miRTarBase - #MIRT446042


—
pre-miRNA Information
pre-miRNA hsa-mir-3179-1   
Genomic Coordinates chr16: 14901508 - 14901591
Description Homo sapiens miR-3179-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-2   
Genomic Coordinates chr16: 16300159 - 16300242
Description Homo sapiens miR-3179-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-3   
Genomic Coordinates chr16: 18411894 - 18411977
Description Homo sapiens miR-3179-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-4   
Genomic Coordinates chr16: 18494493 - 18494576
Description Homo sapiens miR-3179-4 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-3179
Sequence 52| AGAAGGGGUGAAAUUUAAACGU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1351100204 1 dbSNP
rs1398613616 4 dbSNP
rs1340262765 20 dbSNP
rs1229893475 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HMCN1   
Synonyms ARMD1, FBLN6, FIBL-6, FIBL6
Description hemicentin 1
Transcript NM_031935   
Expression
Putative miRNA Targets on HMCN1
3'UTR of HMCN1
(miRNA target sites are highlighted)		 
>HMCN1|NM_031935|3'UTR
   1 GGAACTCTCCAAAGCCTATTCCACATATTTAAACCGCATTAATCATGGCAATCAAGCCCCCTTCCAGATTACTGTCTCTT
  81 GAACAGTTGCAATCTTGGCAGCTTGAAAATGGTGCTACACTCTGTTTTGTGTGCCTTCCTTGGTACTTCTGAGGTATTTT
 161 CATGATCCCACCATGGTCATATCTTGAAGTATGGTCTAGAAAAGTCCCTTATTATTTTATTTATTACACTGGAGCAGTTA
 241 CTTCCCAAAGATTATTCTGAACATCTAACAGGACATATCAGTGATGGTTTACAGTAGTGTAGTACCTAAGATCATTTTCC
 321 TGAAAGCCAAACCAAACAACGAAAAACAAGAACAACTAATTCAGAATCAAATAGAGTTTTTGAGCATTTGACTATTTTTA
 401 GAATCATAAAATTAGTTACTAAGTATTTTGATCAAAGCTTATAAAATAACTTACGGAGATTTTTGTAAGTATTGATACAT
 481 TATAATAGGACTTGCCTATTTTCATTTTTAAGAAGAAAAACACCACTCATTTTATAAAATATAGTACAGCTACTATAAGG
 561 CTTGTTTGATCCCAAATGGTGCTTATCTTGATTGAACATTCAGAACAAGGATATTATTTTCAGTGATTTTGTGAGATCAG
 641 CTGAACCACTTATGATAATAATAATAAAAAAGACTGCTTTGCCCTCACGTCAGTTGTACATGGCATGGAACTTTAAAAAT
 721 TTTAATATAAACTTTCATCCAGTTAGCTTCATAACTTTTACGTTCCAGAATTTTGTTTATTTTCCTGTCAATGAAAGCAA
 801 TTTTTAAAGATACCAGTGGGACAGGTTTGGTTTTTTAAAAATCTCATGTGTTCAAATTAACATAAATATTACACGTCAAT
 881 ACACTGTACATGGTGGTAATAGACTCTAAGCAATTGCCAAGATGTATTCTATTTTTATGAAGTGTATATATATTACCTTA
 961 GTGTGCATTTTCTATATAATATCTTGATGGACTCTTTTATAAAATTATTTTATAAAAAACAATGTTACACTAAAATCAGC
1041 CTAAATAAATTTTCACAACTTTTTTTCATAACCTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcaAAUU--UA----AAGU---GGGGAAGa 5'
              ||||  ||     |||   ||||||| 
Target 5' cgcaTTAATCATGGCAATCAAGCCCCCTTCc 3'
 35 - 65 146.00 -12.47
2 
miRNA  3' ugCAAAUUUAAAGUGGGGAAga 5'
            || ||:|    ::|||||  
Target 5' tgGTCTAGA-AAAGTCCCTTat 3'
 192 - 212 111.00 -8.10
3 
miRNA  3' ugCAAAUUUAAAGUGGGGAAga 5'
            |||| :  | | ::||||  
Target 5' ctGTTTTGTGTGCCTTCCTTgg 3'
 122 - 143 104.00 -7.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
294315 19 ClinVar
294316 93 ClinVar
294317 117 ClinVar
875086 224 ClinVar
294318 235 ClinVar
294319 328 ClinVar
294320 397 ClinVar
876025 419 ClinVar
294321 423 ClinVar
876026 589 ClinVar
294322 655 ClinVar
876027 670 ClinVar
294323 675 ClinVar
876028 690 ClinVar
294324 769 ClinVar
294325 772 ClinVar
294326 831 ClinVar
294327 873 ClinVar
294328 885 ClinVar
294329 903 ClinVar
294330 928 ClinVar
294331 938 ClinVar
294332 983 ClinVar
COSN15624495 3 COSMIC
COSN30493829 5 COSMIC
COSN30145951 17 COSMIC
COSN4745523 34 COSMIC
COSN13501061 37 COSMIC
COSN26978999 49 COSMIC
COSN30497573 91 COSMIC
COSN30180068 111 COSMIC
COSN29426155 152 COSMIC
COSN31603581 153 COSMIC
COSN20647175 155 COSMIC
COSN31524713 186 COSMIC
COSN25796266 230 COSMIC
COSN15091667 398 COSMIC
COSN29288078 541 COSMIC
COSN31527638 678 COSMIC
COSN14959668 689 COSMIC
COSN8966779 720 COSMIC
COSN21706277 722 COSMIC
COSN29338381 753 COSMIC
COSN24571113 763 COSMIC
COSN31571792 831 COSMIC
COSN29498663 880 COSMIC
COSN30161366 1009 COSMIC
COSN16967063 1036 COSMIC
COSN15242968 1041 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1388779767 1 dbSNP
rs753712329 3 dbSNP
rs1309057643 4 dbSNP
rs759357384 6 dbSNP
rs1408597818 7 dbSNP
rs765223486 10 dbSNP
rs752188015 12 dbSNP
rs1244832422 14 dbSNP
rs1283259758 17 dbSNP
rs1356893211 18 dbSNP
rs202061344 19 dbSNP
rs1230122939 23 dbSNP
rs1275176660 26 dbSNP
rs1241081597 28 dbSNP
rs1482599752 30 dbSNP
rs1374079806 31 dbSNP
rs778979608 36 dbSNP
rs558323454 37 dbSNP
rs1443093573 39 dbSNP
rs1186988781 42 dbSNP
rs781380486 47 dbSNP
rs761317240 49 dbSNP
rs1169450857 50 dbSNP
rs554812700 52 dbSNP
rs1428145043 53 dbSNP
rs917883729 59 dbSNP
rs573291494 60 dbSNP
rs112985425 61 dbSNP
rs746012600 64 dbSNP
rs981470630 73 dbSNP
rs895946579 87 dbSNP
rs1274177624 88 dbSNP
rs540014337 92 dbSNP
rs558737295 93 dbSNP
rs1260313414 96 dbSNP
rs140486567 98 dbSNP
rs1187326993 100 dbSNP
rs963113511 103 dbSNP
rs1272780640 112 dbSNP
rs188003881 113 dbSNP
rs1366722882 117 dbSNP
rs397961020 117 dbSNP
rs1050755301 120 dbSNP
rs1320724765 128 dbSNP
rs1028626587 144 dbSNP
rs890744526 145 dbSNP
rs1476530328 153 dbSNP
rs953166455 157 dbSNP
rs1313948222 161 dbSNP
rs1436735703 162 dbSNP
rs1168657542 177 dbSNP
rs562457696 181 dbSNP
rs987373238 190 dbSNP
rs1006553121 204 dbSNP
rs761154748 205 dbSNP
rs1172261019 206 dbSNP
rs1419043521 207 dbSNP
rs1374955727 212 dbSNP
rs769259028 214 dbSNP
rs764216904 216 dbSNP
rs1487148108 220 dbSNP
rs1019271976 221 dbSNP
rs1211495188 228 dbSNP
rs1376011074 232 dbSNP
rs1443694595 233 dbSNP
rs564259144 235 dbSNP
rs1218091129 250 dbSNP
rs898395951 253 dbSNP
rs995319333 258 dbSNP
rs1217182791 266 dbSNP
rs956661370 277 dbSNP
rs1294499649 284 dbSNP
rs887201983 291 dbSNP
rs1327630561 296 dbSNP
rs1357539412 301 dbSNP
rs1333626928 305 dbSNP
rs866497793 308 dbSNP
rs1013584383 309 dbSNP
rs150440473 322 dbSNP
rs541810746 328 dbSNP
rs915105864 341 dbSNP
rs777224574 342 dbSNP
rs1188627113 351 dbSNP
rs1235613459 351 dbSNP
rs1473756597 351 dbSNP
rs1208831537 353 dbSNP
rs947446040 363 dbSNP
rs1437833352 367 dbSNP
rs1282841875 373 dbSNP
rs1196348968 384 dbSNP
rs1349235760 390 dbSNP
rs1317746225 392 dbSNP
rs886045694 397 dbSNP
rs766890397 405 dbSNP
rs1235479581 408 dbSNP
rs1210743711 415 dbSNP
rs927275993 416 dbSNP
rs756210638 419 dbSNP
rs1329621695 420 dbSNP
rs140343074 420 dbSNP
rs958290029 420 dbSNP
rs1448860828 422 dbSNP
rs145533442 423 dbSNP
rs945779404 431 dbSNP
rs896052373 440 dbSNP
rs1411537866 441 dbSNP
rs1181200768 449 dbSNP
rs1470247311 453 dbSNP
rs190698095 455 dbSNP
rs571538996 456 dbSNP
rs751145115 459 dbSNP
rs1457064373 460 dbSNP
rs1395416084 465 dbSNP
rs1434055439 466 dbSNP
rs1224245937 469 dbSNP
rs1320291828 474 dbSNP
rs1036517201 475 dbSNP
rs532654220 479 dbSNP
rs942386711 486 dbSNP
rs550904711 489 dbSNP
rs1170800802 492 dbSNP
rs1387010115 496 dbSNP
rs1307218967 497 dbSNP
rs1446068168 510 dbSNP
rs1372013015 514 dbSNP
rs1328091971 515 dbSNP
rs1400851127 520 dbSNP
rs1438421824 524 dbSNP
rs1347885033 525 dbSNP
rs899352496 536 dbSNP
rs1401186403 543 dbSNP
rs994551187 554 dbSNP
rs568909011 555 dbSNP
rs1039349612 570 dbSNP
rs1438471737 573 dbSNP
rs1029168553 589 dbSNP
rs888906085 591 dbSNP
rs1192558010 600 dbSNP
rs1372119377 602 dbSNP
rs1233987777 608 dbSNP
rs1487738122 609 dbSNP
rs536206852 609 dbSNP
rs554960119 611 dbSNP
rs1008978817 613 dbSNP
rs1046883154 623 dbSNP
rs1165119155 625 dbSNP
rs1216908555 627 dbSNP
rs886981999 632 dbSNP
rs1284433813 636 dbSNP
rs1353461869 644 dbSNP
rs184234281 647 dbSNP
rs777875926 652 dbSNP
rs1013365412 655 dbSNP
rs1303748792 655 dbSNP
rs886045695 655 dbSNP
rs1025508284 658 dbSNP
rs534329426 660 dbSNP
rs1283570913 662 dbSNP
rs1463739746 666 dbSNP
rs905258094 669 dbSNP
rs1362390315 670 dbSNP
rs577673255 670 dbSNP
rs1056456 675 dbSNP
rs1395141063 687 dbSNP
rs967856853 689 dbSNP
rs978833235 690 dbSNP
rs1423972902 700 dbSNP
rs927360610 714 dbSNP
rs1365524947 726 dbSNP
rs767246338 756 dbSNP
rs958282885 757 dbSNP
rs937479801 762 dbSNP
rs188736523 763 dbSNP
rs1208059316 768 dbSNP
rs560234419 769 dbSNP
rs201927661 772 dbSNP
rs886045696 772 dbSNP
rs771489073 776 dbSNP
rs987640639 779 dbSNP
rs940902323 785 dbSNP
rs912320394 787 dbSNP
rs1342127411 790 dbSNP
rs1036620391 791 dbSNP
rs1399290493 792 dbSNP
rs1402779013 795 dbSNP
rs556446998 803 dbSNP
rs899300159 808 dbSNP
rs1386627778 811 dbSNP
rs1464058652 819 dbSNP
rs1358226068 825 dbSNP
rs628748 826 dbSNP
rs1050656460 830 dbSNP
rs1193621582 831 dbSNP
rs146952459 831 dbSNP
rs1240342823 832 dbSNP
rs1258810507 836 dbSNP
rs1482928853 837 dbSNP
rs886045697 837 dbSNP
rs1436229436 839 dbSNP
rs755370308 847 dbSNP
rs192128290 849 dbSNP
rs1319784410 855 dbSNP
rs541425691 856 dbSNP
rs1008676971 862 dbSNP
rs1217740669 871 dbSNP
rs746238036 873 dbSNP
rs374240950 875 dbSNP
rs887013012 876 dbSNP
rs949245184 880 dbSNP
rs753718697 885 dbSNP
rs1022175325 886 dbSNP
rs905288233 887 dbSNP
rs1170434946 890 dbSNP
rs1397622988 890 dbSNP
rs1458679961 891 dbSNP
rs1002257466 894 dbSNP
rs1186031265 900 dbSNP
rs886045698 903 dbSNP
rs1251300929 904 dbSNP
rs1180546064 907 dbSNP
rs1456631675 907 dbSNP
rs1054197458 912 dbSNP
rs1002442939 916 dbSNP
rs1197788066 920 dbSNP
rs886045699 928 dbSNP
rs1267205439 930 dbSNP
rs1242484334 932 dbSNP
rs1320633740 933 dbSNP
rs41317509 938 dbSNP
rs1448286238 942 dbSNP
rs545918862 944 dbSNP
rs1009561562 945 dbSNP
rs1207855953 945 dbSNP
rs1387775620 948 dbSNP
rs565130377 952 dbSNP
rs1162019375 953 dbSNP
rs1457871670 962 dbSNP
rs1381421887 975 dbSNP
rs992936850 977 dbSNP
rs917217920 981 dbSNP
rs886045700 983 dbSNP
rs1194494264 985 dbSNP
rs1379996851 985 dbSNP
rs532617561 989 dbSNP
rs1452010906 990 dbSNP
rs1269161724 991 dbSNP
rs549729366 994 dbSNP
rs1180938523 1004 dbSNP
rs1207800198 1004 dbSNP
rs1488128937 1005 dbSNP
rs1286575700 1006 dbSNP
rs1241689113 1007 dbSNP
rs1350855400 1013 dbSNP
rs1009493978 1014 dbSNP
rs1233480724 1014 dbSNP
rs1308143468 1014 dbSNP
rs1363710727 1015 dbSNP
rs1409630296 1024 dbSNP
rs1017739755 1026 dbSNP
rs964137537 1029 dbSNP
rs879822896 1030 dbSNP
rs1164998456 1045 dbSNP
rs1416788833 1055 dbSNP
rs1418007041 1060 dbSNP
rs975230293 1060 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcaaauuuaaAGU---GGGGAAGa 5'
                     |||   ||||||| 
Target 5' -----------UCAAGCCCCCUUCc 3'
 		1 - 14
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000367492.2 | 3UTR | UCAAGCCCCCUUCCAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
133 hsa-miR-3179 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102087 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT110061 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 6
MIRT112198 BTG2 BTG anti-proliferation factor 2 2 2
MIRT117668 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT146657 MINK1 misshapen like kinase 1 2 2
MIRT175505 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT180535 TXNIP thioredoxin interacting protein 2 2
MIRT190624 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190650 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT366902 NONO non-POU domain containing octamer binding 2 2
MIRT443554 ZFP3 ZFP3 zinc finger protein 2 2
MIRT445953 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT446042 HMCN1 hemicentin 1 2 2
MIRT447968 MSH6 mutS homolog 6 2 2
MIRT448634 ONECUT1 one cut homeobox 1 2 2
MIRT449316 MRO maestro 2 2
MIRT451380 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451547 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451807 CDCA3 cell division cycle associated 3 2 4
MIRT451916 ILK integrin linked kinase 2 2
MIRT451938 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452189 KIAA1456 KIAA1456 2 2
MIRT452498 HMGXB3 HMG-box containing 3 2 2
MIRT452548 ZNF467 zinc finger protein 467 2 2
MIRT453844 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454515 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455363 KDM5C lysine demethylase 5C 2 2
MIRT455455 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455628 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455639 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT455690 GLO1 glyoxalase I 2 2
MIRT456300 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT456784 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT456819 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457566 ZNF34 zinc finger protein 34 2 2
MIRT457604 IDS iduronate 2-sulfatase 2 2
MIRT458236 NXPH3 neurexophilin 3 2 2
MIRT458313 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458350 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458670 GPR35 G protein-coupled receptor 35 2 2
MIRT459675 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT461126 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461918 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462301 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463520 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464378 URM1 ubiquitin related modifier 1 2 2
MIRT464614 UBE4B ubiquitination factor E4B 2 2
MIRT464711 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465520 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465974 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466058 TMEM189 transmembrane protein 189 2 2
MIRT466548 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466647 TAGLN2 transgelin 2 2 2
MIRT467357 SP2 Sp2 transcription factor 2 2
MIRT468744 SDC2 syndecan 2 2 2
MIRT470244 PRRC2A proline rich coiled-coil 2A 2 2
MIRT471426 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471732 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472190 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472450 NAV2 neuron navigator 2 2 6
MIRT474563 KLHDC3 kelch domain containing 3 2 2
MIRT474936 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475165 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475399 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475426 ICK intestinal cell kinase 2 2
MIRT477090 FAM168A family with sequence similarity 168 member A 2 2
MIRT478458 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478953 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480096 CALR calreticulin 2 2
MIRT481924 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT483217 APOA1 apolipoprotein A1 2 6
MIRT483882 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483923 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483942 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484512 SYT7 synaptotagmin 7 2 2
MIRT484709 RNF11 ring finger protein 11 2 2
MIRT485356 MYO1C myosin IC 2 4
MIRT485615 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT486584 ZNF619 zinc finger protein 619 2 2
MIRT487013 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487621 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487801 GPR20 G protein-coupled receptor 20 2 4
MIRT488134 GPR107 G protein-coupled receptor 107 2 2
MIRT488773 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT488854 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489783 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490102 FN3K fructosamine 3 kinase 2 2
MIRT490389 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490434 MYL9 myosin light chain 9 2 2
MIRT490451 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490880 OSBP oxysterol binding protein 2 2
MIRT491037 ALPK3 alpha kinase 3 2 2
MIRT491250 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491748 SEMA3F semaphorin 3F 2 2
MIRT492235 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492490 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492505 RANBP10 RAN binding protein 10 2 4
MIRT492773 PDGFB platelet derived growth factor subunit B 2 2
MIRT492922 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493459 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493654 HDLBP high density lipoprotein binding protein 2 2
MIRT494011 DUSP9 dual specificity phosphatase 9 2 2
MIRT499412 PLCG2 phospholipase C gamma 2 2 4
MIRT499552 C15orf43 telomere repeat binding bouquet formation protein 2 2 2
MIRT501836 NCOA2 nuclear receptor coactivator 2 2 2
MIRT501950 MAT2A methionine adenosyltransferase 2A 2 10
MIRT504066 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT504509 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT508466 HOXB6 homeobox B6 2 4
MIRT512373 CPM carboxypeptidase M 2 2
MIRT513578 EVX1 even-skipped homeobox 1 2 2
MIRT517763 ZNF366 zinc finger protein 366 2 4
MIRT519773 ZNF354B zinc finger protein 354B 2 8
MIRT523568 GGCX gamma-glutamyl carboxylase 2 4
MIRT532802 CLDN11 claudin 11 2 2
MIRT544299 TSPYL1 TSPY like 1 2 2
MIRT544862 MYH2 myosin heavy chain 2 2 4
MIRT556731 KLHL15 kelch like family member 15 2 4
MIRT564347 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568924 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT569012 CXorf36 chromosome X open reading frame 36 2 2
MIRT569256 FAM129B family with sequence similarity 129 member B 2 2
MIRT569591 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT569779 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570034 FAM228A family with sequence similarity 228 member A 2 2
MIRT573803 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574190 ZNF264 zinc finger protein 264 2 2
MIRT576153 Hmox1 heme oxygenase 1 2 2
MIRT611311 CA8 carbonic anhydrase 8 2 4
MIRT673429 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT674976 SH3BP2 SH3 domain binding protein 2 2 2
MIRT692712 MEAF6 MYST/Esa1 associated factor 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3179 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission