miRTarBase - #MIRT445970


—
pre-miRNA Information
pre-miRNA hsa-mir-4476   
Genomic Coordinates chr9: 36893462 - 36893531
Description Homo sapiens miR-4476 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4476
Sequence 45| CAGGAAGGAUUUAGGGACAGGC |66
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 9 - 36893482 29233923 MiREDiBase
A-to-I 9 9 - 36893479 29233923 MiREDiBase
A-to-I 13 9 - 36893475 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs978640498 3 dbSNP
rs1019792440 6 dbSNP
rs1008364367 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IKZF5
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cggacagGGAUUUA---GGAAGGAc 5'
                 :| |:||   ::||||| 
Target 5' -------UCAAGAUUCCUUUUCCU- 3'
 		1 - 17
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000368886.5 | 3UTR | UCAAGAUUCCUUUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000368886.5 | 3UTR | UCAAGAUUCCUUUUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
152 hsa-miR-4476 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT065631 CLIC4 chloride intracellular channel 4 2 2
MIRT076187 GID4 GID complex subunit 4 homolog 2 4
MIRT086304 HOXD8 homeobox D8 2 6
MIRT110644 ARID5B AT-rich interaction domain 5B 2 2
MIRT144337 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT196634 TAOK1 TAO kinase 1 2 6
MIRT227655 SET SET nuclear proto-oncogene 2 2
MIRT263546 PPIF peptidylprolyl isomerase F 2 4
MIRT266189 TXNIP thioredoxin interacting protein 2 4
MIRT266815 SLC25A44 solute carrier family 25 member 44 2 2
MIRT285538 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT295094 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT300906 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT304110 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 6
MIRT314891 RGMB repulsive guidance molecule family member b 2 2
MIRT364225 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT366237 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT405440 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT443613 OR2D2 olfactory receptor family 2 subfamily D member 2 2 2
MIRT445947 SCML4 Scm polycomb group protein like 4 2 2
MIRT445957 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT445970 IKZF5 IKAROS family zinc finger 5 2 2
MIRT448066 MMP15 matrix metallopeptidase 15 2 2
MIRT449498 ZBTB4 zinc finger and BTB domain containing 4 2 2
MIRT450831 IFFO1 intermediate filament family orphan 1 2 2
MIRT451270 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451318 LGALS3BP galectin 3 binding protein 2 2
MIRT451403 FARSA phenylalanyl-tRNA synthetase alpha subunit 2 2
MIRT451941 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452028 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452503 HMGXB3 HMG-box containing 3 2 2
MIRT453852 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454523 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455402 PLA2G2F phospholipase A2 group IIF 2 2
MIRT455442 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT456983 MANEA mannosidase endo-alpha 2 2
MIRT457610 IDS iduronate 2-sulfatase 2 2
MIRT458319 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458756 CES2 carboxylesterase 2 2 2
MIRT458960 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT460403 GPHA2 glycoprotein hormone alpha 2 2 2
MIRT460632 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461760 DDX11 DEAD/H-box helicase 11 2 2
MIRT461924 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT461977 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462271 TPI1 triosephosphate isomerase 1 2 2
MIRT462304 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT462725 SEMA4G semaphorin 4G 2 2
MIRT463414 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463525 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464089 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464623 UBE4B ubiquitination factor E4B 2 2
MIRT465030 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465562 TOB2 transducer of ERBB2, 2 2 2
MIRT465890 TMEM43 transmembrane protein 43 2 2
MIRT466428 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466593 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467623 SLC7A5 solute carrier family 7 member 5 2 2
MIRT468511 SESN2 sestrin 2 2 2
MIRT468649 SEH1L SEH1 like nucleoporin 2 2
MIRT468737 SDC4 syndecan 4 2 2
MIRT468752 SDC2 syndecan 2 2 2
MIRT469182 RNF111 ring finger protein 111 2 2
MIRT469476 REEP5 receptor accessory protein 5 2 2
MIRT472078 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT472093 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT472194 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472453 NAV2 neuron navigator 2 2 6
MIRT474493 KLHDC8B kelch domain containing 8B 2 2
MIRT475174 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475350 IFNLR1 interferon lambda receptor 1 2 2
MIRT476474 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT477094 FAM168A family with sequence similarity 168 member A 2 2
MIRT477179 F3 coagulation factor III, tissue factor 2 6
MIRT478026 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT479587 CDC42SE1 CDC42 small effector 1 2 2
MIRT480117 CALR calreticulin 2 2
MIRT480465 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT480803 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT481076 B4GALT1 beta-1,4-galactosyltransferase 1 2 2
MIRT482576 ABHD2 abhydrolase domain containing 2 2 2
MIRT482690 NXN nucleoredoxin 2 4
MIRT483599 SLC26A9 solute carrier family 26 member 9 2 2
MIRT485011 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT488051 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488067 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488176 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488859 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489074 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT489181 ANKRD45 ankyrin repeat domain 45 2 2
MIRT489981 DDB1 damage specific DNA binding protein 1 2 2
MIRT490225 WRN Werner syndrome RecQ like helicase 2 2
MIRT491084 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT491540 HDAC5 histone deacetylase 5 2 2
MIRT492540 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT499034 MAG myelin associated glycoprotein 2 2
MIRT499420 PLCG2 phospholipase C gamma 2 2 4
MIRT499820 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT500046 SDE2 SDE2 telomere maintenance homolog 2 6
MIRT500844 SYPL1 synaptophysin like 1 2 4
MIRT504518 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT505622 SLC25A37 solute carrier family 25 member 37 2 2
MIRT509134 STK4 serine/threonine kinase 4 2 2
MIRT509219 BUB3 BUB3, mitotic checkpoint protein 2 4
MIRT510752 SLC7A1 solute carrier family 7 member 1 2 2
MIRT512115 CREBZF CREB/ATF bZIP transcription factor 2 2
MIRT512317 ACTR2 ARP2 actin related protein 2 homolog 2 6
MIRT517395 BGN biglycan 2 4
MIRT518412 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 4
MIRT521362 RPL35A ribosomal protein L35a 2 2
MIRT525072 FRK fyn related Src family tyrosine kinase 2 2
MIRT525800 SOD2 superoxide dismutase 2 2 2
MIRT530430 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT541467 AURKA aurora kinase A 2 2
MIRT544303 TSPYL1 TSPY like 1 2 2
MIRT546415 SPRED3 sprouty related EVH1 domain containing 3 2 2
MIRT546582 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT548764 CNN3 calponin 3 2 2
MIRT549809 KIAA0391 KIAA0391 2 2
MIRT550611 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT552227 FIG4 FIG4 phosphoinositide 5-phosphatase 2 4
MIRT554008 SPTLC1 serine palmitoyltransferase long chain base subunit 1 2 2
MIRT554116 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT555100 PURB purine rich element binding protein B 2 2
MIRT560290 HRH2 histamine receptor H2 2 2
MIRT560381 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT560800 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT560978 IWS1 IWS1, SUPT6H interacting protein 2 2
MIRT561161 BCL2L12 BCL2 like 12 2 2
MIRT562389 EN2 engrailed homeobox 2 2 2
MIRT562482 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT567784 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568831 TRIM67 tripartite motif containing 67 2 2
MIRT569555 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT572382 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT575792 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT610505 CTBS chitobiase 2 4
MIRT616605 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT621780 TMEM87B transmembrane protein 87B 2 2
MIRT634217 TMEM192 transmembrane protein 192 2 2
MIRT639651 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 2 2
MIRT642500 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT643217 TYW3 tRNA-yW synthesizing protein 3 homolog 2 4
MIRT674822 KCNJ10 potassium voltage-gated channel subfamily J member 10 2 2
MIRT697356 ZNF426 zinc finger protein 426 2 2
MIRT704675 CHTOP chromatin target of PRMT1 2 2
MIRT708704 TFDP2 transcription factor Dp-2 2 2
MIRT709660 DFFB DNA fragmentation factor subunit beta 2 2
MIRT711280 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 2 2
MIRT713733 SUCO SUN domain containing ossification factor 2 2
MIRT715006 TSPAN11 tetraspanin 11 2 2
MIRT718400 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4476 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4476 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4476 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4476 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-mir-4476 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-4476 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4476 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-4476 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4476 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-4476 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4476 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission