miRTarBase - #MIRT444505


—
pre-miRNA Information
pre-miRNA hsa-mir-3136   
Genomic Coordinates chr3: 69048958 - 69049035
Description Homo sapiens miR-3136 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3136-5p
Sequence 10| CUGACUGAAUAGGUAGGGUCAUU |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1478587998 4 dbSNP
rs912074637 12 dbSNP
rs1465866748 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF525
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000467003.1 | 3UTR | UCAAGCUUCAUCUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.608 0 -0.439 0.02 22 Click to see details
PRAD -0.547 0.02 -0.459 0.05 14 Click to see details
PAAD 0.997 0.02 1.000 0.5 3 Click to see details
BLCA 0.996 0.03 1.000 0.5 3 Click to see details
UCEC -0.518 0.03 -0.477 0.04 14 Click to see details
BRCA -0.307 0.05 -0.320 0.04 30 Click to see details
THCA -0.236 0.06 -0.233 0.07 43 Click to see details
ESCA -0.979 0.07 -1.000 0.5 3 Click to see details
KIRC 0.356 0.14 0.364 0.14 11 Click to see details
STAD -0.282 0.19 -0.203 0.26 12 Click to see details
LIHC -0.176 0.21 -0.063 0.39 23 Click to see details
KIRP -0.203 0.23 -0.032 0.45 16 Click to see details
CHOL -0.662 0.27 -0.500 0.33 3 Click to see details
LUSC -0.135 0.27 0.117 0.3 22 Click to see details
KICH -0.007 0.49 0.029 0.46 14 Click to see details
KICH -0.007 0.49 0.029 0.46 14 Click to see details
KICH -0.007 0.49 0.029 0.46 14 Click to see details
KICH -0.007 0.49 0.029 0.46 14 Click to see details
84 hsa-miR-3136-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081899 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT185493 SRP9 signal recognition particle 9 2 2
MIRT207226 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT246179 TXNIP thioredoxin interacting protein 2 4
MIRT347685 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT444157 ZNF701 zinc finger protein 701 2 2
MIRT444505 ZNF525 zinc finger protein 525 2 2
MIRT444683 NDOR1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT445131 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT446184 FGF1 fibroblast growth factor 1 2 2
MIRT447946 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT449366 ANTXR2 anthrax toxin receptor 2 2 2
MIRT449774 SULF2 sulfatase 2 2 2
MIRT450096 ST8SIA5 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 2 2
MIRT450903 CADM2 cell adhesion molecule 2 2 4
MIRT455645 YARS tyrosyl-tRNA synthetase 2 2
MIRT465135 TSC22D2 TSC22 domain family member 2 2 2
MIRT476177 GOLGA8A golgin A8 family member A 2 8
MIRT483978 PANK1 pantothenate kinase 1 2 10
MIRT497016 INO80B INO80 complex subunit B 2 2
MIRT497450 DDR2 discoidin domain receptor tyrosine kinase 2 2 2
MIRT497626 ZNF576 zinc finger protein 576 2 2
MIRT498187 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT504036 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT507106 GOLGA8B golgin A8 family member B 2 4
MIRT507900 CALM2 calmodulin 2 2 6
MIRT508802 MTPN myotrophin 2 6
MIRT510407 ZNF268 zinc finger protein 268 2 4
MIRT516297 F8A2 coagulation factor VIII associated 2 2 2
MIRT516323 F8A3 coagulation factor VIII associated 3 2 2
MIRT528028 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT529396 ICK intestinal cell kinase 2 2
MIRT534463 SCD stearoyl-CoA desaturase 2 4
MIRT535438 PDE4D phosphodiesterase 4D 2 2
MIRT538187 DBN1 drebrin 1 2 2
MIRT547386 MOB1A MOB kinase activator 1A 2 2
MIRT548180 FOXC1 forkhead box C1 2 2
MIRT561585 SKI SKI proto-oncogene 2 2
MIRT569449 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT573314 RFC5 replication factor C subunit 5 2 2
MIRT574762 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT575975 Fem1a feminization 1 homolog a (C. elegans) 2 5
MIRT575999 Zfp106 zinc finger protein 106 1 1
MIRT576277 Cd59a CD59a antigen 1 1
MIRT606772 KIAA0040 KIAA0040 2 5
MIRT606833 FEM1A fem-1 homolog A 2 7
MIRT608302 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT609269 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT609405 SLC25A45 solute carrier family 25 member 45 2 2
MIRT609603 TRPC4AP transient receptor potential cation channel subfamily C member 4 associated protein 2 2
MIRT610105 IL17REL interleukin 17 receptor E like 2 3
MIRT610327 SSX5 SSX family member 5 2 2
MIRT610610 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT611066 ZNF621 zinc finger protein 621 2 2
MIRT611492 ZNF440 zinc finger protein 440 2 2
MIRT611931 ZNF106 zinc finger protein 106 2 3
MIRT612239 MICALL1 MICAL like 1 2 2
MIRT612451 SMOC1 SPARC related modular calcium binding 1 2 4
MIRT612567 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 2 2
MIRT613111 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT614946 KAT6B lysine acetyltransferase 6B 2 2
MIRT615100 BNC2 basonuclin 2 2 2
MIRT616424 FAM126B family with sequence similarity 126 member B 2 2
MIRT617839 FMO4 flavin containing monooxygenase 4 2 2
MIRT618499 HSPD1 heat shock protein family D (Hsp60) member 1 2 2
MIRT619230 FBXL4 F-box and leucine rich repeat protein 4 2 2
MIRT624202 DCP2 decapping mRNA 2 2 4
MIRT630405 MTX3 metaxin 3 2 2
MIRT640327 DAAM2 dishevelled associated activator of morphogenesis 2 2 2
MIRT642779 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT654363 RBM23 RNA binding motif protein 23 2 2
MIRT654482 RANBP2 RAN binding protein 2 2 2
MIRT656336 MED28 mediator complex subunit 28 2 2
MIRT662856 UPF3A UPF3A, regulator of nonsense mediated mRNA decay 2 2
MIRT666894 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT669526 AP5M1 adaptor related protein complex 5 mu 1 subunit 2 2
MIRT671561 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT707042 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT717063 MTMR6 myotubularin related protein 6 2 2
MIRT717223 SH2D5 SH2 domain containing 5 2 2
MIRT719867 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 2
MIRT719967 RBX1 ring-box 1 2 2
MIRT723594 FKRP fukutin related protein 2 2
MIRT725081 VCPIP1 valosin containing protein interacting protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3136-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3136-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3136-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3136-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3136-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-3136-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-3136-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-3136-5p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-3136-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-3136-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3136-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission