miRTarBase - #MIRT443908


—
pre-miRNA Information
pre-miRNA hsa-mir-4695   
Genomic Coordinates chr1: 18883202 - 18883275
Description Homo sapiens miR-4695 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4695-3p
Sequence 51| UGAUCUCACCGCUGCCUCCUUC |72
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1264904031 5 dbSNP
rs373926482 10 dbSNP
rs778369521 11 dbSNP
rs1445913612 13 dbSNP
rs1259104824 14 dbSNP
rs200517905 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF256   
Synonyms BMZF-3, BMZF3
Description zinc finger protein 256
Transcript NM_005773   
Expression
Putative miRNA Targets on ZNF256
3'UTR of ZNF256
(miRNA target sites are highlighted)		 
>ZNF256|NM_005773|3'UTR
   1 AGGTTAGGTAACACACATAGGGCTGTTACGGACTGAGAAGTGTCCCTGCAAAATTCACAGACATAAATAAATAAATACGT
  81 ATTTTCAATAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuccUCCGUC---GCC--ACUCUagu 5'
               :||| |   |||  |||||   
Target 5' acataGGGCTGTTACGGACTGAGAagt 3'
 15 - 41 111.00 -12.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30501054 29 COSMIC
COSN30141869 37 COSMIC
COSN31495923 42 COSMIC
COSN30131730 61 COSMIC
COSN28884558 65 COSMIC
COSN19725833 69 COSMIC
COSN31570068 74 COSMIC
COSN19668590 79 COSMIC
COSN512243 80 COSMIC
COSN30146677 81 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758553431 3 dbSNP
rs1259146427 6 dbSNP
rs774470961 6 dbSNP
rs1296675092 9 dbSNP
rs1359583859 13 dbSNP
rs908785272 18 dbSNP
rs768616317 20 dbSNP
rs1279769426 23 dbSNP
rs775086838 24 dbSNP
rs199992557 29 dbSNP
rs765853090 30 dbSNP
rs1198811645 31 dbSNP
rs760214916 33 dbSNP
rs1168151428 40 dbSNP
rs1361648315 45 dbSNP
rs545667212 46 dbSNP
rs759299847 49 dbSNP
rs915499521 51 dbSNP
rs1206177587 55 dbSNP
rs988384452 60 dbSNP
rs1401705207 70 dbSNP
rs1391118901 73 dbSNP
rs1333039728 78 dbSNP
rs375694595 78 dbSNP
rs377183612 78 dbSNP
rs55778111 78 dbSNP
rs1282699523 79 dbSNP
rs1356469623 80 dbSNP
rs144810556 88 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000598928.1 | 3UTR | ucaagauuucuucag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000598928.1 | 3UTR | ucaagauuucuucag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
133 hsa-miR-4695-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT271431 ETNK1 ethanolamine kinase 1 2 2
MIRT287899 ZNF652 zinc finger protein 652 2 2
MIRT405482 ARID1A AT-rich interaction domain 1A 2 2
MIRT441675 CXXC4 CXXC finger protein 4 2 2
MIRT442163 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442924 TFDP2 transcription factor Dp-2 2 2
MIRT443908 ZNF256 zinc finger protein 256 2 2
MIRT444792 TMEM251 transmembrane protein 251 2 2
MIRT447161 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT452992 CABP4 calcium binding protein 4 2 4
MIRT454347 CDKL1 cyclin dependent kinase like 1 2 2
MIRT461937 TNFSF14 TNF superfamily member 14 2 2
MIRT462299 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463127 ZNF451 zinc finger protein 451 2 2
MIRT469460 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470528 PPIF peptidylprolyl isomerase F 2 2
MIRT473758 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482910 ZNF845 zinc finger protein 845 2 2
MIRT497070 GTF2H5 general transcription factor IIH subunit 5 2 4
MIRT497169 EPGN epithelial mitogen 2 2
MIRT497196 DRP2 dystrophin related protein 2 2 2
MIRT514518 SHISA9 shisa family member 9 2 2
MIRT516415 COPA coatomer protein complex subunit alpha 2 2
MIRT525259 TLK2 tousled like kinase 2 2 2
MIRT525804 SOD2 superoxide dismutase 2 2 2
MIRT533723 TMEM246 transmembrane protein 246 2 2
MIRT540226 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT566417 PIM3 Pim-3 proto-oncogene, serine/threonine kinase 2 2
MIRT572422 PTGES3L prostaglandin E synthase 3 like 2 2
MIRT575206 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575327 Fbxo6 F-box protein 6 2 2
MIRT575383 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT607069 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607660 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607845 PHLDA3 pleckstrin homology like domain family A member 3 2 4
MIRT607935 ANG angiogenin 2 3
MIRT608144 SYAP1 synapse associated protein 1 2 4
MIRT612151 SIX1 SIX homeobox 1 2 4
MIRT615709 MYO16 myosin XVI 2 2
MIRT617556 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618062 ZNF799 zinc finger protein 799 2 2
MIRT618515 SELPLG selectin P ligand 2 2
MIRT618906 CDK9 cyclin dependent kinase 9 2 2
MIRT621160 RTTN rotatin 2 2
MIRT624169 DGKE diacylglycerol kinase epsilon 2 2
MIRT624953 SERF2 small EDRK-rich factor 2 2 2
MIRT625465 ZNF135 zinc finger protein 135 2 2
MIRT627786 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT629274 CD84 CD84 molecule 2 2
MIRT629311 ZNF566 zinc finger protein 566 2 2
MIRT629569 FAM180B family with sequence similarity 180 member B 2 4
MIRT629667 USP1 ubiquitin specific peptidase 1 2 2
MIRT630486 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT631017 DNAJC22 DnaJ heat shock protein family (Hsp40) member C22 2 2
MIRT631192 TSPAN14 tetraspanin 14 2 2
MIRT631970 YIPF5 Yip1 domain family member 5 2 2
MIRT632246 VPS41 VPS41, HOPS complex subunit 2 2
MIRT632890 GINM1 glycoprotein integral membrane 1 2 2
MIRT634499 NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 2 2
MIRT635431 LRP10 LDL receptor related protein 10 2 2
MIRT636017 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT636343 PHAX phosphorylated adaptor for RNA export 2 2
MIRT636657 CDK4 cyclin dependent kinase 4 2 2
MIRT637378 HINFP histone H4 transcription factor 2 2
MIRT637727 EXO5 exonuclease 5 2 2
MIRT638580 HYPK huntingtin interacting protein K 2 2
MIRT638611 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT640797 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT641965 PWWP2A PWWP domain containing 2A 2 2
MIRT642621 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT643125 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT643352 TRIM10 tripartite motif containing 10 2 2
MIRT643838 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT645613 TSPAN6 tetraspanin 6 2 2
MIRT647206 NPTXR neuronal pentraxin receptor 2 2
MIRT649302 IGSF6 immunoglobulin superfamily member 6 2 2
MIRT650008 KLB klotho beta 2 2
MIRT650166 USHBP1 USH1 protein network component harmonin binding protein 1 2 2
MIRT650441 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT651906 UEVLD UEV and lactate/malate dehyrogenase domains 2 4
MIRT652158 TRIM66 tripartite motif containing 66 2 2
MIRT654719 PRR11 proline rich 11 2 2
MIRT654846 PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K 2 2
MIRT656063 MTMR10 myotubularin related protein 10 2 2
MIRT657240 IDE insulin degrading enzyme 2 2
MIRT657261 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT659504 CIAO1 cytosolic iron-sulfur assembly component 1 2 2
MIRT660210 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT661075 FFAR2 free fatty acid receptor 2 2 2
MIRT662239 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662336 MYLK3 myosin light chain kinase 3 2 2
MIRT662449 SEMA5A semaphorin 5A 2 2
MIRT662740 LRRC3C leucine rich repeat containing 3C 2 2
MIRT663459 FADS1 fatty acid desaturase 1 2 2
MIRT664177 MYOZ2 myozenin 2 2 2
MIRT664906 PDE6A phosphodiesterase 6A 2 2
MIRT664924 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT665528 USP14 ubiquitin specific peptidase 14 2 2
MIRT665534 UROS uroporphyrinogen III synthase 2 2
MIRT666081 SSTR2 somatostatin receptor 2 2 2
MIRT666458 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT668253 FUT11 fucosyltransferase 11 2 2
MIRT668722 DIP2A disco interacting protein 2 homolog A 2 2
MIRT669551 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT670021 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT671098 ZNF665 zinc finger protein 665 2 2
MIRT671479 FLYWCH2 FLYWCH family member 2 2 2
MIRT671495 SLC38A9 solute carrier family 38 member 9 2 2
MIRT672908 KRBA2 KRAB-A domain containing 2 2 2
MIRT675102 SNTB2 syntrophin beta 2 2 2
MIRT676194 GSTM3 glutathione S-transferase mu 3 2 2
MIRT677349 POC1A POC1 centriolar protein A 2 2
MIRT677551 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677665 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT677689 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT678246 FITM2 fat storage inducing transmembrane protein 2 2 2
MIRT678300 GPR155 G protein-coupled receptor 155 2 2
MIRT684176 MOG myelin oligodendrocyte glycoprotein 2 2
MIRT688037 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT689034 ANGPTL3 angiopoietin like 3 2 2
MIRT689618 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691210 KLHL30 kelch like family member 30 2 2
MIRT692300 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT703556 FKBP14 FK506 binding protein 14 2 2
MIRT709136 GLG1 golgi glycoprotein 1 2 2
MIRT709392 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT711949 SLC7A14 solute carrier family 7 member 14 2 2
MIRT712590 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT714007 IL6R interleukin 6 receptor 2 2
MIRT714592 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT716716 SCN7A sodium voltage-gated channel alpha subunit 7 2 2
MIRT718816 PYGO1 pygopus family PHD finger 1 2 2
MIRT719980 MAPK1 mitogen-activated protein kinase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4695 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4695 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4695 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4695 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-miR-4695-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4695-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-4695-3p Cisplatin + Decitabine resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4695-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4695-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4695-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4695-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4695-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4695-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4695-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4695-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)

Error report submission