>SLC10A3|NM_001142391|3'UTR
   1 GGCCTCTGGGTCAAGCTTTCATCAGCCCCAGCCCCCACACTCCACCAAAGTTCTCATGCACTATGCACTCAGAAAAATCC
  81 AGGCTTATTTTTTTTACTGATTTTTTATTCTCCAGCTTTCAGTGCCAAAGAGGCCATGCTGAGTTAGGTAGGTGGGCGCT
 161 GCCCAGAAAATATATTTCAATAAAAGAGAGAAGCAAGCTTGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uguCCGGAG---------GACGGGAGUCGGGu 5' |||||| || :| ||||||| Target 5' ---GGCCTCTGGGTCAAGCTTTCATCAGCCCc 3'	1 - 29	156.00	-23.70
2	miRNA 3' uguccGGAGGACGGGAGUCGGGu 5' :|||| ||::||||: | Target 5' tttatTCTCCAGCTTTCAGTGCc 3'	104 - 126	122.00	-21.20
3	miRNA 3' uguccggaggacgggaGUCGGGu 5' | |||| Target 5' gttaggtaggtgggcgCTGCCCa 3'	143 - 165	88.00	-16.60

Mutant ID	Mutant Position	Mutant Source
rs1235261375	7	dbSNP
rs1293943985	8	dbSNP
rs1328779348	16	dbSNP
rs782656612	26	dbSNP
rs1262274110	32	dbSNP
rs782503551	36	dbSNP
rs781846179	45	dbSNP
rs782715086	51	dbSNP
rs11550365	53	dbSNP
rs1476126565	69	dbSNP
rs1188079627	70	dbSNP
rs369220311	75	dbSNP
rs782699594	87	dbSNP
rs1416949247	98	dbSNP
rs1160925403	101	dbSNP
rs782120525	102	dbSNP
rs1454681098	106	dbSNP
rs1312621177	119	dbSNP
rs1048969	130	dbSNP
rs1374205346	130	dbSNP
rs1417111936	136	dbSNP
rs1313576141	158	dbSNP
rs1372614335	170	dbSNP
rs1222136186	172	dbSNP
rs1309496067	173	dbSNP
rs1317720910	174	dbSNP
rs1232306524	186	dbSNP
rs1277870497	192	dbSNP

- Cell host & microbe, 2011

Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.