miRTarBase - #MIRT445539


—
pre-miRNA Information
pre-miRNA hsa-mir-488   
Genomic Coordinates chr1: 177029363 - 177029445
Synonyms MIRN488, hsa-mir-488, MIR488
Description Homo sapiens miR-488 stem-loop
Comment miR-488-3p cloned in has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-488-3p
Sequence 52| UUGAAAGGCUAUUUCUUGGUC |72
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 1 - 177029390 27229138, 28550310, 29165639, 29233923 MiREDiBase
A-to-I 6 1 - 177029389 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN1079766 12 COSMIC
COSN19660590 16 COSMIC
COSN30190142 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1210074726 7 dbSNP
rs1310911055 17 dbSNP
rs1248997320 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBC1D8   
Synonyms AD3, GRAMD8, HBLP1, TBC1D8A, VRP
Description TBC1 domain family member 8
Transcript NM_001102426   
Expression
Putative miRNA Targets on TBC1D8
3'UTR of TBC1D8
(miRNA target sites are highlighted)		 
>TBC1D8|NM_001102426|3'UTR
   1 CAAGACAGCAGCTGCTATGCACACTGGAGTCCACCATACCAAAGCACGAACCAGACTGTTTCTTGGGGTCAGCCCTAAAC
  81 CGAGATTTCAGTCTACCTTACCAATGGGGCATCTGGCTAAACAACCTGACAAACTGTGGCCAGGGGAACCGACACAACCC
 161 TCAAGCATTTCTATGTATTGAGAATTGTCAGTGCCCTAAGGTATCCATTGGTTCCCTTGATGCCAACTTACAATTTTTAC
 241 CGGATTTGCTGAAATGGGCACTTCTGCTGTGATGCTAGTGTTGATTTTGCTCTCAGATGAACACAATGTCTCATACTAAC
 321 CAAGAAGCAAGAAAAGCCCCATGCTTTCATTTTTCACTTGGAGTGACAATGGGAGAGGTCAGGAATCAAGTTCACTTTCA
 401 AGATCTAAGGGAGTCCACTATCTGTGCAATTGTATTTGGCTTTTTTTTGCACTGTTTCAATGCTGGTAATTGAAACCATT
 481 TTAATATATTTGGTTGTATTCACTTTATATGTCCTTCCAAAAATGTTGTTGTGTACAAACCATGCTTTCAATGTTGGCTT
 561 CCAAGTTTTTTAATAAGAAACTTTTTGTATTTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cugGUUCUUUAUC------GGAAAGUu 5'
             ||||||| ||       |||||| 
Target 5' aagCAAGAAA-AGCCCCATGCTTTCAt 3'
 325 - 350 127.00 -11.90
2 
miRNA  3' cugguUCUUUA--UC--G-GAAAGUu 5'
               ||:|||  ||  | |||||| 
Target 5' aggtcAGGAATCAAGTTCACTTTCAa 3'
 376 - 401 124.00 -14.70
3 
miRNA  3' cugGUUCUUUAUCGGAAAGUu 5'
             |||   ||:  |||||| 
Target 5' gtaCAAACCATG--CTTTCAa 3'
 533 - 551 121.00 -6.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31482354 15 COSMIC
COSN31498439 26 COSMIC
COSN30114309 44 COSMIC
COSN31560564 47 COSMIC
COSN31593092 47 COSMIC
COSN30141568 51 COSMIC
COSN30448209 52 COSMIC
COSN30523118 81 COSMIC
COSN31485161 89 COSMIC
COSN21904790 171 COSMIC
COSN20097003 225 COSMIC
COSN20090601 231 COSMIC
COSN6418077 401 COSMIC
COSN1774163 487 COSMIC
COSN1774161 489 COSMIC
COSN1774159 510 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767976406 9 dbSNP
rs771578429 11 dbSNP
rs199637281 17 dbSNP
rs1225203916 18 dbSNP
rs1025531538 22 dbSNP
rs375440656 25 dbSNP
rs759792023 28 dbSNP
rs1289725157 29 dbSNP
rs749224881 29 dbSNP
rs1192735324 31 dbSNP
rs1350804380 34 dbSNP
rs1376715057 37 dbSNP
rs780083059 39 dbSNP
rs769923428 40 dbSNP
rs745886072 41 dbSNP
rs781524620 47 dbSNP
rs755559831 48 dbSNP
rs1267905716 51 dbSNP
rs1489934242 52 dbSNP
rs1184570314 53 dbSNP
rs1018075069 54 dbSNP
rs1469711296 55 dbSNP
rs186621310 57 dbSNP
rs927832157 61 dbSNP
rs745594288 62 dbSNP
rs945258039 66 dbSNP
rs1032078895 70 dbSNP
rs915202504 71 dbSNP
rs775738054 73 dbSNP
rs769575728 79 dbSNP
rs547941017 81 dbSNP
rs1237713464 82 dbSNP
rs1277266323 95 dbSNP
rs1392956880 95 dbSNP
rs989140324 96 dbSNP
rs1246589408 97 dbSNP
rs534117694 101 dbSNP
rs953746788 102 dbSNP
rs565823881 104 dbSNP
rs540878652 107 dbSNP
rs1395322111 110 dbSNP
rs1167684438 112 dbSNP
rs1471910451 119 dbSNP
rs1239271532 121 dbSNP
rs1445809219 123 dbSNP
rs557029567 126 dbSNP
rs1383878655 128 dbSNP
rs1432033442 131 dbSNP
rs895380344 132 dbSNP
rs1396853666 139 dbSNP
rs1055338270 142 dbSNP
rs1182945126 150 dbSNP
rs140971569 151 dbSNP
rs1452673068 152 dbSNP
rs909329908 153 dbSNP
rs965528967 161 dbSNP
rs1230341730 162 dbSNP
rs1264755305 163 dbSNP
rs1251668664 164 dbSNP
rs777943855 165 dbSNP
rs1194267651 166 dbSNP
rs1004375953 180 dbSNP
rs1280951056 180 dbSNP
rs1183003743 185 dbSNP
rs952956497 189 dbSNP
rs1274527031 198 dbSNP
rs528902382 204 dbSNP
rs1194419111 206 dbSNP
rs929329438 208 dbSNP
rs1013293785 210 dbSNP
rs373122674 211 dbSNP
rs753134705 221 dbSNP
rs1057455634 222 dbSNP
rs1469877137 223 dbSNP
rs569630583 224 dbSNP
rs1335408435 227 dbSNP
rs1403900654 230 dbSNP
rs369643576 231 dbSNP
rs375186762 232 dbSNP
rs1224905719 233 dbSNP
rs550116018 235 dbSNP
rs911110080 240 dbSNP
rs903292890 241 dbSNP
rs1371758567 242 dbSNP
rs1042243026 251 dbSNP
rs533229289 252 dbSNP
rs915130003 255 dbSNP
rs1053714722 257 dbSNP
rs1261589654 260 dbSNP
rs1427127683 262 dbSNP
rs1201385665 269 dbSNP
rs1388530697 275 dbSNP
rs1430977982 278 dbSNP
rs1480556218 279 dbSNP
rs1032111698 283 dbSNP
rs932287447 289 dbSNP
rs1454857272 295 dbSNP
rs1289396206 301 dbSNP
rs564201822 304 dbSNP
rs1325277267 305 dbSNP
rs1159666602 306 dbSNP
rs541254489 308 dbSNP
rs966373777 309 dbSNP
rs1281504128 313 dbSNP
rs1376313865 315 dbSNP
rs1331352347 325 dbSNP
rs1197657740 339 dbSNP
rs1024680294 340 dbSNP
rs1260662799 348 dbSNP
rs755581316 350 dbSNP
rs527485596 355 dbSNP
rs965152202 361 dbSNP
rs1270030304 362 dbSNP
rs150986003 363 dbSNP
rs1198201616 364 dbSNP
rs982878203 369 dbSNP
rs1426712779 373 dbSNP
rs1420367662 376 dbSNP
rs541871512 376 dbSNP
rs1363224944 377 dbSNP
rs183441553 379 dbSNP
rs1165295097 384 dbSNP
rs952883467 387 dbSNP
rs528742122 390 dbSNP
rs1301544717 393 dbSNP
rs1006403071 399 dbSNP
rs754373292 408 dbSNP
rs1342566700 409 dbSNP
rs1315719617 412 dbSNP
rs1013180682 418 dbSNP
rs1293006424 420 dbSNP
rs959242199 422 dbSNP
rs1233770556 424 dbSNP
rs1035677351 426 dbSNP
rs929360524 430 dbSNP
rs1003326102 431 dbSNP
rs923352255 438 dbSNP
rs1305986354 443 dbSNP
rs1177340543 447 dbSNP
rs1432915174 449 dbSNP
rs1364552958 457 dbSNP
rs1319510625 458 dbSNP
rs1165433986 460 dbSNP
rs1040396831 486 dbSNP
rs1423778871 487 dbSNP
rs1161362136 488 dbSNP
rs903262200 491 dbSNP
rs1462674249 492 dbSNP
rs1384442687 502 dbSNP
rs556101538 504 dbSNP
rs1382605819 507 dbSNP
rs1454609736 507 dbSNP
rs766536641 508 dbSNP
rs1435797716 510 dbSNP
rs1308943921 511 dbSNP
rs911151515 513 dbSNP
rs1396490783 514 dbSNP
rs1009365498 515 dbSNP
rs1184835453 522 dbSNP
rs1166347899 525 dbSNP
rs893664613 526 dbSNP
rs1421358035 532 dbSNP
rs1170048504 533 dbSNP
rs138605441 533 dbSNP
rs957859722 533 dbSNP
rs977910831 536 dbSNP
rs1242227436 537 dbSNP
rs1057591 538 dbSNP
rs932563998 542 dbSNP
rs1451071844 559 dbSNP
rs1272334183 567 dbSNP
rs1363136595 573 dbSNP
rs1214306349 574 dbSNP
rs1294421371 575 dbSNP
rs1440609774 577 dbSNP
rs1315606910 578 dbSNP
rs1205086641 580 dbSNP
rs1263201395 581 dbSNP
rs779066141 581 dbSNP
rs921218410 581 dbSNP
rs1243735829 583 dbSNP
rs542971514 583 dbSNP
rs1211328218 584 dbSNP
rs1013280491 587 dbSNP
rs959270159 587 dbSNP
rs577502468 588 dbSNP
rs1481534814 593 dbSNP
rs1033955515 594 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cugguucuuuaucgGAAAGUu 5'
                        |||||| 
Target 5' -----ucaaguucaCUUUCAa 3'
 		1 - 16
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000376840.4 | 3UTR | UCAAGUUCACUUUCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000376840.4 | 3UTR | UCAAGUUCACUUUCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.815 6.2e-7 0.781 3.3e-6 24 Click to see details
GSE28260 Renal cortex and medulla 0.805 4.5e-4 0.721 2.7e-3 13 Click to see details
GSE32688 Pancreatic cancer 0.472 3.2e-3 0.500 1.8e-3 32 Click to see details
GSE21687 Ependynoma primary tumors -0.257 2.0e-2 -0.186 7.1e-2 64 Click to see details
GSE17306 Multiple myeloma -0.191 9.4e-2 0.418 1.4e-3 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.193 1.8e-1 -0.131 2.7e-1 24 Click to see details
GSE38226 Liver fibrosis -0.153 2.5e-1 -0.308 8.7e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.096 3.2e-1 -0.049 4.1e-1 25 Click to see details
GSE21849 B cell lymphoma -0.072 3.6e-1 0.108 2.9e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.118 3.6e-1 -0.035 4.6e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.071 3.8e-1 -0.380 4.9e-2 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.065 3.8e-1 0.156 2.4e-1 23 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.235 4.2e-1 0.500 3.3e-1 3 Click to see details
GSE27834 Pluripotent stem cells 0.035 4.5e-1 -0.259 1.7e-1 16 Click to see details
GSE17498 Multiple myeloma -0.013 4.7e-1 -0.123 2.2e-1 40 Click to see details
GSE17498 Multiple myeloma -0.013 4.7e-1 -0.123 2.2e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.724 0 0.636 0.01 12 Click to see details
HNSC 0.753 0.04 0.543 0.13 6 Click to see details
BRCA 0.361 0.11 0.379 0.1 13 Click to see details
LUSC 0.557 0.13 0.143 0.39 6 Click to see details
PRAD 0.218 0.21 0.106 0.35 16 Click to see details
THCA 0.582 0.21 0.800 0.1 4 Click to see details
KIRP 0.405 0.25 0.100 0.44 5 Click to see details
LIHC -0.182 0.33 0.143 0.37 8 Click to see details
PCPG -0.466 0.35 -0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
ESCA 0.27 0.41 0.500 0.33 3 Click to see details
116 hsa-miR-488-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005899 POMC proopiomelanocortin 3 1
MIRT038008 CYP2E1 cytochrome P450 family 2 subfamily E member 1 1 1
MIRT054483 SLC39A8 solute carrier family 39 member 8 2 1
MIRT058884 C11ORF58 chromosome 11 open reading frame 58 2 2
MIRT061194 MED17 mediator complex subunit 17 2 2
MIRT167237 TMEM167A transmembrane protein 167A 2 2
MIRT188343 ARID1A AT-rich interaction domain 1A 2 2
MIRT218170 MRPL18 mitochondrial ribosomal protein L18 2 2
MIRT218297 C6ORF120 chromosome 6 open reading frame 120 2 2
MIRT263337 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT294633 ZNF548 zinc finger protein 548 2 2
MIRT305053 SRPRB SRP receptor beta subunit 2 6
MIRT306846 FYTTD1 forty-two-three domain containing 1 2 2
MIRT442753 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT443955 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT444032 SYNM synemin 2 2
MIRT444519 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT444569 UNC5C unc-5 netrin receptor C 2 2
MIRT444779 ECE1 endothelin converting enzyme 1 2 2
MIRT445195 FAXC failed axon connections homolog 2 2
MIRT445345 FAM169A family with sequence similarity 169 member A 2 2
MIRT445539 TBC1D8 TBC1 domain family member 8 2 2
MIRT446058 RABIF RAB interacting factor 2 2
MIRT446358 EFCAB6 EF-hand calcium binding domain 6 2 2
MIRT446486 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT446973 CARKD NAD(P)HX dehydratase 2 2
MIRT446984 MOB1B MOB kinase activator 1B 2 2
MIRT446987 TMEM9B TMEM9 domain family member B 2 2
MIRT447376 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT447857 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT448077 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT448970 CBX5 chromobox 5 2 2
MIRT449072 RPS15A ribosomal protein S15a 2 2
MIRT449200 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT449459 HAT1 histone acetyltransferase 1 2 2
MIRT449588 PCDHA6 protocadherin alpha 6 2 2
MIRT449885 ZNF621 zinc finger protein 621 2 2
MIRT449892 C11orf34 placenta expressed transcript 1 1 2
MIRT450669 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT450866 GPR107 G protein-coupled receptor 107 2 2
MIRT450881 EIF6 eukaryotic translation initiation factor 6 2 2
MIRT455373 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT458266 FUT10 fucosyltransferase 10 2 2
MIRT464839 RPS27A ribosomal protein S27a 2 12
MIRT465335 TPM3 tropomyosin 3 2 4
MIRT467939 SLC16A1 solute carrier family 16 member 1 2 2
MIRT468719 SDC4 syndecan 4 2 2
MIRT469844 PXK PX domain containing serine/threonine kinase like 2 8
MIRT474545 KLHDC3 kelch domain containing 3 2 2
MIRT480700 BRPF1 bromodomain and PHD finger containing 1 2 2
MIRT482087 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT491225 KCNA5 potassium voltage-gated channel subfamily A member 5 2 2
MIRT497790 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT497831 GPR26 G protein-coupled receptor 26 2 2
MIRT497910 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 2 2
MIRT498428 DDX39A DExD-box helicase 39A 2 2
MIRT499196 TJAP1 tight junction associated protein 1 2 2
MIRT500396 ZNF281 zinc finger protein 281 2 6
MIRT501523 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT504445 MC2R melanocortin 2 receptor 2 2
MIRT505270 TUBB2A tubulin beta 2A class IIa 2 2
MIRT508584 CCDC115 coiled-coil domain containing 115 2 12
MIRT509269 NPM3 nucleophosmin/nucleoplasmin 3 2 4
MIRT512466 CCDC149 coiled-coil domain containing 149 2 2
MIRT513534 PRDM2 PR/SET domain 2 2 4
MIRT514218 ZNF83 zinc finger protein 83 2 4
MIRT518526 FLCN folliculin 2 6
MIRT524841 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT524855 ARL5B ADP ribosylation factor like GTPase 5B 2 4
MIRT525048 FRK fyn related Src family tyrosine kinase 2 2
MIRT528635 SENP6 SUMO1/sentrin specific peptidase 6 2 2
MIRT529557 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT532319 GHSR growth hormone secretagogue receptor 2 2
MIRT534232 SLC25A16 solute carrier family 25 member 16 2 2
MIRT534254 SLC12A7 solute carrier family 12 member 7 2 2
MIRT536223 LRRC41 leucine rich repeat containing 41 2 2
MIRT537658 ERBB2IP erbb2 interacting protein 2 2
MIRT537795 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT540404 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT544563 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT546045 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT546846 RAB4A RAB4A, member RAS oncogene family 2 2
MIRT548480 EEF2 eukaryotic translation elongation factor 2 2 2
MIRT549337 ARF6 ADP ribosylation factor 6 2 2
MIRT550855 SNAP47 synaptosome associated protein 47 2 4
MIRT551607 ZNF267 zinc finger protein 267 2 2
MIRT553222 TWF1 twinfilin actin binding protein 1 2 2
MIRT553874 SUPT7L SPT7 like, STAGA complex gamma subunit 2 4
MIRT557956 FAM222B family with sequence similarity 222 member B 2 2
MIRT559264 BAG4 BCL2 associated athanogene 4 2 4
MIRT562245 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT563184 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT563834 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563967 RAB6A RAB6A, member RAS oncogene family 2 2
MIRT564808 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT565188 TSHZ1 teashirt zinc finger homeobox 1 2 2
MIRT565549 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT566969 LBR lamin B receptor 2 2
MIRT570926 ZNF284 zinc finger protein 284 2 2
MIRT612283 ZMAT3 zinc finger matrin-type 3 2 2
MIRT612695 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT625293 ZNF619 zinc finger protein 619 2 2
MIRT628496 LINS lines homolog 1 2 2
MIRT640282 FAM169B family with sequence similarity 169 member B 2 2
MIRT647212 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 2
MIRT654668 PSMB5 proteasome subunit beta 5 2 2
MIRT657516 HAS2 hyaluronan synthase 2 2 2
MIRT670337 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT702010 MIDN midnolin 2 2
MIRT704253 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT710205 ENAH ENAH, actin regulator 2 2
MIRT712126 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT714890 COQ10B coenzyme Q10B 2 2
MIRT716588 PAX6 paired box 6 2 2
MIRT720810 CIAO1 cytosolic iron-sulfur assembly component 1 2 2
MIRT724953 AHCY adenosylhomocysteinase 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-488 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-488 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-488 Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-488 Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-488 Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-488 Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-miR-488 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-miR-488 Taxane 9548828 sensitive High Breast Cancer tissue
hsa-miR-488 Doxorubicin 31703 NSC123127 approved sensitive High Anaplastic Thyroid Cancer tissue
hsa-mir-488 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-488 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-miR-488 Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-488 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-488 Doxorubicin 31703 NSC123127 approved resistant cell line (K562)
hsa-miR-488 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-488-3p Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-488-3p Cisplatin 5460033 NSC119875 approved sensitive Low Melanoma cell line (SK-Mel-28)
hsa-miR-488-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-488-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-488-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission