| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-514b |
| Genomic Coordinates | chrX: 147250151 - 147250230 |
| Description | Homo sapiens miR-514b stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-514b-3p | ||||||||||||
| Sequence | 50| AUUGACACCUCUGUGAGUGGA |70 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |
|---|---|
| Gene Symbol | VNN3 |
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | BC-1 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
| Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
| CLIP-seq Support 1 for dataset GSM796038 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | BC-1 / 4-Thiouridine |
| Location of target site | ENST00000392393.3 | 3UTR | ucaagccauuuuccucug |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22100165 / GSE32109 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
53 hsa-miR-514b-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT241379 | QSER1 | glutamine and serine rich 1 |  |
|
2 | 2 | ||||||
| MIRT444703 | ZNF772 | zinc finger protein 772 | |
|
2 | 2 | ||||||
| MIRT445153 | VNN3 | vanin 3 | |
|
2 | 2 | ||||||
| MIRT446418 | ABHD2 | abhydrolase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT450012 | NPHP3 | nephrocystin 3 | |
|
2 | 2 | ||||||
| MIRT450275 | LMBRD2 | LMBR1 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT456296 | ASH1L | ASH1 like histone lysine methyltransferase | |
|
2 | 2 | ||||||
| MIRT497427 | SEC63 | SEC63 homolog, protein translocation regulator | |
|
2 | 2 | ||||||
| MIRT497573 | PTCHD4 | patched domain containing 4 | |
|
2 | 2 | ||||||
| MIRT497930 | SCO1 | SCO1, cytochrome c oxidase assembly protein | |
|
2 | 2 | ||||||
| MIRT504844 | HAUS3 | HAUS augmin like complex subunit 3 | |
|
2 | 6 | ||||||
| MIRT525184 | ZNF257 | zinc finger protein 257 | |
|
2 | 2 | ||||||
| MIRT526074 | TMEM41B | transmembrane protein 41B | |
|
2 | 2 | ||||||
| MIRT528581 | PTGER3 | prostaglandin E receptor 3 | |
|
2 | 2 | ||||||
| MIRT529572 | IGBP1 | immunoglobulin binding protein 1 | |
|
2 | 4 | ||||||
| MIRT532528 | NDFIP2 | Nedd4 family interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT535625 | NR2E1 | nuclear receptor subfamily 2 group E member 1 | |
|
2 | 4 | ||||||
| MIRT536224 | LRP6 | LDL receptor related protein 6 | |
|
2 | 2 | ||||||
| MIRT536892 | HEPHL1 | hephaestin like 1 | |
|
2 | 2 | ||||||
| MIRT536951 | HAS3 | hyaluronan synthase 3 | |
|
2 | 2 | ||||||
| MIRT539334 | AGPAT5 | 1-acylglycerol-3-phosphate O-acyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT541765 | ROBO2 | roundabout guidance receptor 2 | |
|
2 | 2 | ||||||
| MIRT545082 | ICT1 | mitochondrial ribosomal protein L58 | |
|
2 | 2 | ||||||
| MIRT546399 | SRP9 | signal recognition particle 9 | |
|
2 | 2 | ||||||
| MIRT548872 | CEP55 | centrosomal protein 55 | |
|
2 | 4 | ||||||
| MIRT550702 | TP53RK | TP53 regulating kinase | |
|
2 | 4 | ||||||
| MIRT555944 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT556010 | MYLIP | myosin regulatory light chain interacting protein | |
|
2 | 2 | ||||||
| MIRT557873 | FEM1B | fem-1 homolog B | |
|
2 | 4 | ||||||
| MIRT558905 | CBX5 | chromobox 5 | |
|
2 | 2 | ||||||
| MIRT562059 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT562461 | CORO1C | coronin 1C | |
|
2 | 2 | ||||||
| MIRT565656 | SIX1 | SIX homeobox 1 | |
|
2 | 2 | ||||||
| MIRT567036 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT571580 | TXNIP | thioredoxin interacting protein | |
|
2 | 2 | ||||||
| MIRT613573 | YY2 | YY2 transcription factor | |
|
2 | 2 | ||||||
| MIRT614610 | MVK | mevalonate kinase | |
|
2 | 2 | ||||||
| MIRT615433 | ZFP82 | ZFP82 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT616333 | ZNF699 | zinc finger protein 699 | |
|
2 | 2 | ||||||
| MIRT622846 | PDGFA | platelet derived growth factor subunit A | |
|
2 | 2 | ||||||
| MIRT626308 | ABCC9 | ATP binding cassette subfamily C member 9 | |
|
2 | 2 | ||||||
| MIRT637941 | SIGLEC9 | sialic acid binding Ig like lectin 9 | |
|
2 | 2 | ||||||
| MIRT639156 | LAMTOR3 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 | |
|
2 | 2 | ||||||
| MIRT639691 | NOM1 | nucleolar protein with MIF4G domain 1 | |
|
2 | 2 | ||||||
| MIRT644937 | ATXN3L | ataxin 3 like | |
|
2 | 2 | ||||||
| MIRT648260 | ZNF582 | zinc finger protein 582 | |
|
2 | 2 | ||||||
| MIRT648446 | LEAP2 | liver enriched antimicrobial peptide 2 | |
|
2 | 2 | ||||||
| MIRT651575 | WDR26 | WD repeat domain 26 | |
|
2 | 2 | ||||||
| MIRT666986 | PDPN | podoplanin | |
|
2 | 4 | ||||||
| MIRT691007 | CRTC3 | CREB regulated transcription coactivator 3 | |
|
2 | 2 | ||||||
| MIRT705009 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | |
|
2 | 2 | ||||||
| MIRT705046 | C5orf15 | chromosome 5 open reading frame 15 | |
|
2 | 2 | ||||||
| MIRT710355 | TLL2 | tolloid like 2 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|