891814866 512 dbSNP
rs1349825650 518 dbSNP
rs1049245498 522 dbSNP
rs1456708811 525 dbSNP
rs532211426 534 dbSNP
rs1247720959 537 dbSNP
rs999457043 539 dbSNP
rs1318161782 549 dbSNP
rs900963151 553 dbSNP
rs1311840638 556 dbSNP
rs1319928240 557 dbSNP
rs776092278 559 dbSNP
rs76739889 560 dbSNP
rs528160347 562 dbSNP
rs35413555 567 dbSNP
rs1055425984 568 dbSNP
rs1208302915 573 dbSNP
rs1246448830 581 dbSNP
rs770898737 582 dbSNP
rs1355322876 587 dbSNP
rs746832553 595 dbSNP
rs1283860194 600 dbSNP
rs927645304 603 dbSNP
rs1042046703 604 dbSNP
rs1443122648 617 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-3
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796039. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796039
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-3 / 4-Thiouridine
Location of target site ENST00000306442.4 | 3UTR | UUGGCUAUUUUUUUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.613 7.2e-4 0.722 3.4e-5 24 Click to see details
GSE32688 Pancreatic cancer 0.312 4.1e-2 0.366 2.0e-2 32 Click to see details
GSE27834 Pluripotent stem cells 0.378 7.4e-2 0.500 2.4e-2 16 Click to see details
GSE28260 Renal cortex and medulla 0.394 9.1e-2 0.446 6.3e-2 13 Click to see details
GSE17306 Multiple myeloma 0.185 1.0e-1 0.504 1.1e-4 49 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.575 1.6e-1 -0.600 1.4e-1 5 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.177 2.3e-1 -0.411 3.6e-2 20 Click to see details
GSE19350 CNS germ cell tumors -0.221 2.5e-1 0.014 4.8e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.112 3.0e-1 -0.032 4.4e-1 24 Click to see details
GSE38226 Liver fibrosis 0.112 3.1e-1 0.029 4.5e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.102 3.2e-1 0.061 3.9e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.035 3.7e-1 0.073 2.5e-1 90 Click to see details
GSE21687 Ependynoma primary tumors 0.037 3.9e-1 0.120 1.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.054 4.0e-1 0.110 3.0e-1 25 Click to see details
GSE17498 Multiple myeloma -0.029 4.3e-1 0.117 2.4e-1 40 Click to see details
GSE17498 Multiple myeloma -0.029 4.3e-1 0.117 2.4e-1 40 Click to see details
GSE17498 Multiple myeloma -0.029 4.3e-1 0.117 2.4e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission