miRTarBase - #MIRT444144


—
pre-miRNA Information
pre-miRNA hsa-mir-526b   
Genomic Coordinates chr19: 53694393 - 53694475
Description Homo sapiens miR-526b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-526b-5p
Sequence 14| CUCUUGAGGGAAGCACUUUCUGU |36
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs527640376 1 dbSNP
rs1397075062 2 dbSNP
rs1462454250 5 dbSNP
rs774071640 7 dbSNP
rs1329470722 12 dbSNP
rs1471427006 13 dbSNP
rs375077514 15 dbSNP
rs1280430663 16 dbSNP
rs370046048 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARSE   
Synonyms ASE, CDPX, CDPX1, CDPXR
Description arylsulfatase E (chondrodysplasia punctata 1)
Transcript NM_000047   
Expression
Putative miRNA Targets on ARSE
3'UTR of ARSE
(miRNA target sites are highlighted)		 
>ARSE|NM_000047|3'UTR
   1 ATGTCTGCAGTGAAAAGCTGGAGCCCCGATTCCTAAATTTTGTCACTCAAATTGAAACAAACCAGCTGGCCATGGTGGTT
  81 GTCATCCCAGCACTTTAGGAGGCCACCACAGGAGGATCACTCCCGTGATCAAAACCAACCTGGGCAACATGATGAAACTC
 161 TAGCTCTACAAAACAAAAATAAAAAAAAAATTAGCCTGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUCUUUCACGAAG-GGAGUUCUc 5'
            ||:|:  ||  | || ||:|| 
Target 5' ttAGGAG--GC--CACCACAGGAg 3'
 95 - 114 101.00 -14.40
2 
miRNA  3' ugUCUUUC-A-CGAAGG---GAGUUCUC-- 5'
            ||:|:| |  || ||    |||| |   
Target 5' acAGGAGGATCACTCCCGTGATCAAAACCA 3'
 108 - 137 79.00 -13.10
3 
miRNA  3' ugucuuUCACGAAGGGAGUUCuc 5'
                ||||     || :||  
Target 5' gtctgcAGTGAAAAGCTGGAGcc 3'
 3 - 25 77.00 -7.80
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1340143455 12 dbSNP
rs756210434 13 dbSNP
rs752767946 14 dbSNP
rs771146162 20 dbSNP
rs758293584 23 dbSNP
rs750241721 27 dbSNP
rs1322447070 28 dbSNP
rs1292233670 31 dbSNP
rs1226836208 38 dbSNP
rs200675470 40 dbSNP
rs761662093 50 dbSNP
rs1389434404 58 dbSNP
rs928169125 64 dbSNP
rs1459431577 66 dbSNP
rs1368464914 83 dbSNP
rs749435772 86 dbSNP
rs1191292017 99 dbSNP
rs1260492166 108 dbSNP
rs1476539545 119 dbSNP
rs1195486597 125 dbSNP
rs966777331 138 dbSNP
rs1478362248 140 dbSNP
rs1164436363 159 dbSNP
rs5982927 167 dbSNP
rs1195368207 174 dbSNP
rs1431481571 180 dbSNP
rs756724677 181 dbSNP
rs1360026801 183 dbSNP
rs1341296198 191 dbSNP
rs1398225914 191 dbSNP
rs989611341 191 dbSNP
rs1210948675 208 dbSNP
rs1310254532 209 dbSNP
rs1323262572 211 dbSNP
rs1222271205 212 dbSNP
rs1285219756 217 dbSNP
rs753118871 218 dbSNP
rs1218095700 220 dbSNP
rs958337432 227 dbSNP
rs1204914757 234 dbSNP
rs1342381015 245 dbSNP
rs1412137357 249 dbSNP
rs1299313743 251 dbSNP
rs1166195022 253 dbSNP
rs1380210226 260 dbSNP
rs781634030 264 dbSNP
rs143340498 265 dbSNP
rs1447638010 269 dbSNP
rs139314733 271 dbSNP
rs1301439615 272 dbSNP
rs146382452 274 dbSNP
rs1308465522 279 dbSNP
rs1351336120 281 dbSNP
rs1241721743 286 dbSNP
rs1286042909 292 dbSNP
rs1441309663 293 dbSNP
rs1207631327 297 dbSNP
rs1238840259 306 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000540563.1 | 3UTR | UCAAGAAUAUUUCUUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000540563.1 | 3UTR | UCAAGAAUAUUUCUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.42 2.3e-2 -0.337 5.8e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.548 2.6e-2 -0.474 5.1e-2 13 Click to see details
GSE17498 Multiple myeloma -0.294 3.3e-2 -0.417 3.7e-3 40 Click to see details
GSE21032 Prostate cancer -0.203 3.3e-2 -0.200 3.5e-2 83 Click to see details
GSE32688 Pancreatic cancer -0.264 7.2e-2 -0.288 5.5e-2 32 Click to see details
GSE19350 CNS germ cell tumors -0.375 1.1e-1 -0.427 8.3e-2 12 Click to see details
GSE27834 Pluripotent stem cells 0.255 1.7e-1 0.156 2.8e-1 16 Click to see details
GSE28544 Breast cancer 0.201 1.7e-1 0.035 4.4e-1 24 Click to see details
GSE38226 Liver fibrosis 0.206 1.9e-1 0.051 4.1e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.177 2.0e-1 0.326 5.6e-2 25 Click to see details
GSE19536 Breast cancer 0.083 2.1e-1 0.058 2.8e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.124 2.8e-1 0.199 1.8e-1 24 Click to see details
GSE21687 Ependynoma primary tumors 0.056 3.3e-1 0.013 4.6e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.091 3.3e-1 0.341 4.8e-2 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.076 3.8e-1 -0.177 2.3e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.026 4.1e-1 0.004 4.9e-1 79 Click to see details
GSE14794 Lymphoblastoid cells -0.024 4.1e-1 0.001 5.0e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.05 4.2e-1 -0.068 3.9e-1 20 Click to see details
GSE17306 Multiple myeloma -0.015 4.6e-1 0.042 3.9e-1 49 Click to see details
GSE17306 Multiple myeloma -0.015 4.6e-1 0.042 3.9e-1 49 Click to see details
GSE17306 Multiple myeloma -0.015 4.6e-1 0.042 3.9e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.327 0.08 -0.386 0.05 20 Click to see details
LIHC -0.236 0.27 -0.533 0.07 9 Click to see details
THCA -0.153 0.29 -0.024 0.46 16 Click to see details
PRAD 0.147 0.32 0.324 0.14 13 Click to see details
UCEC 0.163 0.42 0.000 0.5 4 Click to see details
BLCA -0.063 0.44 -0.071 0.43 8 Click to see details
LUSC 0.018 0.48 0.167 0.33 9 Click to see details
STAD 0.023 0.49 -0.300 0.31 5 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
BRCA 0.005 0.49 0.007 0.48 56 Click to see details
234 hsa-miR-526b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT382022 FAM49B family with sequence similarity 49 member B 2 2
MIRT442559 CAB39 calcium binding protein 39 2 2
MIRT443783 ST13 ST13, Hsp70 interacting protein 2 2
MIRT443886 CNKSR3 CNKSR family member 3 2 2
MIRT443970 SSH2 slingshot protein phosphatase 2 2 2
MIRT444050 PROX2 prospero homeobox 2 2 2
MIRT444128 BRCA2 BRCA2, DNA repair associated 2 2
MIRT444144 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT444171 RBM7 RNA binding motif protein 7 2 2
MIRT444185 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT444217 METTL12 methyltransferase like 12 2 2
MIRT444474 WNT5A Wnt family member 5A 2 2
MIRT444582 GPR89B G protein-coupled receptor 89B 2 2
MIRT444659 TSPAN14 tetraspanin 14 2 2
MIRT444755 LUZP1 leucine zipper protein 1 2 2
MIRT444768 ZNF90 zinc finger protein 90 2 2
MIRT444862 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT444904 KIAA1841 KIAA1841 2 2
MIRT444941 HLA-DQB2 major histocompatibility complex, class II, DQ beta 2 2 2
MIRT444966 CDH7 cadherin 7 2 2
MIRT445008 TMEM106B transmembrane protein 106B 2 2
MIRT445014 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT445036 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT445045 PURB purine rich element binding protein B 2 2
MIRT445075 CXXC4 CXXC finger protein 4 2 2
MIRT445148 KLHL23 kelch like family member 23 2 2
MIRT445228 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT445258 C9orf66 chromosome 9 open reading frame 66 2 2
MIRT445263 LOH12CR2 loss of heterozygosity, 12, chromosomal region 2 (non-protein coding) 2 4
MIRT445413 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT445431 ESD esterase D 2 2
MIRT445475 KDM6A lysine demethylase 6A 2 2
MIRT445618 CLIC4 chloride intracellular channel 4 2 2
MIRT445709 RBL1 RB transcriptional corepressor like 1 2 2
MIRT445736 ITM2A integral membrane protein 2A 2 2
MIRT445787 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT445796 IFIT1 interferon induced protein with tetratricopeptide repeats 1 2 2
MIRT445801 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT445805 NFATC2 nuclear factor of activated T-cells 2 2 2
MIRT445814 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT445861 ZNF451 zinc finger protein 451 2 2
MIRT445871 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT445964 IKZF5 IKAROS family zinc finger 5 2 2
MIRT445974 TSPYL1 TSPY like 1 2 2
MIRT446013 VNN1 vanin 1 2 2
MIRT446021 HBS1L HBS1 like translational GTPase 2 2
MIRT446080 RCOR3 REST corepressor 3 2 2
MIRT446084 SLC30A10 solute carrier family 30 member 10 2 2
MIRT446102 TSC22D2 TSC22 domain family member 2 2 2
MIRT446174 ZNF37A zinc finger protein 37A 2 2
MIRT446185 FGF1 fibroblast growth factor 1 2 2
MIRT446197 GTPBP4 GTP binding protein 4 2 2
MIRT446212 SLC25A44 solute carrier family 25 member 44 2 2
MIRT446229 C17orf80 chromosome 17 open reading frame 80 2 2
MIRT446311 TBC1D8B TBC1 domain family member 8B 2 2
MIRT446362 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT446383 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT446411 OCA2 OCA2 melanosomal transmembrane protein 2 2
MIRT446535 GOLGA8B golgin A8 family member B 2 2
MIRT446544 ASTN2 astrotactin 2 2 2
MIRT446563 IDS iduronate 2-sulfatase 2 2
MIRT446569 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT446596 AKAP1 A-kinase anchoring protein 1 2 2
MIRT446703 FUT10 fucosyltransferase 10 2 2
MIRT446778 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT446782 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT446787 KIF1C kinesin family member 1C 2 2
MIRT446795 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT446801 C5orf30 chromosome 5 open reading frame 30 2 2
MIRT446841 FOXP1 forkhead box P1 2 2
MIRT446848 FIBIN fin bud initiation factor homolog (zebrafish) 2 2
MIRT446865 NBPF3 NBPF member 3 2 2
MIRT446883 TRIM25 tripartite motif containing 25 2 2
MIRT446904 RGS5 regulator of G protein signaling 5 2 2
MIRT446910 GPR89A G protein-coupled receptor 89A 2 2
MIRT446931 AGGF1 angiogenic factor with G-patch and FHA domains 1 2 2
MIRT446942 ZMAT3 zinc finger matrin-type 3 2 2
MIRT446976 SUSD5 sushi domain containing 5 2 2
MIRT447005 RSF1 remodeling and spacing factor 1 2 2
MIRT447027 TACR3 tachykinin receptor 3 2 2
MIRT447037 ZNF439 zinc finger protein 439 2 2
MIRT447050 STARD5 StAR related lipid transfer domain containing 5 2 2
MIRT447056 KCNAB1 potassium voltage-gated channel subfamily A member regulatory beta subunit 1 2 2
MIRT447145 HHIP hedgehog interacting protein 2 2
MIRT447152 PRSS12 protease, serine 12 2 2
MIRT447179 PGRMC2 progesterone receptor membrane component 2 2 2
MIRT447198 DNAJC5G DnaJ heat shock protein family (Hsp40) member C5 gamma 2 2
MIRT447210 APBB2 amyloid beta precursor protein binding family B member 2 2 2
MIRT447238 IHH indian hedgehog 2 2
MIRT447271 FZD5 frizzled class receptor 5 2 2
MIRT447322 ZSCAN21 zinc finger and SCAN domain containing 21 2 2
MIRT447390 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT447409 MED21 mediator complex subunit 21 2 2
MIRT447478 NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 2 2
MIRT447549 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT447628 NDST4 N-deacetylase and N-sulfotransferase 4 2 2
MIRT447645 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT447694 OGN osteoglycin 2 2
MIRT447733 MOCOS molybdenum cofactor sulfurase 2 2
MIRT447739 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT447868 TRNT1 tRNA nucleotidyl transferase 1 2 2
MIRT447979 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT447992 CDX1 caudal type homeobox 1 2 2
MIRT448067 SLC25A43 solute carrier family 25 member 43 2 2
MIRT448113 SEMA4G semaphorin 4G 2 2
MIRT448129 CCDC80 coiled-coil domain containing 80 2 2
MIRT448171 ST6GAL1 ST6 beta-galactoside alpha-2,6-sialyltransferase 1 2 2
MIRT448299 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT448447 SMC3 structural maintenance of chromosomes 3 2 2
MIRT448467 SLC45A4 solute carrier family 45 member 4 2 2
MIRT448472 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT448481 SEMA4F ssemaphorin 4F 2 2
MIRT448747 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT448765 GOLGA8A golgin A8 family member A 2 2
MIRT448830 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT448852 FEM1C fem-1 homolog C 2 2
MIRT448899 CLOCK clock circadian regulator 2 2
MIRT448905 CLCN6 chloride voltage-gated channel 6 2 4
MIRT448951 CDK19 cyclin dependent kinase 19 2 2
MIRT448974 CADM2 cell adhesion molecule 2 2 2
MIRT449021 AMER2 APC membrane recruitment protein 2 2 2
MIRT449053 NUDT3 nudix hydrolase 3 2 2
MIRT449065 ZNF24 zinc finger protein 24 2 2
MIRT449069 CNDP2 carnosine dipeptidase 2 2 2
MIRT449120 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT449177 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT449304 PARP3 poly(ADP-ribose) polymerase family member 3 2 2
MIRT449319 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT449345 GEMIN6 gem nuclear organelle associated protein 6 2 2
MIRT449424 GPR75 G protein-coupled receptor 75 2 2
MIRT449440 STAMBP STAM binding protein 2 2
MIRT449474 ZNF84 zinc finger protein 84 2 2
MIRT449504 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449599 INIP INTS3 and NABP interacting protein 2 4
MIRT449611 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT449630 ELAVL4 ELAV like RNA binding protein 4 2 2
MIRT449654 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 2 2
MIRT449679 CDR1 cerebellar degeneration related protein 1 2 2
MIRT449730 CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 2 2
MIRT449777 NUDT16 nudix hydrolase 16 2 2
MIRT449826 TLR4 toll like receptor 4 2 2
MIRT449832 AGK acylglycerol kinase 2 2
MIRT449855 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT449927 TPST2 tyrosylprotein sulfotransferase 2 2 2
MIRT450126 NSUN3 NOP2/Sun RNA methyltransferase family member 3 2 2
MIRT450202 ABHD15 abhydrolase domain containing 15 2 2
MIRT450243 TRIM66 tripartite motif containing 66 2 2
MIRT450268 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450337 MRPL17 mitochondrial ribosomal protein L17 2 4
MIRT450341 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 2 2
MIRT450344 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT450374 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT450408 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT450427 CPOX coproporphyrinogen oxidase 2 2
MIRT450451 ZDHHC2 zinc finger DHHC-type containing 2 2 2
MIRT450463 ENOX1 ecto-NOX disulfide-thiol exchanger 1 2 2
MIRT450527 PGLS 6-phosphogluconolactonase 2 2
MIRT450540 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450631 ZNF654 zinc finger protein 654 2 2
MIRT450652 TMEM70 transmembrane protein 70 2 2
MIRT450670 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT450685 RPN2 ribophorin II 2 2
MIRT450707 RNF152 ring finger protein 152 2 2
MIRT450765 PPAPDC2 phospholipid phosphatase 6 2 2
MIRT450812 LIFR LIF receptor alpha 2 2
MIRT450867 GPR107 G protein-coupled receptor 107 2 2
MIRT464938 TXLNA taxilin alpha 2 4
MIRT472332 NETO2 neuropilin and tolloid like 2 2 2
MIRT478672 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT485664 CDC25B cell division cycle 25B 2 2
MIRT497300 CD300LB CD300 molecule like family member b 2 2
MIRT497587 SLC23A1 solute carrier family 23 member 1 2 2
MIRT497762 KIAA0895 KIAA0895 2 2
MIRT497815 STAT5B signal transducer and activator of transcription 5B 2 2
MIRT497827 GPR26 G protein-coupled receptor 26 2 2
MIRT497855 LGR5 leucine rich repeat containing G protein-coupled receptor 5 2 2
MIRT497975 XBP1P1 X-box binding protein 1 pseudogene 1 2 2
MIRT498178 CREB1 cAMP responsive element binding protein 1 2 2
MIRT498333 PRELID2 PRELI domain containing 2 2 2
MIRT501771 NRBF2 nuclear receptor binding factor 2 2 6
MIRT504823 RAP2A RAP2A, member of RAS oncogene family 2 6
MIRT510498 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT513131 ZNF431 zinc finger protein 431 2 2
MIRT524341 CREBRF CREB3 regulatory factor 2 4
MIRT528236 SPIN4 spindlin family member 4 2 2
MIRT534138 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT535420 PDZD8 PDZ domain containing 8 2 2
MIRT535876 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT540789 TMOD2 tropomodulin 2 2 2
MIRT540925 OIP5 Opa interacting protein 5 2 2
MIRT544028 STAM signal transducing adaptor molecule 2 2
MIRT546027 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT551818 TMEM138 transmembrane protein 138 2 2
MIRT556115 MLEC malectin 2 4
MIRT557669 GATA6 GATA binding protein 6 2 2
MIRT568897 MGRN1 mahogunin ring finger 1 2 2
MIRT573538 MDM2 MDM2 proto-oncogene 2 2
MIRT615473 RPS6KA3 ribosomal protein S6 kinase A3 2 2
MIRT618257 DDX51 DEAD-box helicase 51 2 2
MIRT619905 FAM43B family with sequence similarity 43 member B 2 2
MIRT621109 SP110 SP110 nuclear body protein 2 2
MIRT622331 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT622682 PLSCR1 phospholipid scramblase 1 2 2
MIRT624095 DNAJC16 DnaJ heat shock protein family (Hsp40) member C16 2 2
MIRT628661 FAM83C family with sequence similarity 83 member C 2 2
MIRT639259 MANEAL mannosidase endo-alpha like 2 2
MIRT641171 LYPLA1 lysophospholipase I 2 2
MIRT642966 FUT6 fucosyltransferase 6 2 2
MIRT643539 SLC25A17 solute carrier family 25 member 17 2 2
MIRT648679 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT649446 ST3GAL6 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 2 2
MIRT651353 ZBTB40 zinc finger and BTB domain containing 40 2 2
MIRT651565 WHSC1L1 nuclear receptor binding SET domain protein 3 2 2
MIRT652242 TPPP tubulin polymerization promoting protein 2 2
MIRT653925 SERPINC1 serpin family C member 1 2 2
MIRT654113 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT658395 FAM221B family with sequence similarity 221 member B 2 2
MIRT658581 EPHB1 EPH receptor B1 2 2
MIRT660026 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT661405 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 2 2
MIRT664138 ATP6V1G3 ATPase H+ transporting V1 subunit G3 2 2
MIRT665655 TRIM33 tripartite motif containing 33 2 2
MIRT691641 SLC43A3 solute carrier family 43 member 3 2 2
MIRT692708 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT693859 IYD iodotyrosine deiodinase 2 2
MIRT702910 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT705052 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705124 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT705534 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT708676 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT709868 A1CF APOBEC1 complementation factor 2 2
MIRT715657 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT716567 DLGAP2 DLG associated protein 2 2 2
MIRT737090 SIK2 salt inducible kinase 2 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-526b Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-526b 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-526b 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-526b Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-526b Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-526b-5p Cisplatin 5460033 NSC119875 approved resistant High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-526b-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-526b-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-526b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, H3122)
hsa-miR-526b-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-526b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-526b-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-526b-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-526b-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-526b-5p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-526b-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-526b-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-526b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-526b-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-526b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-526b-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-526b-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-526b-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission