miRTarBase - #MIRT444725


—
pre-miRNA Information
pre-miRNA hsa-mir-3133   
Genomic Coordinates chr2: 241477905 - 241477982
Description Homo sapiens miR-3133 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3133
Sequence 10| UAAAGAACUCUUAAAACCCAAU |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1030052469 1 dbSNP
rs955010137 12 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LAMA2   
Synonyms LAMM
Description laminin subunit alpha 2
Transcript NM_000426   
Other Transcripts NM_001079823   
Expression
Putative miRNA Targets on LAMA2
3'UTR of LAMA2
(miRNA target sites are highlighted)		 
>LAMA2|NM_000426|3'UTR
   1 TAAAAATAAGTGTAACCCCAGGAAGAGTCTGTCAAAACAAGTATATCAAGTAAAACAAACAAATATATTTTACCTATATA
  81 TGTTAATTAAACTAATTTGTGCATGTACATAGAATTCTTTCTGTATTCAGATGGTGCTAATTCAGACTCCAGACTGAATT
 161 TTAATTCAAGTTCTTTCTCAAGTCTATAAATAATATTAAACTGATTATTTCATTCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaACCCAAAAUU---CUCAAGAAAu 5'
            ||  ||||||    |||||||| 
Target 5' acTGAATTTTAATTCAAGTTCTTTc 3'
 153 - 177 164.00 -6.10
2 
miRNA  3' uaAC-CCAAAAU---UCUCAAGAAAu 5'
            || |  | ||   ||| |||||| 
Target 5' ttTGTGCATGTACATAGAATTCTTTc 3'
 96 - 121 124.00 -5.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
355308 47 ClinVar
355309 58 ClinVar
355310 61 ClinVar
355311 119 ClinVar
355312 189 ClinVar
355313 205 ClinVar
COSN30629729 8 COSMIC
COSN7689054 14 COSMIC
COSN30465088 17 COSMIC
COSN31506696 22 COSMIC
COSN26982132 27 COSMIC
COSN30107690 52 COSMIC
COSN5273010 58 COSMIC
COSN30191025 96 COSMIC
COSN31524838 113 COSMIC
COSN21334027 157 COSMIC
COSN20103342 194 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764506272 1 dbSNP
rs773563829 4 dbSNP
rs1440991867 5 dbSNP
rs1324974152 7 dbSNP
rs1328934870 11 dbSNP
rs541534425 17 dbSNP
rs1491318065 24 dbSNP
rs760867800 25 dbSNP
rs757699316 26 dbSNP
rs776709087 28 dbSNP
rs1347322409 29 dbSNP
rs779521697 42 dbSNP
rs376934472 47 dbSNP
rs758527299 48 dbSNP
rs780034553 51 dbSNP
rs747246486 52 dbSNP
rs759994977 53 dbSNP
rs765687850 53 dbSNP
rs1486228344 57 dbSNP
rs1049473 58 dbSNP
rs111454788 61 dbSNP
rs140699127 61 dbSNP
rs967051761 61 dbSNP
rs886061058 66 dbSNP
rs1303334760 69 dbSNP
rs1331596292 77 dbSNP
rs1279633660 78 dbSNP
rs918284204 83 dbSNP
rs1360626234 87 dbSNP
rs929740410 100 dbSNP
rs1491511497 104 dbSNP
rs1491463307 105 dbSNP
rs770213087 105 dbSNP
rs1056578429 110 dbSNP
rs1469560370 113 dbSNP
rs1277523762 116 dbSNP
rs1172802446 118 dbSNP
rs1049476 119 dbSNP
rs1184806373 120 dbSNP
rs763361790 124 dbSNP
rs1243604664 127 dbSNP
rs1044561037 128 dbSNP
rs1459801690 133 dbSNP
rs1252920774 134 dbSNP
rs1204754988 138 dbSNP
rs906107476 146 dbSNP
rs1032920306 147 dbSNP
rs1247448520 149 dbSNP
rs1290527363 171 dbSNP
rs1316335867 173 dbSNP
rs1452636102 178 dbSNP
rs1380997247 182 dbSNP
rs957482592 187 dbSNP
rs1297397326 189 dbSNP
rs371188338 189 dbSNP
rs201080256 194 dbSNP
rs1462834232 198 dbSNP
rs1033006133 199 dbSNP
rs1168601680 201 dbSNP
rs1426559766 202 dbSNP
rs886061059 205 dbSNP
rs891828202 214 dbSNP
rs1386000132 216 dbSNP
rs113910634 220 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaacccaaaauucUCAAGAAAu 5'
                       |||||||| 
Target 5' ----------ucaAGUUCUUUc 3'
 		1 - 12
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000421865.2 | 3UTR | UCAAGUUCUUUCUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000421865.2 | 3UTR | UCAAGUUCUUUCUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
174 hsa-miR-3133 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057804 SLC30A7 solute carrier family 30 member 7 2 2
MIRT075401 ZFHX3 zinc finger homeobox 3 2 2
MIRT088350 MAPRE3 microtubule associated protein RP/EB family member 3 2 6
MIRT107288 FAM73B mitoguardin 2 2 2
MIRT141571 ABHD2 abhydrolase domain containing 2 2 2
MIRT161036 CDV3 CDV3 homolog 2 2
MIRT167732 RNF146 ring finger protein 146 8 3
MIRT209559 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT214631 SMAD5 SMAD family member 5 2 8
MIRT258393 KIAA0895 KIAA0895 2 2
MIRT272744 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT309347 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 6
MIRT329705 SCD stearoyl-CoA desaturase 2 2
MIRT336556 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT363351 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT386753 TAOK1 TAO kinase 1 2 2
MIRT441580 EXOC5 exocyst complex component 5 2 2
MIRT441735 SEPT8 septin 8 2 2
MIRT441817 LRRC40 leucine rich repeat containing 40 2 2
MIRT442180 TRIM59 tripartite motif containing 59 2 4
MIRT442277 TLX3 T-cell leukemia homeobox 3 2 2
MIRT442489 TBC1D19 TBC1 domain family member 19 2 2
MIRT443242 ANKRD26 ankyrin repeat domain 26 2 2
MIRT443270 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT444114 CEPT1 choline/ethanolamine phosphotransferase 1 2 2
MIRT444725 LAMA2 laminin subunit alpha 2 2 2
MIRT445346 FAM169A family with sequence similarity 169 member A 2 2
MIRT445693 GJB1 gap junction protein beta 1 2 2
MIRT446051 CDC73 cell division cycle 73 2 2
MIRT447746 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT447955 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT449199 ZNF623 zinc finger protein 623 2 2
MIRT449564 GPC5 glypican 5 2 2
MIRT450938 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT459811 POTED POTE ankyrin domain family member D 2 8
MIRT461692 ZNF426 zinc finger protein 426 2 2
MIRT462014 SNRNP27 small nuclear ribonucleoprotein U4/U6.U5 subunit 27 2 2
MIRT465150 TSC22D2 TSC22 domain family member 2 2 2
MIRT467144 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT474929 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT475118 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT476844 FIGN fidgetin, microtubule severing factor 2 10
MIRT477336 EPHA2 EPH receptor A2 2 2
MIRT477853 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT481113 B2M beta-2-microglobulin 2 2
MIRT481296 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT485094 SLC30A1 solute carrier family 30 member 1 2 4
MIRT491908 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT492458 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT493341 LAPTM4A lysosomal protein transmembrane 4 alpha 2 12
MIRT494771 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT497837 GPR26 G protein-coupled receptor 26 2 2
MIRT497958 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT498445 INO80D INO80 complex subunit D 2 2
MIRT498997 HAT1 histone acetyltransferase 1 2 10
MIRT499257 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT500067 SFT2D2 SFT2 domain containing 2 2 4
MIRT501385 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT503084 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503272 SLC7A5 solute carrier family 7 member 5 2 2
MIRT504341 ASGR2 asialoglycoprotein receptor 2 2 2
MIRT505453 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 6
MIRT505905 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT507917 C7orf60 base methyltransferase of 25S rRNA 2 homolog 2 6
MIRT508174 FRK fyn related Src family tyrosine kinase 2 4
MIRT508287 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT509232 KIF14 kinesin family member 14 2 6
MIRT509481 GNL3L G protein nucleolar 3 like 2 6
MIRT509530 INTU inturned planar cell polarity protein 2 6
MIRT509548 BTLA B and T lymphocyte associated 2 8
MIRT511328 KIAA1522 KIAA1522 2 4
MIRT511427 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 4
MIRT511477 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 4
MIRT512471 CCDC149 coiled-coil domain containing 149 2 2
MIRT512996 SEZ6L seizure related 6 homolog like 2 2
MIRT514755 ACER3 alkaline ceramidase 3 2 8
MIRT515764 KRTAP5-6 keratin associated protein 5-6 2 2
MIRT517392 TBK1 TANK binding kinase 1 2 4
MIRT518720 FTH1 ferritin heavy chain 1 2 2
MIRT521923 PHIP pleckstrin homology domain interacting protein 2 4
MIRT522849 KIAA2022 neurite extension and migration factor 2 4
MIRT522887 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT523153 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT525149 ZNF256 zinc finger protein 256 2 2
MIRT525941 C11orf74 chromosome 11 open reading frame 74 2 2
MIRT526876 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT527366 KRTAP13-2 keratin associated protein 13-2 2 2
MIRT527549 DLGAP5 DLG associated protein 5 2 4
MIRT527604 ANKRD42 ankyrin repeat domain 42 2 2
MIRT527803 KLRD1 killer cell lectin like receptor D1 2 2
MIRT528046 PRKD3 protein kinase D3 2 2
MIRT528397 PGK1 phosphoglycerate kinase 1 2 2
MIRT529673 SLC28A1 solute carrier family 28 member 1 2 2
MIRT530358 HPSE heparanase 2 2
MIRT530908 KIAA1161 myogenesis regulating glycosidase (putative) 2 2
MIRT531169 ZNF333 zinc finger protein 333 2 2
MIRT531438 PAK1 p21 (RAC1) activated kinase 1 2 2
MIRT531562 CENPC1P1 centromere protein C pseudogene 1 1 1
MIRT532783 LDHD lactate dehydrogenase D 2 2
MIRT532848 ZNF699 zinc finger protein 699 2 2
MIRT534287 SLC12A7 solute carrier family 12 member 7 2 2
MIRT535078 PPIG peptidylprolyl isomerase G 2 4
MIRT535968 MFAP3L microfibril associated protein 3 like 2 2
MIRT536163 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT537417 FBXO47 F-box protein 47 2 2
MIRT538665 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT540291 RGR retinal G protein coupled receptor 2 4
MIRT543332 KIAA1456 KIAA1456 2 2
MIRT543392 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT543891 AIMP1 aminoacyl tRNA synthetase complex interacting multifunctional protein 1 2 2
MIRT545609 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT545839 ZNF275 zinc finger protein 275 2 2
MIRT546689 RORA RAR related orphan receptor A 2 4
MIRT547513 MAT2A methionine adenosyltransferase 2A 2 4
MIRT549431 ACVR1 activin A receptor type 1 2 2
MIRT550567 MYC MYC proto-oncogene, bHLH transcription factor 2 4
MIRT552517 ZIC5 Zic family member 5 2 2
MIRT552743 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT552942 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT555752 PDCD10 programmed cell death 10 2 2
MIRT558002 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT559422 ASF1B anti-silencing function 1B histone chaperone 2 2
MIRT560276 SF1 splicing factor 1 2 2
MIRT560713 ZNF324B zinc finger protein 324B 2 2
MIRT561190 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT561817 NUP50 nucleoporin 50 2 2
MIRT562018 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT562847 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT563252 SETD6 SET domain containing 6 2 2
MIRT563978 GCC2 GRIP and coiled-coil domain containing 2 2 2
MIRT564383 BAAT bile acid-CoA:amino acid N-acyltransferase 2 2
MIRT566552 PANK3 pantothenate kinase 3 2 2
MIRT566933 LIN28B lin-28 homolog B 2 2
MIRT566989 LBR lamin B receptor 2 2
MIRT567645 EXT1 exostosin glycosyltransferase 1 2 2
MIRT568268 BICD2 BICD cargo adaptor 2 2 2
MIRT571407 MED4 mediator complex subunit 4 2 2
MIRT571784 PPP2CA protein phosphatase 2 catalytic subunit alpha 2 2
MIRT572437 ATM ATM serine/threonine kinase 2 2
MIRT573613 COX6A1P2 cytochrome c oxidase subunit 6A1 pseudogene 2 2 2
MIRT574289 COX6A1 cytochrome c oxidase subunit 6A1 2 2
MIRT574375 YY1 YY1 transcription factor 2 2
MIRT613142 DSEL dermatan sulfate epimerase-like 2 2
MIRT616661 ORAI1 ORAI calcium release-activated calcium modulator 1 2 2
MIRT619345 SASH1 SAM and SH3 domain containing 1 2 2
MIRT626315 ABCC9 ATP binding cassette subfamily C member 9 2 2
MIRT628235 FAM117B family with sequence similarity 117 member B 2 2
MIRT630452 GTPBP8 GTP binding protein 8 (putative) 2 2
MIRT631013 TMEM30B transmembrane protein 30B 2 2
MIRT637315 FBXO18 F-box protein, helicase, 18 2 2
MIRT640658 FRY FRY microtubule binding protein 2 2
MIRT642081 FUT11 fucosyltransferase 11 2 2
MIRT644607 C17orf77 chromosome 17 open reading frame 77 2 2
MIRT644829 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT652465 TMEM2 transmembrane protein 2 2 2
MIRT657514 HAS2 hyaluronan synthase 2 2 2
MIRT658290 FAM86C1 family with sequence similarity 86 member C1 2 2
MIRT659570 CGGBP1 CGG triplet repeat binding protein 1 2 2
MIRT675457 SRP19 signal recognition particle 19 2 2
MIRT687828 ITGB8 integrin subunit beta 8 2 2
MIRT693550 MYO16 myosin XVI 2 2
MIRT697294 ZNF654 zinc finger protein 654 2 2
MIRT699804 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT704867 CD164 CD164 molecule 2 2
MIRT705309 AVL9 AVL9 cell migration associated 2 2
MIRT705323 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT707180 HOXC4 homeobox C4 2 2
MIRT709331 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT712321 PER2 period circadian clock 2 2 2
MIRT713817 XRCC2 X-ray repair cross complementing 2 2 2
MIRT713854 HHLA2 HERV-H LTR-associating 2 2 2
MIRT717257 SLC44A1 solute carrier family 44 member 1 2 2
MIRT719956 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT725408 KIF6 kinesin family member 6 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3133 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3133 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-mir-3133 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-3133 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3133 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3133 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3133 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission