pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-8055 |
Genomic Coordinates | chr8: 6622124 - 6622220 |
Description | Homo sapiens miR-8055 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-8055 | |||||||||||||||||||||||||||
Sequence | 65| CUUUGAGCACAUGAGCAGACGGA |87 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ALG14 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | CMS15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_144988 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ALG14 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ALG14 (miRNA target sites are highlighted) |
>ALG14|NM_144988|3'UTR 1 CAAATGGCAACTGACTTCTTTAGAATTTTGCAGTTAACAGTAGTATGTACTCAAATTGGGGGGAAAAAAACCCTACATGT 81 TTCTTGTAAAGGCGTCTGACAGTCCTGAGAATTATTGATGGTAAGGAATAAAAAATGTACAGATGACTCAGTGAAGAAAC 161 TGAGGCTTCTCTTATGAAACAAACATTGATAAACGTAACTACTAAATGTTTATGCCTCTGTAAACCAAATTTCTTTTCTA 241 GATAAAAATATGTATTACTACCTGCAAATTTTCTTCTGGCTGTTTTAGTAGTATTTTTTTTACAGAACTAAATATAGAGT 321 TTGTATGATTAGTAATATTTCCTGTCCTACAGC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | BC-1 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine
PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine
... - Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe. |
Article |
- Gottwein E; Corcoran DL; Mukherjee N; et al. - Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
|
CLIP-seq Support 1 for dataset GSM796037 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-1 / 4-Thiouridine |
Location of target site | ENST00000370205.5 | 3UTR | UCAAGAUCUCAAAAGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM796038 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | BC-1 / 4-Thiouridine |
Location of target site | ENST00000370205.5 | 3UTR | UCAAGAUCUCAAAAGGCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22100165 / GSE32109 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
192 hsa-miR-8055 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT104178 | PHTF2 | putative homeodomain transcription factor 2 | 2 | 6 | ||||||||
MIRT109489 | KLHL15 | kelch like family member 15 | 2 | 2 | ||||||||
MIRT138601 | HIF1A | hypoxia inducible factor 1 alpha subunit | 2 | 2 | ||||||||
MIRT207609 | COX5B | cytochrome c oxidase subunit 5B | 2 | 2 | ||||||||
MIRT246311 | HIST2H2AA3 | histone cluster 2 H2A family member a3 | 2 | 4 | ||||||||
MIRT246323 | HIST2H2AA4 | histone cluster 2 H2A family member a4 | 2 | 4 | ||||||||
MIRT267508 | FEN1 | flap structure-specific endonuclease 1 | 2 | 2 | ||||||||
MIRT271002 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | 2 | 2 | ||||||||
MIRT378038 | SMAD5 | SMAD family member 5 | 2 | 4 | ||||||||
MIRT442382 | CLVS2 | clavesin 2 | 2 | 2 | ||||||||
MIRT443996 | METRN | meteorin, glial cell differentiation regulator | 2 | 4 | ||||||||
MIRT444222 | TMEM136 | transmembrane protein 136 | 2 | 2 | ||||||||
MIRT445870 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | 2 | 2 | ||||||||
MIRT463214 | ZNF131 | zinc finger protein 131 | 2 | 2 | ||||||||
MIRT464523 | UBXN2B | UBX domain protein 2B | 2 | 2 | ||||||||
MIRT471509 | PCGF3 | polycomb group ring finger 3 | 2 | 6 | ||||||||
MIRT474035 | LONRF1 | LON peptidase N-terminal domain and ring finger 1 | 2 | 2 | ||||||||
MIRT481566 | ARIH2 | ariadne RBR E3 ubiquitin protein ligase 2 | 2 | 2 | ||||||||
MIRT485415 | LZIC | leucine zipper and CTNNBIP1 domain containing | 2 | 8 | ||||||||
MIRT485724 | CALM2 | calmodulin 2 | 2 | 2 | ||||||||
MIRT500745 | TNRC6A | trinucleotide repeat containing 6A | 2 | 2 | ||||||||
MIRT502790 | CELSR3 | cadherin EGF LAG seven-pass G-type receptor 3 | 2 | 6 | ||||||||
MIRT503164 | AGO2 | argonaute 2, RISC catalytic component | 2 | 4 | ||||||||
MIRT504842 | HAUS3 | HAUS augmin like complex subunit 3 | 2 | 6 | ||||||||
MIRT506559 | MNX1 | motor neuron and pancreas homeobox 1 | 2 | 4 | ||||||||
MIRT511372 | IKZF3 | IKAROS family zinc finger 3 | 2 | 6 | ||||||||
MIRT522117 | NUDT3 | nudix hydrolase 3 | 2 | 4 | ||||||||
MIRT523755 | FBXO27 | F-box protein 27 | 2 | 4 | ||||||||
MIRT525160 | PGPEP1 | pyroglutamyl-peptidase I | 2 | 4 | ||||||||
MIRT537294 | FZD5 | frizzled class receptor 5 | 2 | 2 | ||||||||
MIRT537493 | FAM168B | family with sequence similarity 168 member B | 2 | 2 | ||||||||
MIRT538375 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | 2 | 2 | ||||||||
MIRT539394 | ADO | 2-aminoethanethiol dioxygenase | 2 | 2 | ||||||||
MIRT544124 | PPIL1 | peptidylprolyl isomerase like 1 | 2 | 2 | ||||||||
MIRT547269 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 2 | ||||||||
MIRT548034 | GOLIM4 | golgi integral membrane protein 4 | 2 | 2 | ||||||||
MIRT551641 | CCDC127 | coiled-coil domain containing 127 | 2 | 2 | ||||||||
MIRT552585 | ZCCHC9 | zinc finger CCHC-type containing 9 | 2 | 2 | ||||||||
MIRT552605 | ZBTB8A | zinc finger and BTB domain containing 8A | 2 | 2 | ||||||||
MIRT554174 | SLC35E2B | solute carrier family 35 member E2B | 2 | 2 | ||||||||
MIRT556914 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | 2 | 2 | ||||||||
MIRT564288 | MED26 | mediator complex subunit 26 | 2 | 2 | ||||||||
MIRT571375 | TTPAL | alpha tocopherol transfer protein like | 2 | 4 | ||||||||
MIRT572009 | HIC2 | HIC ZBTB transcriptional repressor 2 | 2 | 2 | ||||||||
MIRT572339 | CKAP2L | cytoskeleton associated protein 2 like | 2 | 4 | ||||||||
MIRT572612 | CNTLN | centlein | 2 | 2 | ||||||||
MIRT572779 | ZNF277 | zinc finger protein 277 | 2 | 2 | ||||||||
MIRT573258 | DCAF10 | DDB1 and CUL4 associated factor 10 | 2 | 2 | ||||||||
MIRT573353 | PDE3A | phosphodiesterase 3A | 2 | 4 | ||||||||
MIRT573362 | MAP2K6 | mitogen-activated protein kinase kinase 6 | 2 | 2 | ||||||||
MIRT574194 | LMNB1 | lamin B1 | 2 | 2 | ||||||||
MIRT574453 | RPS16 | ribosomal protein S16 | 2 | 2 | ||||||||
MIRT574849 | C12orf73 | chromosome 12 open reading frame 73 | 2 | 2 | ||||||||
MIRT575356 | Zxda | zinc finger, X-linked, duplicated A | 2 | 3 | ||||||||
MIRT612192 | CCDC77 | coiled-coil domain containing 77 | 2 | 2 | ||||||||
MIRT612974 | GGCX | gamma-glutamyl carboxylase | 2 | 2 | ||||||||
MIRT613749 | UNKL | unkempt family like zinc finger | 2 | 2 | ||||||||
MIRT614085 | PDE4C | phosphodiesterase 4C | 2 | 2 | ||||||||
MIRT614405 | ADAT1 | adenosine deaminase, tRNA specific 1 | 2 | 2 | ||||||||
MIRT614441 | WDR92 | WD repeat domain 92 | 2 | 2 | ||||||||
MIRT614518 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 2 | ||||||||
MIRT614653 | NIPAL3 | NIPA like domain containing 3 | 2 |