miRTarBase - #MIRT444057


—
pre-miRNA Information
pre-miRNA hsa-mir-203b   
Genomic Coordinates chr14: 104117418 - 104117503
Description Homo sapiens miR-203b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-203b-3p
Sequence 54| UUGAACUGUUAAGAACCACUGGA |76
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 11 14 - 104117440 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1444131167 3 dbSNP
rs1307766631 8 dbSNP
rs527418519 12 dbSNP
rs771545143 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SERPINA4   
Synonyms KAL, KLST, KST, PI-4, PI4, kallistatin
Description serpin family A member 4
Transcript NM_006215   
Expression
Putative miRNA Targets on SERPINA4
3'UTR of SERPINA4
(miRNA target sites are highlighted)		 
>SERPINA4|NM_006215|3'UTR
   1 CCCTCCCAGGGCTGCTCATCTGTTCCAAGCAGGAGGATGTGGCAGGGGAGGGCTGGGAGTGAGTAGCTCTGTGTTTAGAG
  81 TTGGGGACAAGGATGACACCGAAGGTCCAGGAGTCCAGGACAGCAGGTGCTGGCCGGTGGGGAGCGGGGAGGGGCACTGA
 161 GATGGGCAGGGCCTGGACATTCCACACCCTGGTGCTGTGCAGCCTCTGGCAGAGCATCCGACCTCTTGGAGCAAGTTTCT
 241 GCCTCTGGAAAGGGGGCGGGCCCTTTTCACAACAGGCTGGTTGTACCGAGTAAACAACACGATGCCATGAAGACCCTGAA
 321 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGUCACCAAGAAUUGUCAAGuu 5'
            ||| | | || | | ||||  
Target 5' ccCAGGGCTGCTCATCTGTTCca 3'
 5 - 27 113.00 -11.10
2 
miRNA  3' agGUCACCAAGAAUUGUCAAGUu 5'
            ||| ||  || :||| | || 
Target 5' ggCAG-GG-CCTGGACATTCCAc 3'
 165 - 185 95.00 -7.40
3 
miRNA  3' aggUCACCAAG----AAUUGUCAAguu 5'
             ||| | ||    || | ||||   
Target 5' gtgAGTAGCTCTGTGTTTAGAGTTggg 3'
 59 - 85 90.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM371745 1 COSMIC
COSN30475360 3 COSMIC
COSN30699302 12 COSMIC
COSN30486380 26 COSMIC
COSN30462312 49 COSMIC
COSN7034314 61 COSMIC
COSN30484559 93 COSMIC
COSN31495838 102 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1360919540 2 dbSNP
rs781524176 3 dbSNP
rs746133292 4 dbSNP
rs942067626 5 dbSNP
rs1400358747 6 dbSNP
rs1341780172 8 dbSNP
rs1448064907 9 dbSNP
rs1285305702 10 dbSNP
rs1030617111 11 dbSNP
rs867135735 17 dbSNP
rs1353702502 18 dbSNP
rs775493002 19 dbSNP
rs749389570 20 dbSNP
rs1471988440 26 dbSNP
rs374911683 34 dbSNP
rs773155594 37 dbSNP
rs760422576 38 dbSNP
rs1444215259 41 dbSNP
rs1188257065 43 dbSNP
rs766197956 45 dbSNP
rs1437817082 47 dbSNP
rs1160360117 49 dbSNP
rs776241000 50 dbSNP
rs1214383016 60 dbSNP
rs900618890 61 dbSNP
rs989173356 73 dbSNP
rs1226420646 77 dbSNP
rs1405854414 77 dbSNP
rs1450852902 79 dbSNP
rs997510758 80 dbSNP
rs963845917 81 dbSNP
rs1454570214 82 dbSNP
rs975276462 84 dbSNP
rs1052240292 86 dbSNP
rs538577397 95 dbSNP
rs181625563 101 dbSNP
rs574939554 102 dbSNP
rs1347188718 104 dbSNP
rs1224386152 105 dbSNP
rs542383947 112 dbSNP
rs957220788 114 dbSNP
rs1262692793 127 dbSNP
rs907855665 128 dbSNP
rs940699658 136 dbSNP
rs13306797 137 dbSNP
rs899224107 138 dbSNP
rs535534539 141 dbSNP
rs549284172 145 dbSNP
rs1022661806 146 dbSNP
rs1200221821 147 dbSNP
rs1490081165 160 dbSNP
rs1292248052 163 dbSNP
rs1045269841 173 dbSNP
rs1250962866 174 dbSNP
rs1340013228 186 dbSNP
rs1294714329 188 dbSNP
rs539929747 199 dbSNP
rs1215069928 208 dbSNP
rs151132569 210 dbSNP
rs1403395614 211 dbSNP
rs1003413315 213 dbSNP
rs1304133216 214 dbSNP
rs1030901940 216 dbSNP
rs892395392 220 dbSNP
rs1010504142 221 dbSNP
rs140109334 224 dbSNP
rs544109774 231 dbSNP
rs749214614 235 dbSNP
rs1188892048 254 dbSNP
rs1035771065 258 dbSNP
rs113728617 259 dbSNP
rs529863792 262 dbSNP
rs909486104 270 dbSNP
rs1250523358 273 dbSNP
rs548398107 277 dbSNP
rs572076201 288 dbSNP
rs149951409 289 dbSNP
rs922010610 299 dbSNP
rs527831221 301 dbSNP
rs1221688683 302 dbSNP
rs908096805 310 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggucacCAAGAAUUGUCAAGUu 5'
                 ||||| |||| | || 
Target 5' ---ucaaGUUCUCAACACUACAg 3'
 		1 - 20
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000555095.1 | 3UTR | UCAAGUUCUCAACACUACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000555095.1 | 3UTR | UCAAGUUCUCAACACUACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
154 hsa-miR-203b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063500 SKI SKI proto-oncogene 2 4
MIRT149737 LDLR low density lipoprotein receptor 2 6
MIRT206557 SOCS5 suppressor of cytokine signaling 5 2 8
MIRT248820 SESN2 sestrin 2 2 2
MIRT261314 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT443290 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT443893 NUDT3 nudix hydrolase 3 2 4
MIRT444057 SERPINA4 serpin family A member 4 2 2
MIRT444345 KIAA1211 KIAA1211 2 2
MIRT444538 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT444594 TGFA transforming growth factor alpha 2 2
MIRT445601 SEC14L3 SEC14 like lipid binding 3 2 2
MIRT446025 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT446309 TBC1D8B TBC1 domain family member 8B 2 2
MIRT446492 TMEM215 transmembrane protein 215 2 4
MIRT446728 SLC36A4 solute carrier family 36 member 4 2 2
MIRT447468 CISD2 CDGSH iron sulfur domain 2 2 2
MIRT447504 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT447597 MRPL3 mitochondrial ribosomal protein L3 2 2
MIRT447636 AGPS alkylglycerone phosphate synthase 2 2
MIRT447846 ZRANB2 zinc finger RANBP2-type containing 2 2 2
MIRT448098 TCN2 transcobalamin 2 2 2
MIRT448111 SEMA4G semaphorin 4G 2 2
MIRT448903 CLCN6 chloride voltage-gated channel 6 2 4
MIRT449396 TOX4 TOX high mobility group box family member 4 2 2
MIRT449484 CACNA2D4 calcium voltage-gated channel auxiliary subunit alpha2delta 4 2 2
MIRT450705 RNF152 ring finger protein 152 2 2
MIRT450781 PAPOLG poly(A) polymerase gamma 2 2
MIRT452856 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT453048 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT459389 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT461156 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461613 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT463711 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT464107 VPS35 VPS35, retromer complex component 2 2
MIRT466438 TFAM transcription factor A, mitochondrial 2 2
MIRT467735 SLC36A1 solute carrier family 36 member 1 2 2
MIRT469512 RBFOX2 RNA binding protein, fox-1 homolog 2 2 6
MIRT470026 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT473411 MDM4 MDM4, p53 regulator 2 2
MIRT480545 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT488444 ACBD3 acyl-CoA binding domain containing 3 2 2
MIRT489498 CRLF3 cytokine receptor like factor 3 2 4
MIRT496149 RPS15A ribosomal protein S15a 2 2
MIRT497013 PRDM2 PR/SET domain 2 2 2
MIRT497087 PHF12 PHD finger protein 12 2 2
MIRT508695 MTRNR2L4 MT-RNR2-like 4 2 4
MIRT517468 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT525329 CNGB1 cyclic nucleotide gated channel beta 1 2 2
MIRT527842 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT529111 AQPEP laeverin 1 1
MIRT530163 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT532249 TBPL2 TATA-box binding protein like 2 2 2
MIRT532828 ZNF704 zinc finger protein 704 2 2
MIRT533140 WNT10A Wnt family member 10A 2 2
MIRT536481 KIAA1468 KIAA1468 2 2
MIRT536802 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT537301 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT542650 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT545691 NUTF2 nuclear transport factor 2 2 2
MIRT546960 PRR14L proline rich 14 like 2 2
MIRT560566 ZNF460 zinc finger protein 460 2 2
MIRT561792 PAWR pro-apoptotic WT1 regulator 2 2
MIRT562372 ERI2 ERI1 exoribonuclease family member 2 2 2
MIRT569292 SURF6 surfeit 6 2 2
MIRT574090 VASN vasorin 2 2
MIRT619787 HLCS holocarboxylase synthetase 2 2
MIRT620104 HARBI1 harbinger transposase derived 1 2 2
MIRT626003 ZNF517 zinc finger protein 517 2 2
MIRT626375 BBS1 Bardet-Biedl syndrome 1 2 2
MIRT626615 SLC30A6 solute carrier family 30 member 6 2 2
MIRT628381 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT629299 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT630439 IDE insulin degrading enzyme 2 2
MIRT631848 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT633171 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT633472 ZNF724P zinc finger protein 724 2 2
MIRT634389 PLSCR1 phospholipid scramblase 1 2 2
MIRT635536 TRIM72 tripartite motif containing 72 2 2
MIRT635818 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT636165 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636792 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT637946 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT640317 STAT1 signal transducer and activator of transcription 1 2 2
MIRT645131 HES2 hes family bHLH transcription factor 2 2 2
MIRT645658 ADK adenosine kinase 2 2
MIRT646143 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT646999 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT648183 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT650085 TERF2 telomeric repeat binding factor 2 2 2
MIRT650326 RTN2 reticulon 2 2 2
MIRT651562 WHSC1L1 nuclear receptor binding SET domain protein 3 2 2
MIRT659367 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT659830 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT662103 LACTB lactamase beta 2 4
MIRT664837 HUS1 HUS1 checkpoint clamp component 2 2
MIRT669750 ZNF101 zinc finger protein 101 2 4
MIRT669791 GAN gigaxonin 2 2
MIRT670044 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670293 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670382 EMP2 epithelial membrane protein 2 2 2
MIRT670950 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 4
MIRT672854 C22orf29 retrotransposon Gag like 10 2 2
MIRT672885 FXN frataxin 2 2
MIRT673994 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674155 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT674495 TIRAP TIR domain containing adaptor protein 2 2
MIRT675461 NUBPL nucleotide binding protein like 2 2
MIRT675669 TMOD2 tropomodulin 2 2 2
MIRT675994 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT676069 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676378 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676759 SNX2 sorting nexin 2 2 2
MIRT676893 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT676973 ZNF708 zinc finger protein 708 2 2
MIRT677229 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677363 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677456 PDLIM3 PDZ and LIM domain 3 2 2
MIRT678073 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678091 ATCAY ATCAY, caytaxin 2 2
MIRT678316 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678411 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678519 ZNF347 zinc finger protein 347 2 2
MIRT678695 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT678821 PDE6A phosphodiesterase 6A 2 2
MIRT679984 RUNDC1 RUN domain containing 1 2 2
MIRT680608 KIAA0391 KIAA0391 2 2
MIRT680724 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT681238 ZNF383 zinc finger protein 383 2 2
MIRT681932 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682003 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT682500 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 2
MIRT685460 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT688193 FNIP1 folliculin interacting protein 1 2 2
MIRT689666 RBM23 RNA binding motif protein 23 2 2
MIRT691058 CRCP CGRP receptor component 2 2
MIRT691442 CXorf36 chromosome X open reading frame 36 2 2
MIRT695998 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT696395 CORO7 coronin 7 2 2
MIRT702334 KLHL7 kelch like family member 7 2 2
MIRT702555 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT703362 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT703551 FKBP14 FK506 binding protein 14 2 2
MIRT705029 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT706335 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT708907 TM4SF19 transmembrane 4 L six family member 19 2 2
MIRT711625 CORO1C coronin 1C 2 2
MIRT714444 TOPAZ1 testis and ovary specific PAZ domain containing 1 2 2
MIRT716324 POU5F1 POU class 5 homeobox 1 2 2
MIRT718568 SLC25A22 solute carrier family 25 member 22 2 2
MIRT720299 DDHD1 DDHD domain containing 1 2 2
MIRT721449 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT723529 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 2
MIRT724492 BFAR bifunctional apoptosis regulator 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-203b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-203b 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-203b-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-203b-3p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-203b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-203b-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-203b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-203b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-203b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-203b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-203b-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-203b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission