miRTarBase - #MIRT444366


—
pre-miRNA Information
pre-miRNA hsa-mir-100   
Genomic Coordinates chr11: 122152229 - 122152308
Synonyms MIRN100, miR-100, MIR100
Description Homo sapiens miR-100 stem-loop
Comment This sequence is localised to chromosome 11 and was named mir-100-11 in reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-100-3p
Sequence 48| CAAGCUUGUAUCUAUAGGUAUG |69
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 11 - 122152259 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs773933142 2 dbSNP
rs1321972926 4 dbSNP
rs770590792 7 dbSNP
rs1388368183 9 dbSNP
rs909526986 14 dbSNP
rs749039221 15 dbSNP
rs530428149 17 dbSNP
rs775253529 17 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TIMM8B   
Synonyms DDP2, TIM8B
Description translocase of inner mitochondrial membrane 8 homolog B
Transcript NM_012459   
Expression
Putative miRNA Targets on TIMM8B
3'UTR of TIMM8B
(miRNA target sites are highlighted)		 
>TIMM8B|NM_012459|3'UTR
   1 GCCATCCCCCAGGAGAATGACAGAAGCAAAGGACTTGTTACTAAGCAGATTTAAGGGTCAGTGGGGGAAGGCTATCAACC
  81 CATTGTCAGATCAGCATCAGGCTGTTATCAAGTCTGTTGGTGCTAAAAAGTAAAAGATGAAATGTTCAAAGAGTGAAATT
 161 TATTTATTTGGAATTCAGAAATTCCAGGTTGTATGACATCAGTTACTCAATAAGTGTGAATTCTCCAACTCTTCTTTTAA
 241 TCCCATTTTAGAATTTAATATAGAGATCTCTGATTGGCAGGAACACTAGAAATAAATGTTCCATGGCCAGTAGTGCAAAT
 321 GGGGGATTGTAGGTTTTGAAAAACCACCCTAAGCCATATTAAGGGGGTTGGAAGAACCATCGAAGCCTAAGGCATAGAAG
 401 AAAATTTGGGGTTAAGAAAGATGAAGAACAAAAAACAGCTTTATTGCTTATACATGACCAAGAAAAGGAAAACATGGCAA
 481 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guaUGGAUA----UCUA----U-GUUCGAac 5'
             ||| ||    ||||    | ||:|||  
Target 5' tcaACCCATTGTCAGATCAGCATCAGGCTgt 3'
 75 - 105 115.00 -8.50
2 
miRNA  3' guAUGGAUAUCUAU--GUUCgaac 5'
            |:|:|||| ||:  ||||    
Target 5' atTGCTTATACATGACCAAGaaaa 3'
 443 - 466 110.00 -7.36
3 
miRNA  3' guAUGGAUAUCU----AUGUUCGAAc 5'
            |:|  ||:|:    |::|:|:|| 
Target 5' agTGCAAATGGGGGATTGTAGGTTTt 3'
 312 - 337 106.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30464708 3 COSMIC
COSN30525477 13 COSMIC
COSN30146151 25 COSMIC
COSN30478307 31 COSMIC
COSN28886869 40 COSMIC
COSN30508201 51 COSMIC
COSN31612812 72 COSMIC
COSN30509505 76 COSMIC
COSN1126584 83 COSMIC
COSN31530672 138 COSMIC
COSN32065661 138 COSMIC
COSN31532515 333 COSMIC
COSN31515154 381 COSMIC
COSN30160456 409 COSMIC
COSN25730499 419 COSMIC
COSN8640852 477 COSMIC
COSN19655815 496 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1396716875 3 dbSNP
rs1171494993 6 dbSNP
rs1229886728 7 dbSNP
rs760335707 13 dbSNP
rs775220221 15 dbSNP
rs376730287 18 dbSNP
rs887717599 20 dbSNP
rs1436160140 22 dbSNP
rs1267139786 31 dbSNP
rs1487465937 32 dbSNP
rs749703681 38 dbSNP
rs1212304949 39 dbSNP
rs1350653880 41 dbSNP
rs773570289 45 dbSNP
rs770237175 46 dbSNP
rs556111853 48 dbSNP
rs535840784 63 dbSNP
rs929134077 70 dbSNP
rs1485447952 72 dbSNP
rs1472467686 74 dbSNP
rs1166110080 79 dbSNP
rs923094855 83 dbSNP
rs975871184 87 dbSNP
rs752047515 89 dbSNP
rs12286283 94 dbSNP
rs910240568 101 dbSNP
rs1349565943 105 dbSNP
rs548554081 108 dbSNP
rs1314625493 111 dbSNP
rs1290415657 116 dbSNP
rs1244010102 130 dbSNP
rs1251872741 131 dbSNP
rs144034555 138 dbSNP
rs1207469438 142 dbSNP
rs1249811117 147 dbSNP
rs140364026 148 dbSNP
rs1001883229 151 dbSNP
rs978069166 153 dbSNP
rs1258739610 154 dbSNP
rs904972407 160 dbSNP
rs1037985966 188 dbSNP
rs971576711 189 dbSNP
rs146725060 191 dbSNP
rs1037669533 192 dbSNP
rs1166176942 198 dbSNP
rs1369492422 206 dbSNP
rs1304326142 208 dbSNP
rs1434969520 208 dbSNP
rs1012982267 210 dbSNP
rs1296206672 214 dbSNP
rs1395303657 214 dbSNP
rs1367274306 225 dbSNP
rs1230631277 230 dbSNP
rs887353472 231 dbSNP
rs1341674881 237 dbSNP
rs1047270065 238 dbSNP
rs934244162 239 dbSNP
rs1438897575 242 dbSNP
rs1181709207 246 dbSNP
rs958793802 249 dbSNP
rs1017408830 260 dbSNP
rs149707049 261 dbSNP
rs563596712 265 dbSNP
rs1422765310 270 dbSNP
rs751809666 276 dbSNP
rs1434839625 284 dbSNP
rs1177779786 285 dbSNP
rs1392071291 297 dbSNP
rs543821094 299 dbSNP
rs1465303746 301 dbSNP
rs1289247519 306 dbSNP
rs777852724 308 dbSNP
rs926061914 309 dbSNP
rs1432852939 312 dbSNP
rs901701647 319 dbSNP
rs967366221 321 dbSNP
rs758562999 324 dbSNP
rs1219946439 326 dbSNP
rs1303669581 327 dbSNP
rs879628508 329 dbSNP
rs1209783246 332 dbSNP
rs879550102 332 dbSNP
rs913233035 340 dbSNP
rs1427844225 344 dbSNP
rs1417199134 346 dbSNP
rs988049367 347 dbSNP
rs1248016439 349 dbSNP
rs1040220215 356 dbSNP
rs529995315 360 dbSNP
rs1432260525 366 dbSNP
rs1159577844 367 dbSNP
rs1413863802 368 dbSNP
rs1192651193 372 dbSNP
rs910321086 376 dbSNP
rs960928996 381 dbSNP
rs754468787 382 dbSNP
rs1437197770 387 dbSNP
rs180822823 392 dbSNP
rs1034795420 393 dbSNP
rs1002020406 406 dbSNP
rs1054574290 409 dbSNP
rs1331635222 414 dbSNP
rs1219773682 420 dbSNP
rs1227018961 422 dbSNP
rs1483773997 422 dbSNP
rs1274729466 423 dbSNP
rs1267985676 424 dbSNP
rs1205905473 426 dbSNP
rs969101014 427 dbSNP
rs1307370037 429 dbSNP
rs1244508463 438 dbSNP
rs1487897530 440 dbSNP
rs1182423511 450 dbSNP
rs191295421 451 dbSNP
rs1221251696 458 dbSNP
rs942034386 459 dbSNP
rs878991213 462 dbSNP
rs1403299152 468 dbSNP
rs1372560364 469 dbSNP
rs1298805506 470 dbSNP
rs4937011 472 dbSNP
rs889400058 473 dbSNP
rs1352621133 474 dbSNP
rs1466032078 476 dbSNP
rs1265997378 477 dbSNP
rs867719695 478 dbSNP
rs1166948496 479 dbSNP
rs1016677630 480 dbSNP
rs1348166878 480 dbSNP
rs1428300772 480 dbSNP
rs1196925140 481 dbSNP
rs1308846741 496 dbSNP
rs1352572515 496 dbSNP
rs1402149144 496 dbSNP
rs1408329948 496 dbSNP
rs1491043662 496 dbSNP
rs373899267 496 dbSNP
rs386374911 496 dbSNP
rs71301698 496 dbSNP
rs71775703 496 dbSNP
rs751174110 496 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guauggauaucuauGUUCGAAc 5'
                        ||||||| 
Target 5' -------------uCAAGCUUu 3'
 		1 - 9
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000504148.2 | 3UTR | UCAAGCUUUUUACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000504148.2 | 3UTR | UCAAGCUUUUUACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.482 8.5e-3 -0.479 8.9e-3 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.457 1.1e-2 0.603 7.1e-4 25 Click to see details
GSE38226 Liver fibrosis -0.291 1.0e-1 -0.276 1.1e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.384 1.5e-1 0.517 7.7e-2 9 Click to see details
GSE19350 CNS germ cell tumors 0.254 2.1e-1 0.521 4.1e-2 12 Click to see details
GSE21687 Ependynoma primary tumors 0.086 2.5e-1 0.025 4.2e-1 64 Click to see details
GSE17498 Multiple myeloma -0.109 2.5e-1 -0.069 3.4e-1 40 Click to see details
GSE32688 Pancreatic cancer 0.111 2.7e-1 0.150 2.1e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.118 2.9e-1 0.114 3.0e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.12 3.5e-1 -0.033 4.6e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.081 3.7e-1 -0.316 8.7e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.026 4.5e-1 -0.022 4.6e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.001 5.0e-1 0.237 1.4e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.757 0.04 -0.429 0.2 6 Click to see details
CHOL -0.736 0.08 0.000 0.5 5 Click to see details
THCA -0.209 0.09 -0.189 0.11 44 Click to see details
LUSC -0.256 0.13 0.003 0.49 22 Click to see details
LIHC 0.194 0.15 0.180 0.17 30 Click to see details
KIRP -0.308 0.19 -0.248 0.24 10 Click to see details
BRCA -0.272 0.21 -0.327 0.16 11 Click to see details
PRAD 0.169 0.21 -0.096 0.33 24 Click to see details
LUAD 0.337 0.23 0.357 0.22 7 Click to see details
KIRC -0.345 0.25 0.029 0.48 6 Click to see details
BLCA 0.092 0.41 0.119 0.39 8 Click to see details
STAD -0.049 0.43 0.262 0.18 14 Click to see details
UCEC 0.044 0.45 -0.245 0.23 11 Click to see details
HNSC 0.015 0.47 -0.118 0.29 24 Click to see details
HNSC 0.015 0.47 -0.118 0.29 24 Click to see details
HNSC 0.015 0.47 -0.118 0.29 24 Click to see details
HNSC 0.015 0.47 -0.118 0.29 24 Click to see details
HNSC 0.015 0.47 -0.118 0.29 24 Click to see details
107 hsa-miR-100-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT105690 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT151558 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT167753 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT195380 CBFB core-binding factor beta subunit 2 2
MIRT283995 DNAJA2 DnaJ heat shock protein family (Hsp40) member A2 2 2
MIRT317145 E2F3 E2F transcription factor 3 2 4
MIRT380785 ZFP3 ZFP3 zinc finger protein 2 2
MIRT380927 ZNF264 zinc finger protein 264 2 2
MIRT441600 ABCB5 ATP binding cassette subfamily B member 5 2 6
MIRT443896 NUDT3 nudix hydrolase 3 2 4
MIRT444030 GREM1 gremlin 1, DAN family BMP antagonist 2 4
MIRT444112 CEPT1 choline/ethanolamine phosphotransferase 1 2 2
MIRT444169 ZNF701 zinc finger protein 701 2 2
MIRT444366 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT444371 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT444517 ZNF525 zinc finger protein 525 2 2
MIRT444525 CNIH4 cornichon family AMPA receptor auxiliary protein 4 2 2
MIRT444529 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT444537 PHKB phosphorylase kinase regulatory subunit beta 2 2
MIRT444702 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT444717 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT444730 TMC7 transmembrane channel like 7 2 2
MIRT444777 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 2 2
MIRT444802 TMEM251 transmembrane protein 251 2 2
MIRT444995 LRRC57 leucine rich repeat containing 57 2 2
MIRT445073 C16orf87 chromosome 16 open reading frame 87 2 2
MIRT445250 SEMA5A semaphorin 5A 2 2
MIRT445336 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT445426 TPT1 tumor protein, translationally-controlled 1 2 4
MIRT445469 TRIM13 tripartite motif containing 13 2 2
MIRT445646 NPY4R neuropeptide Y receptor Y4 2 2
MIRT445759 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT445838 SRSF11 serine and arginine rich splicing factor 11 2 2
MIRT445868 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT446368 STX16 syntaxin 16 2 2
MIRT446444 THYN1 thymocyte nuclear protein 1 2 2
MIRT446593 TASP1 taspase 1 2 2
MIRT446926 SRSF7 serine and arginine rich splicing factor 7 2 2
MIRT447121 SLFN5 schlafen family member 5 2 2
MIRT447196 CDCP1 CUB domain containing protein 1 2 2
MIRT447358 STOM stomatin 2 2
MIRT447361 FAM161B family with sequence similarity 161 member B 2 2
MIRT447374 NUP205 nucleoporin 205 2 2
MIRT447467 OSMR oncostatin M receptor 2 2
MIRT447606 MRPL3 mitochondrial ribosomal protein L3 2 2
MIRT447682 ASPA aspartoacylase 2 2
MIRT447715 ERP44 endoplasmic reticulum protein 44 2 2
MIRT447814 EMX1 empty spiracles homeobox 1 2 2
MIRT447855 RRP8 ribosomal RNA processing 8 2 4
MIRT447866 KIAA1244 ARFGEF family member 3 1 1
MIRT447890 STRIP2 striatin interacting protein 2 2 2
MIRT447916 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT447935 DUSP4 dual specificity phosphatase 4 2 2
MIRT448813 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT448927 CKS1B CDC28 protein kinase regulatory subunit 1B 2 2
MIRT449105 CREBRF CREB3 regulatory factor 2 2
MIRT449216 ZNHIT3 zinc finger HIT-type containing 3 2 2
MIRT449336 ACTBL2 actin, beta like 2 2 2
MIRT449675 SOX3 SRY-box 3 2 2
MIRT449724 POU2F1 POU class 2 homeobox 1 2 2
MIRT449768 PRAMEF7 PRAME family member 7 2 2
MIRT449804 PRAMEF8 PRAME family member 8 2 2
MIRT449850 BCL2L13 BCL2 like 13 2 2
MIRT449866 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT450067 SYT9 synaptotagmin 9 2 2
MIRT450197 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT450386 TENM4 teneurin transmembrane protein 4 2 2
MIRT450435 PAX8 paired box 8 2 2
MIRT450716 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT495906 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT497543 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT497630 ZNF576 zinc finger protein 576 2 2
MIRT497756 OXGR1 oxoglutarate receptor 1 2 2
MIRT498072 SLC25A12 solute carrier family 25 member 12 2 2
MIRT500542 XPO4 exportin 4 2 4
MIRT500848 SYPL1 synaptophysin like 1 2 4
MIRT511621 HIST1H3J histone cluster 1 H3 family member j 2 4
MIRT513745 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT535077 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT543133 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT544518 GTF2E2 general transcription factor IIE subunit 2 2 2
MIRT544666 MED19 mediator complex subunit 19 2 2
MIRT545407 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT547569 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548767 CNN3 calponin 3 2 2
MIRT551009 TRIM4 tripartite motif containing 4 2 2
MIRT555077 PURG purine rich element binding protein G 2 2
MIRT560753 ZNF616 zinc finger protein 616 2 2
MIRT563752 FOXO3 forkhead box O3 2 2
MIRT565531 SON SON DNA binding protein 2 2
MIRT613933 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT614433 TAZ tafazzin 2 2
MIRT622520 RAP2A RAP2A, member of RAS oncogene family 2 2
MIRT626037 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT648459 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT654982 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2 4
MIRT689103 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT704259 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT711194 CXCL3 C-X-C motif chemokine ligand 3 2 2
MIRT713315 VLDLR very low density lipoprotein receptor 2 2
MIRT717266 BMPR2 bone morphogenetic protein receptor type 2 4 2
MIRT718248 CCDC18 coiled-coil domain containing 18 2 2
MIRT721944 NGRN neugrin, neurite outgrowth associated 2 2
MIRT721948 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 2
MIRT734969 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 3 0
MIRT735945 NME2 NME/NM23 nucleoside diphosphate kinase 2 0 0
MIRT737404 HOXA1 homeobox A1 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-100 Trichostatin A (TSA) NULL 444732 Microarray human pancreatic cancer cell line BxPC-3 19112422 2009 up-regulated
miR-100 Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
miR-100 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-100 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-100 Docetaxel approved 148124 Microarray human lung adenocarcinoma cells 22120675 2012 up-regulated
miR-100 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-100 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-100 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-100 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-100 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-100 Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-100 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-100 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-100 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-100 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-100 Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-100 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-100 Ethanol NULL 702 Microarray zebrafish embryos 22298809 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-100 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-100 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-100 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-100 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-100 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-100 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-100 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-100 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-100-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-100-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-100-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia leukemia stem cells
hsa-miR-100-3p Ponatinib 24826799 NSC758487 approved sensitive High Chronic Myelogenous Leukemia leukemia stem cells
hsa-miR-100-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-100-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-100-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-100-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-100-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-100-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-100-3p Palbociclib 5330286 NSC758247 approved sensitive tissue (breast cancer)
hsa-miR-100-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-100-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-100-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-100-3p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-100-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (MDA-231)
hsa-miR-100-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-100-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission