miRTarBase - #MIRT444097


—
pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SEPHS1   
Synonyms SELD, SPS, SPS1
Description selenophosphate synthetase 1
Transcript NM_012247   
Expression
Putative miRNA Targets on SEPHS1
3'UTR of SEPHS1
(miRNA target sites are highlighted)		 
>SEPHS1|NM_012247|3'UTR
   1 TCTAGACAGAAATAGCTGTTTGGTTTTGTTTTTAAATAGATCTATTTCCCTTATCACTTCAATTAAAGACTATAAACAAC
  81 AAAAATCTCATTGTGTCTACACATCGGGGTGACCTTAGGTCGGTTTGTAAGTGGATACAATTAATAAAATAAAATCCATT
 161 GCCTTTTTTTCCTGTTACATTAACTGAAGATGCACCTAATCTTGAGGCAGCTTCTGAGTTGAGAATTATATTGTTATCCA
 241 ATACTGTTGATTCATTTTGAATCTTTAGACACTTATCTCTTGCCGCATAGGCTTTTTAAAGGTGCTTTCACATAGCACAG
 321 GCATTACCCGTAGTCGTGTCAAATAGCAGTTGGTGTCTTCATTTTATGTATATTTATCATATAAGTCTGATTTTTTTTTT
 401 TAAGCGTCTTGAATGGTTTTCTGGAGAGACAGCATTGGTAAGTGGCACATGACGGTATCCCAGTCATAAGAGGGTTGCAT
 481 GATTCCTTTGAGTGTTTGATTTGAAAAGCCTAGTCTTGTCTCTCAAGAGCATCTCGGACCCAGAACATTCTCCAGTAGTG
 561 CATTCAGTTCAACACAGCAAGTGCTTCATTGCATGGAAAACACTTTGAAGACAAAAAAGAAATCTTATTTCTTTTTTTGT
 641 AGCCTTCCTGATATTTACAGTAATACCATTAACTGTTTTATCGATAGCAAAAAAGGATACTTTTTGCAATGTTATTAGAT
 721 GTTCTATAGTGCTACAAGGAATTGCCTTCCGAATGGAGGTTCATGTATAATACTCATTTACAATTCAATATATAATTACA
 801 CAAATAATTTTTAAATATAATCAATAGTAAAGACTGTTCTGTGGATGGTAGTGTTTAATACATTTTCTATTTTGTACAGT
 881 GATTTCAGGCCTTTTGTTTTCTTAAAATCAGCAGCTGTTTGGCCTAATTCTTAGCATTATTTTGTCCTTTGCGCCAGTAC
 961 TTTTTTGTGCACGCTTTTTGTGATCTGTGTTAAAAACCTGCATTGCCAACATTGCAGCTCGAACTTAAACTTGTTATTCA
1041 AATAAATATTTAATTTTTTAAATTGCTCTTGTATAATCAGATGCCCCTTTTAGTATTATTTTAGAAGCGTTGGGAGGGTT
1121 TTGCCTAAAGTACAATTTATCGGGAAAAACTAGATTTTAGTTTTATAAAACTTTTAAGTCTTTCATGGGACCTATATTTT
1201 CTTGAATTAAATTTTGTAGTTCTAGAATAAATAGGCAATCTAAAAAGGTGTTCTCTGTGTTATGTAAAGTGGAGGCTTCC
1281 TTATATTTTAACCTACTAAGCAATGAGGAGGGATTCCTGTCATTAAGCACAAGGGCGCTGGATCCTCAAGTGCCCATCTT
1361 CGTGAGAGAAAAAGCAGCACATCCTGCCCATTTCTGGTGCTTTCTGCTCACAGGCACCAAAGCTGCACATGTAAACTGAC
1441 TTCTTGCCAAAGGAAATGACCCCTGGGAAGTTCAAGCTCCTGGAAGAGGCTTTAACTCGGACGCGCCCTCCTCCAGGAAC
1521 CAGTGGGCAGGGCAGCCTTCATGCATGTGTAACTGGACCTCCAGCCATAAGCATGGTGTGCAGTATGGAAGAGCCTGCTA
1601 CGGAACTGAAAGTGATTGGACATTTTATAGGAATTGATAGAGATGTTGGTCCTCAAAAGCTACAAACCAGTGGTCTGCAA
1681 AATAAAGTGTGTTGGAAACCTCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agggccCUUGAG--UAGUCAGAGg 5'
                |:|| |  | || |||| 
Target 5' catctcGGACCCAGAACATTCTCc 3'
 530 - 553 118.00 -16.90
2 
miRNA  3' agggcccUUGAGUAGUCAGAGg 5'
                 ||||: | |||||: 
Target 5' tttataaAACTTTTAAGTCTTt 3'
 1162 - 1183 115.00 -9.30
3 
miRNA  3' agGGCC---CUUGAGU--AGUCAGAgg 5'
            :|||   || ||:|  ||:||:|  
Target 5' caTCGGGGTGACCTTAGGTCGGTTTgt 3'
 102 - 128 110.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31559042 46 COSMIC
COSN30489116 50 COSMIC
COSN30148603 68 COSMIC
COSN31603965 128 COSMIC
COSN31544125 244 COSMIC
COSN30172187 263 COSMIC
COSN31522302 342 COSMIC
COSN1478030 381 COSMIC
COSN31530446 400 COSMIC
COSN15663086 435 COSMIC
COSN23596306 564 COSMIC
COSN31529910 624 COSMIC
COSN22357284 658 COSMIC
COSN31582427 676 COSMIC
COSN31513658 713 COSMIC
COSN15661835 775 COSMIC
COSN22852689 802 COSMIC
COSN31570886 806 COSMIC
COSN31548836 807 COSMIC
COSN31545567 867 COSMIC
COSN27058165 983 COSMIC
COSN10062833 1024 COSMIC
COSN32126952 1305 COSMIC
COSN514580 1361 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455370416 1 dbSNP
rs1199353446 2 dbSNP
rs748405882 4 dbSNP
rs535134415 5 dbSNP
rs750095396 7 dbSNP
rs750062262 9 dbSNP
rs780871408 12 dbSNP
rs1388828512 15 dbSNP
rs1198182830 16 dbSNP
rs1343533954 18 dbSNP
rs767239464 23 dbSNP
rs1255892696 25 dbSNP
rs756686391 28 dbSNP
rs200190731 31 dbSNP
rs751108141 34 dbSNP
rs1004522092 37 dbSNP
rs763886552 39 dbSNP
rs1353111166 42 dbSNP
rs185568518 44 dbSNP
rs994955615 62 dbSNP
rs1157135655 71 dbSNP
rs539777748 72 dbSNP
rs1284901577 73 dbSNP
rs760824989 75 dbSNP
rs900370529 89 dbSNP
rs1226861395 90 dbSNP
rs1270268727 103 dbSNP
rs1465476675 105 dbSNP
rs1200275473 106 dbSNP
rs1254477540 108 dbSNP
rs1039269804 118 dbSNP
rs1188839953 119 dbSNP
rs1418565619 121 dbSNP
rs1268226453 122 dbSNP
rs1160661224 123 dbSNP
rs944633522 124 dbSNP
rs1170636701 129 dbSNP
rs911794959 129 dbSNP
rs1404053737 135 dbSNP
rs1396591954 149 dbSNP
rs1053003281 156 dbSNP
rs571102213 158 dbSNP
rs1268837786 163 dbSNP
rs562577130 170 dbSNP
rs776045640 174 dbSNP
rs1317792297 177 dbSNP
rs1232779798 178 dbSNP
rs1356347817 184 dbSNP
rs1347578608 188 dbSNP
rs1201325278 194 dbSNP
rs1251743882 207 dbSNP
rs934664304 210 dbSNP
rs1287699014 216 dbSNP
rs1237591436 225 dbSNP
rs1251868878 229 dbSNP
rs1432282916 239 dbSNP
rs1196286690 240 dbSNP
rs1315969500 241 dbSNP
rs1379216631 246 dbSNP
rs1466362919 265 dbSNP
rs1301292098 266 dbSNP
rs1167679353 271 dbSNP
rs925914433 275 dbSNP
rs1431520219 283 dbSNP
rs1309994314 284 dbSNP
rs978872280 285 dbSNP
rs1386491033 297 dbSNP
rs1388036370 302 dbSNP
rs765664031 303 dbSNP
rs28670344 310 dbSNP
rs1332995018 311 dbSNP
rs916115946 317 dbSNP
rs992944633 318 dbSNP
rs1340714983 319 dbSNP
rs1302519725 330 dbSNP
rs551267037 332 dbSNP
rs760155232 335 dbSNP
rs779086130 339 dbSNP
rs1296579755 340 dbSNP
rs1453244501 344 dbSNP
rs1433372201 349 dbSNP
rs1187746545 353 dbSNP
rs530942468 360 dbSNP
rs1451316856 364 dbSNP
rs1178275565 366 dbSNP
rs1169138190 368 dbSNP
rs1004387346 381 dbSNP
rs1457482616 382 dbSNP
rs1431551551 385 dbSNP
rs1291808872 387 dbSNP
rs1393183637 391 dbSNP
rs1441875418 391 dbSNP
rs201121729 402 dbSNP
rs559372629 402 dbSNP
rs950416502 402 dbSNP
rs562021285 405 dbSNP
rs548703805 406 dbSNP
rs1218784323 416 dbSNP
rs900235259 421 dbSNP
rs1468684973 430 dbSNP
rs1207702118 436 dbSNP
rs1246037641 438 dbSNP
rs1466092288 440 dbSNP
rs555001434 440 dbSNP
rs1038889841 446 dbSNP
rs1195100846 449 dbSNP
rs1421943641 453 dbSNP
rs528576853 454 dbSNP
rs1489471314 458 dbSNP
rs1462218654 463 dbSNP
rs1261392824 470 dbSNP
rs1204928194 472 dbSNP
rs1386639672 476 dbSNP
rs1008755378 479 dbSNP
rs890267042 499 dbSNP
rs560124686 505 dbSNP
rs1379136464 510 dbSNP
rs1227086483 517 dbSNP
rs1314329284 529 dbSNP
rs1256263662 535 dbSNP
rs1053034994 536 dbSNP
rs1465938885 540 dbSNP
rs1216271799 544 dbSNP
rs1236647339 552 dbSNP
rs1482261973 555 dbSNP
rs540401453 557 dbSNP
rs1234749544 560 dbSNP
rs1183508105 578 dbSNP
rs28451457 589 dbSNP
rs577736665 595 dbSNP
rs564057561 599 dbSNP
rs747143800 603 dbSNP
rs1342300496 610 dbSNP
rs1458991169 616 dbSNP
rs1160353510 617 dbSNP
rs1276013269 619 dbSNP
rs1043443701 622 dbSNP
rs1381469997 628 dbSNP
rs1356601967 639 dbSNP
rs1403143020 644 dbSNP
rs1304860194 649 dbSNP
rs1464594652 650 dbSNP
rs1405521207 653 dbSNP
rs1171477908 654 dbSNP
rs1277722359 660 dbSNP
rs1310209943 665 dbSNP
rs1479054441 669 dbSNP
rs1211894968 673 dbSNP
rs1280972420 673 dbSNP
rs1422139587 673 dbSNP
rs1192875865 674 dbSNP
rs1424803539 675 dbSNP
rs1482659285 677 dbSNP
rs1256400771 679 dbSNP
rs542818798 682 dbSNP
rs181441782 683 dbSNP
rs1471314115 686 dbSNP
rs1177994227 688 dbSNP
rs1261896632 690 dbSNP
rs1198744557 693 dbSNP
rs1424648958 694 dbSNP
rs780095930 696 dbSNP
rs1319859884 697 dbSNP
rs1175870841 699 dbSNP
rs574899156 704 dbSNP
rs1429638044 706 dbSNP
rs1305692413 709 dbSNP
rs1351781481 711 dbSNP
rs28756245 713 dbSNP
rs771053681 715 dbSNP
rs938859304 723 dbSNP
rs1364979071 725 dbSNP
rs1226390198 726 dbSNP
rs908677269 727 dbSNP
rs1340903716 735 dbSNP
rs983033786 744 dbSNP
rs953066431 750 dbSNP
rs1450632952 751 dbSNP
rs1382323318 759 dbSNP
rs1246372689 773 dbSNP
rs1332064623 773 dbSNP
rs1467278370 775 dbSNP
rs1195941535 778 dbSNP
rs1396045313 783 dbSNP
rs1027349630 788 dbSNP
rs1167255517 790 dbSNP
rs1399173123 791 dbSNP
rs1410054987 792 dbSNP
rs1398702321 806 dbSNP
rs1322251291 820 dbSNP
rs1347787466 822 dbSNP
rs1438127338 824 dbSNP
rs1303958279 826 dbSNP
rs3864819 829 dbSNP
rs746989739 830 dbSNP
rs1299750140 831 dbSNP
rs1370632254 835 dbSNP
rs973458627 835 dbSNP
rs964387617 840 dbSNP
rs189003629 841 dbSNP
rs1289206560 843 dbSNP
rs1017380286 847 dbSNP
rs1215771876 856 dbSNP
rs1254090429 858 dbSNP
rs1008619424 869 dbSNP
rs1187004100 875 dbSNP
rs28711667 877 dbSNP
rs1476003525 878 dbSNP
rs890298321 884 dbSNP
rs535234802 887 dbSNP
rs1326176107 888 dbSNP
rs1031505963 891 dbSNP
rs1458747210 894 dbSNP
rs1320001412 896 dbSNP
rs998806763 901 dbSNP
rs1283730035 909 dbSNP
rs1354327277 911 dbSNP
rs572877784 914 dbSNP
rs1235137868 916 dbSNP
rs28410783 917 dbSNP
rs1274050163 925 dbSNP
rs904426196 935 dbSNP
rs1207258954 939 dbSNP
rs1264263723 942 dbSNP
rs758715099 952 dbSNP
rs1448126678 953 dbSNP
rs28649208 954 dbSNP
rs1187458915 958 dbSNP
rs143557270 962 dbSNP
rs1475910387 964 dbSNP
rs1195226899 967 dbSNP
rs2650 972 dbSNP
rs573772558 973 dbSNP
rs1410812388 980 dbSNP
rs948741079 987 dbSNP
rs894441719 996 dbSNP
rs549688875 997 dbSNP
rs183923562 998 dbSNP
rs570921408 1006 dbSNP
rs28422123 1009 dbSNP
rs1357221121 1010 dbSNP
rs1243526966 1015 dbSNP
rs1293943043 1018 dbSNP
rs28682928 1020 dbSNP
rs551304214 1021 dbSNP
rs1351857190 1029 dbSNP
rs537693627 1030 dbSNP
rs568507456 1037 dbSNP
rs1277146624 1051 dbSNP
rs1310318785 1059 dbSNP
rs1449062034 1060 dbSNP
rs1334117837 1068 dbSNP
rs1471440989 1071 dbSNP
rs1183527676 1078 dbSNP
rs1328771269 1083 dbSNP
rs1363950547 1085 dbSNP
rs369406418 1088 dbSNP
rs931603517 1089 dbSNP
rs920188598 1091 dbSNP
rs773450639 1096 dbSNP
rs1387790788 1101 dbSNP
rs191808187 1108 dbSNP
rs975664502 1109 dbSNP
rs28742249 1124 dbSNP
rs1389679516 1130 dbSNP
rs964741603 1136 dbSNP
rs1336528388 1141 dbSNP
rs116744097 1142 dbSNP
rs41302978 1151 dbSNP
rs954436103 1157 dbSNP
rs28468083 1161 dbSNP
rs1384194782 1164 dbSNP
rs1212211825 1165 dbSNP
rs1273366539 1165 dbSNP
rs1031538416 1174 dbSNP
rs1481788212 1175 dbSNP
rs1196968041 1176 dbSNP
rs1250820374 1185 dbSNP
rs1345276510 1192 dbSNP
rs1432193964 1201 dbSNP
rs1196529405 1207 dbSNP
rs1158931308 1209 dbSNP
rs999077088 1224 dbSNP
rs1454700776 1225 dbSNP
rs533163981 1239 dbSNP
rs148888629 1248 dbSNP
rs1299925320 1250 dbSNP
rs568329515 1253 dbSNP
rs1386408260 1254 dbSNP
rs1324368634 1256 dbSNP
rs1180484489 1259 dbSNP
rs1235391039 1261 dbSNP
rs1297526483 1262 dbSNP
rs1306213941 1263 dbSNP
rs1229010602 1264 dbSNP
rs1251352771 1266 dbSNP
rs1487981958 1283 dbSNP
rs1211420396 1289 dbSNP
rs1021967260 1293 dbSNP
rs765442679 1295 dbSNP
rs1012794613 1300 dbSNP
rs544150092 1308 dbSNP
rs1269410359 1311 dbSNP
rs1388282889 1315 dbSNP
rs530703910 1317 dbSNP
rs757585054 1319 dbSNP
rs1286994652 1321 dbSNP
rs1373709020 1331 dbSNP
rs1002941979 1332 dbSNP
rs1163055239 1336 dbSNP
rs561378033 1337 dbSNP
rs1320256755 1339 dbSNP
rs1360537976 1340 dbSNP
rs541786049 1362 dbSNP
rs1278978422 1364 dbSNP
rs754214170 1375 dbSNP
rs1234086927 1376 dbSNP
rs1230864755 1380 dbSNP
rs1274688666 1383 dbSNP
rs1333300334 1386 dbSNP
rs1207923410 1401 dbSNP
rs1301885794 1406 dbSNP
rs1486843134 1408 dbSNP
rs1187036166 1411 dbSNP
rs931484629 1417 dbSNP
rs1423329937 1419 dbSNP
rs45615137 1424 dbSNP
rs1420327698 1427 dbSNP
rs1462132862 1429 dbSNP
rs1158953466 1430 dbSNP
rs1343791734 1432 dbSNP
rs1455865893 1434 dbSNP
rs1289971443 1435 dbSNP
rs1379021391 1437 dbSNP
rs1040363165 1438 dbSNP
rs1294562764 1439 dbSNP
rs1227388340 1441 dbSNP
rs563564 1442 dbSNP
rs910256212 1443 dbSNP
rs1398939425 1452 dbSNP
rs184655803 1456 dbSNP
rs1402024860 1472 dbSNP
rs1255358827 1473 dbSNP
rs1405370202 1475 dbSNP
rs1157440087 1484 dbSNP
rs1259676677 1487 dbSNP
rs1478094065 1489 dbSNP
rs1176832451 1490 dbSNP
rs987124648 1491 dbSNP
rs954470220 1492 dbSNP
rs761239841 1493 dbSNP
rs1359137326 1494 dbSNP
rs754718590 1496 dbSNP
rs1379277165 1498 dbSNP
rs1375519793 1499 dbSNP
rs1408622458 1500 dbSNP
rs1277427266 1502 dbSNP
rs576920064 1503 dbSNP
rs757449905 1504 dbSNP
rs755681710 1505 dbSNP
rs1218543716 1507 dbSNP
rs1013281271 1508 dbSNP
rs1282643414 1510 dbSNP
rs1486042279 1515 dbSNP
rs958601983 1515 dbSNP
rs1445448936 1523 dbSNP
rs1394845046 1527 dbSNP
rs1035676807 1532 dbSNP
rs1002847113 1534 dbSNP
rs11258324 1535 dbSNP
rs1281921953 1538 dbSNP
rs369809229 1541 dbSNP
rs1355955536 1542 dbSNP
rs1442450506 1549 dbSNP
rs995566200 1559 dbSNP
rs1162270799 1560 dbSNP
rs1368508277 1561 dbSNP
rs1341694295 1573 dbSNP
rs537776638 1575 dbSNP
rs898699352 1578 dbSNP
rs1270946260 1579 dbSNP
rs1439837978 1582 dbSNP
rs1205485632 1590 dbSNP
rs1280435785 1591 dbSNP
rs1252539897 1594 dbSNP
rs1467429523 1594 dbSNP
rs749854126 1598 dbSNP
rs1429098394 1601 dbSNP
rs1343039734 1602 dbSNP
rs1317263023 1609 dbSNP
rs767112904 1613 dbSNP
rs1414532096 1616 dbSNP
rs1407747716 1620 dbSNP
rs1039865463 1627 dbSNP
rs79664729 1628 dbSNP
rs1421006477 1631 dbSNP
rs145749407 1643 dbSNP
rs1424278905 1651 dbSNP
rs1195527990 1659 dbSNP
rs535034805 1661 dbSNP
rs1442859519 1662 dbSNP
rs1474330828 1672 dbSNP
rs1364434759 1674 dbSNP
rs932987533 1675 dbSNP
rs1268561761 1684 dbSNP
rs192369713 1693 dbSNP
rs1215182457 1702 dbSNP
rs1211165183 1704 dbSNP
rs1215982654 1708 dbSNP
rs1020008714 1715 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agggcccuugaguagUCAGAGg 5'
                         |||||| 
Target 5' ------------ucaAGUCUCa 3'
 		1 - 10
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000545675.1 | 3UTR | UCAAGUCUCAACAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000545675.1 | 3UTR | UCAAGUCUCAACAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission