miRTarBase - #MIRT445817


—
pre-miRNA Information
pre-miRNA hsa-mir-449b   
Genomic Coordinates chr5: 55170646 - 55170742
Description Homo sapiens miR-449b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-449b-5p
Sequence 16| AGGCAGUGUAUUGUUAGCUGGC |37
Evidence Experimental
Experiments Microarray
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN8871076 12 COSMIC
COSN17153496 22 COSMIC
COSN31576772 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322925717 3 dbSNP
rs769526811 10 dbSNP
rs10061133 12 dbSNP
rs1431829587 13 dbSNP
rs778042202 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DNAAF3   
Synonyms C19orf51, CILD2, DAB1, PCD, PF22
Description dynein axonemal assembly factor 3
Transcript NM_178837   
Expression
Putative miRNA Targets on DNAAF3
3'UTR of DNAAF3
(miRNA target sites are highlighted)		 
>DNAAF3|NM_178837|3'UTR
   1 CCCAACCCCTAGACACCCCTTATCTCCAACTTCCAAAGTCAGGTTGTAGGATGAGAACCCGCTGATACCATTCTAAGTCC
  81 GCTGCTAGAGTCCTCAATTTTATTCTAATCATTCCCACTCAGTACCCGCCACCCCCACCCCGGGAGTGTTGGTAGACTTT
 161 CAAATTCCATTTCTGAGATTCTATGGTCTATTCCTAGAATTCTAGATTGTTCTCTCAGAATTCCAAATTCCACTTCTGAG
 241 GCTCTAAGCCCAGCCTAGGATCTGACACTGAGTCTCAGGCCCTTGACTTTGGCCCCCTTGTTCCCAGGCACCCTGTGGCT
 321 GACTAGGGGCTGGGGTGTCTCCTCACCAGGGCCTGGTCAGCACCCAGATGGTTCAAGTAAAGCAAGTTGTGTCCACCCTT
 401 C
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cggucGAUUGUUAUGUGACGGa 5'
               |||  |:| |:||||: 
Target 5' ccattCTA--AGTCCGCTGCTa 3'
 68 - 87 121.00 -9.50
2 
miRNA  3' cgGUCGAUUGUUA---UGUGACgga 5'
            ||||  | :||   ||||||   
Target 5' ccCAGCCTAGGATCTGACACTGagt 3'
 249 - 273 120.00 -16.62
3 
miRNA  3' cgGUC-GAUUGUU--AUGUGACGGa 5'
            |||  |  |||  | |||| |: 
Target 5' ctCAGAATTCCAAATTCCACTTCTg 3'
 214 - 238 102.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
330205 28 ClinVar
COSN30500127 9 COSMIC
COSN5762167 26 COSMIC
COSN30453887 60 COSMIC
COSN5268667 60 COSMIC
COSN30508289 65 COSMIC
COSN30508330 67 COSMIC
COSN30508245 70 COSMIC
COSN13836180 81 COSMIC
COSN20807413 88 COSMIC
COSN25897721 127 COSMIC
COSN30525182 128 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752998991 1 dbSNP
rs765312080 2 dbSNP
rs547397454 3 dbSNP
rs1431175274 6 dbSNP
rs1332908231 7 dbSNP
rs376466344 12 dbSNP
rs1191376414 17 dbSNP
rs753688172 18 dbSNP
rs766154848 24 dbSNP
rs201512228 28 dbSNP
rs750337673 29 dbSNP
rs767076467 36 dbSNP
rs1056626335 37 dbSNP
rs1261705988 40 dbSNP
rs761186350 42 dbSNP
rs774056189 43 dbSNP
rs1220214967 44 dbSNP
rs768252759 45 dbSNP
rs568564289 60 dbSNP
rs1477847286 61 dbSNP
rs1172239766 75 dbSNP
rs548048894 80 dbSNP
rs924217578 81 dbSNP
rs1186721415 83 dbSNP
rs531570316 105 dbSNP
rs1044343246 110 dbSNP
rs946376262 115 dbSNP
rs867368084 116 dbSNP
rs1288194609 125 dbSNP
rs530765673 127 dbSNP
rs150804001 128 dbSNP
rs1280121573 129 dbSNP
rs142148946 132 dbSNP
rs1006667799 136 dbSNP
rs1187071480 139 dbSNP
rs532132907 141 dbSNP
rs544757290 142 dbSNP
rs1487999027 147 dbSNP
rs1260613174 151 dbSNP
rs922462089 156 dbSNP
rs1196493752 160 dbSNP
rs1254696244 161 dbSNP
rs540235885 163 dbSNP
rs1474596413 181 dbSNP
rs972600470 207 dbSNP
rs1223565871 221 dbSNP
rs1359698443 232 dbSNP
rs758870525 233 dbSNP
rs1398709078 236 dbSNP
rs961464333 244 dbSNP
rs148658260 254 dbSNP
rs1360957719 260 dbSNP
rs1421381449 269 dbSNP
rs1311002745 270 dbSNP
rs1273514546 292 dbSNP
rs996253144 298 dbSNP
rs1016871020 320 dbSNP
rs1447471813 326 dbSNP
rs1284974494 334 dbSNP
rs1005410944 335 dbSNP
rs1222310084 337 dbSNP
rs1308919385 337 dbSNP
rs1343708417 341 dbSNP
rs1219343689 344 dbSNP
rs1278895386 345 dbSNP
rs1441323585 347 dbSNP
rs1210257089 348 dbSNP
rs1238733449 352 dbSNP
rs369312182 371 dbSNP
rs886054637 374 dbSNP
rs1386709853 382 dbSNP
rs1040886999 386 dbSNP
rs1441389894 389 dbSNP
rs1171673617 390 dbSNP
rs1366188088 391 dbSNP
rs554664741 396 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000371236.2 | 3UTR | UCAAGUUUUUCAACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000371236.2 | 3UTR | UCAAGUUUUUCAACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.333 1.4e-3 0.326 1.7e-3 79 Click to see details
GSE21687 Ependynoma primary tumors 0.334 3.5e-3 0.444 1.2e-4 64 Click to see details
GSE28260 Renal cortex and medulla 0.649 8.2e-3 0.692 4.4e-3 13 Click to see details
GSE19536 Breast cancer 0.209 1.8e-2 0.202 2.2e-2 100 Click to see details
GSE32688 Pancreatic cancer -0.311 4.2e-2 -0.150 2.1e-1 32 Click to see details
GSE28544 Breast cancer 0.277 9.5e-2 0.193 1.8e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.293 1.4e-1 0.450 4.0e-2 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.207 1.9e-1 0.053 4.1e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.093 1.9e-1 -0.069 2.6e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.176 2.0e-1 0.169 2.1e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.266 2.0e-1 0.266 2.0e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.178 2.1e-1 -0.283 9.5e-2 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.133 2.6e-1 0.155 2.3e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.147 2.7e-1 -0.272 1.2e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.127 2.8e-1 0.153 2.4e-1 24 Click to see details
GSE38226 Liver fibrosis 0.117 3.1e-1 0.146 2.6e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.184 3.3e-1 -0.333 2.1e-1 8 Click to see details
GSE21849 B cell lymphoma -0.076 3.5e-1 0.156 2.1e-1 29 Click to see details
GSE17306 Multiple myeloma -0.015 4.6e-1 0.100 2.5e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.846 0 0.810 0.01 8 Click to see details
BRCA -0.933 0.03 -0.800 0.1 4 Click to see details
LUSC 0.762 0.12 0.200 0.4 4 Click to see details
THCA -0.855 0.17 -1.000 0.5 3 Click to see details
THCA -0.855 0.17 -1.000 0.5 3 Click to see details
THCA -0.855 0.17 -1.000 0.5 3 Click to see details
THCA -0.855 0.17 -1.000 0.5 3 Click to see details
THCA -0.855 0.17 -1.000 0.5 3 Click to see details
109 hsa-miR-449b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006349 SIRT1 sirtuin 1 2 1
MIRT006350 CCNE2 cyclin E2 4 3
MIRT006351 MET MET proto-oncogene, receptor tyrosine kinase 2 1
MIRT006352 GMNN geminin, DNA replication inhibitor 2 1
MIRT006353 HDAC1 histone deacetylase 1 2 1
MIRT016137 CDK4 cyclin dependent kinase 4 1 1
MIRT016138 CDC25A cell division cycle 25A 2 1
MIRT016139 CDK6 cyclin dependent kinase 6 4 3
MIRT057740 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT078636 FAM104A family with sequence similarity 104 member A 2 2
MIRT100407 HSPA1B heat shock protein family A (Hsp70) member 1B 2 2
MIRT115552 MAZ MYC associated zinc finger protein 2 2
MIRT130146 TXNIP thioredoxin interacting protein 2 4
MIRT142254 DCTN5 dynactin subunit 5 2 2
MIRT143724 CCL22 C-C motif chemokine ligand 22 2 2
MIRT168101 E2F3 E2F transcription factor 3 2 2
MIRT169809 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT183694 MDM4 MDM4, p53 regulator 2 2
MIRT198922 SMAD4 SMAD family member 4 2 2
MIRT202950 TSN translin 2 4
MIRT221565 CBX3 chromobox 3 2 2
MIRT253418 EVI5L ecotropic viral integration site 5 like 2 2
MIRT294759 ZNF551 zinc finger protein 551 2 4
MIRT307053 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT331273 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT372293 UBXN2B UBX domain protein 2B 2 2
MIRT374317 MBD6 methyl-CpG binding domain protein 6 2 2
MIRT445817 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT447158 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT447823 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT448798 GMFB glia maturation factor beta 2 2
MIRT451580 HIRIP3 HIRA interacting protein 3 2 2
MIRT452679 GPR156 G protein-coupled receptor 156 2 2
MIRT453158 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT453634 SLC4A2 solute carrier family 4 member 2 2 2
MIRT455384 PLA2G2D phospholipase A2 group IID 2 2
MIRT456958 SPAM1 sperm adhesion molecule 1 2 2
MIRT462739 EFNB1 ephrin B1 2 2
MIRT464321 UST uronyl 2-sulfotransferase 2 2
MIRT465641 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 10
MIRT466748 SYNGR2 synaptogyrin 2 2 2
MIRT468345 SF3B3 splicing factor 3b subunit 3 2 2
MIRT469324 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT474361 KMT2D lysine methyltransferase 2D 2 2
MIRT475316 IFNLR1 interferon lambda receptor 1 2 2
MIRT477759 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT477824 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478265 DDX19B DEAD-box helicase 19B 2 2
MIRT481042 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT481289 ATXN1L ataxin 1 like 2 2
MIRT482730 COPZ1 coatomer protein complex subunit zeta 1 2 2
MIRT488780 CYTH3 cytohesin 3 2 2
MIRT489578 SSBP2 single stranded DNA binding protein 2 2 2
MIRT489659 SHMT1 serine hydroxymethyltransferase 1 2 4
MIRT490527 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492949 NEUROD2 neuronal differentiation 2 2 2
MIRT493154 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT493845 FOXN3 forkhead box N3 2 4
MIRT494743 ARHGAP1 Rho GTPase activating protein 1 2 6
MIRT496491 MAST3 microtubule associated serine/threonine kinase 3 2 2
MIRT503312 FICD FIC domain containing 2 4
MIRT503507 ZNF623 zinc finger protein 623 2 2
MIRT504182 FAM127B retrotransposon Gag like 8A 2 2
MIRT505010 ZNF644 zinc finger protein 644 2 2
MIRT505352 TMEM167A transmembrane protein 167A 2 2
MIRT505645 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT505710 SESN2 sestrin 2 2 2
MIRT505777 SATB2 SATB homeobox 2 2 6
MIRT506208 PHF19 PHD finger protein 19 2 2
MIRT506251 PEG10 paternally expressed 10 2 2
MIRT507786 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT508005 BCL2L13 BCL2 like 13 2 4
MIRT508857 ZRSR1 zinc finger CCCH-type, RNA binding motif and serine/arginine rich 1 2 4
MIRT510546 XBP1P1 X-box binding protein 1 pseudogene 1 2 4
MIRT511892 GAS1 growth arrest specific 1 2 6
MIRT512907 UBL4A ubiquitin like 4A 2 2
MIRT513600 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT521241 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT521321 RRAGD Ras related GTP binding D 2 4
MIRT525281 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT528650 RWDD2A RWD domain containing 2A 2 4
MIRT535101 PODXL podocalyxin like 2 2
MIRT547752 KBTBD6 kelch repeat and BTB domain containing 6 2 4
MIRT547865 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT549170 BMP3 bone morphogenetic protein 3 2 2
MIRT550115 SLC35G2 solute carrier family 35 member G2 2 2
MIRT556097 MOAP1 modulator of apoptosis 1 2 2
MIRT557172 HOXA13 homeobox A13 2 2
MIRT557422 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT557931 FAM73A mitoguardin 1 2 2
MIRT568804 VPS37D VPS37D, ESCRT-I subunit 2 2
MIRT571326 TPCN2 two pore segment channel 2 2 2
MIRT572598 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT573437 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT574092 VASN vasorin 2 2
MIRT608688 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT608800 ITGA11 integrin subunit alpha 11 2 4
MIRT610332 SSX5 SSX family member 5 2 2
MIRT613158 DDA1 DET1 and DDB1 associated 1 2 2
MIRT625407 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT636603 CLIC5 chloride intracellular channel 5 2 2
MIRT638573 IER5 immediate early response 5 2 2
MIRT639686 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT677979 ITGB3 integrin subunit beta 3 2 2
MIRT685217 POTED POTE ankyrin domain family member D 2 2
MIRT702570 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT706259 MKLN1 muskelin 1 2 2
MIRT734675 HMGB1 high mobility group box 1 3 0
MIRT736369 HSPA1A heat shock protein family A (Hsp70) member 1A 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-449b Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-449b Doxorubicin approved 31703 Quantitative real-time PCR ovarian carcinoma cell line A2780 cells 22340095 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-449b Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-449b Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-449b-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SUIT-2, CAPAN-1)
hsa-miR-449b-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-449b-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-449b-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-449b-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-449b-5p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-449b-5p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-449b-5p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-449b-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-449b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-449b-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-449b-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-449b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-449b-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-449b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-449b-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-449b-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-449b-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission