miRTarBase - #MIRT446157


—
pre-miRNA Information
pre-miRNA hsa-mir-4747   
Genomic Coordinates chr19: 4932687 - 4932740
Description Homo sapiens miR-4747 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4747-5p
Sequence 1| AGGGAAGGAGGCUUGGUCUUAG |22
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs560927363 4 dbSNP
rs1471226927 10 dbSNP
rs763137545 12 dbSNP
rs767337154 15 dbSNP
rs775298039 16 dbSNP
rs760472311 19 dbSNP
rs1207950315 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPL12   
Synonyms L12
Description ribosomal protein L12
Transcript NM_000976   
Expression
Putative miRNA Targets on RPL12
3'UTR of RPL12
(miRNA target sites are highlighted)		 
>RPL12|NM_000976|3'UTR
   1 GCACAAAGGAAAACATTTCAATAAAGGATCATTTGACAACTGGTGGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26993158 31 COSMIC
COSN31558567 43 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1345657451 5 dbSNP
rs866385458 9 dbSNP
rs1284741940 10 dbSNP
rs768144832 15 dbSNP
rs758596087 16 dbSNP
rs760099616 18 dbSNP
rs371601790 21 dbSNP
rs767885616 23 dbSNP
rs200477216 26 dbSNP
rs762508910 36 dbSNP
rs1470313775 38 dbSNP
rs146387248 39 dbSNP
rs748357348 40 dbSNP
rs909032957 41 dbSNP
rs113212838 44 dbSNP
rs373688448 46 dbSNP
rs1182219962 47 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gauucuGGUUCGGA--GGAAGgga 5'
                :||||:||  :||||   
Target 5' ------UCAAGUCUCAUCUUC--- 3'
 		1 - 15
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000361436.5 | 3UTR | UCAAGUCUCAUCUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
215 hsa-miR-4747-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061689 BTG2 BTG anti-proliferation factor 2 2 2
MIRT062834 BCL7A BCL tumor suppressor 7A 2 2
MIRT079371 CCDC137 coiled-coil domain containing 137 2 2
MIRT081190 MIDN midnolin 2 4
MIRT081724 ZNF507 zinc finger protein 507 2 2
MIRT110565 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT133724 SKI SKI proto-oncogene 2 4
MIRT146689 MINK1 misshapen like kinase 1 2 2
MIRT150676 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159196 NRBP1 nuclear receptor binding protein 1 2 2
MIRT180865 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT190659 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196111 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT232390 SP1 Sp1 transcription factor 2 2
MIRT331070 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT338632 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT407441 CTDSP1 CTD small phosphatase 1 2 2
MIRT444276 NKX6-1 NK6 homeobox 1 2 2
MIRT444834 PDE6D phosphodiesterase 6D 2 2
MIRT445452 EXT1 exostosin glycosyltransferase 1 2 2
MIRT445644 NPY4R neuropeptide Y receptor Y4 2 2
MIRT446157 RPL12 ribosomal protein L12 2 2
MIRT446608 HIP1 huntingtin interacting protein 1 2 2
MIRT447108 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 2 2
MIRT449314 MRO maestro 2 2
MIRT450305 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT451245 ZNF444 zinc finger protein 444 2 2
MIRT451714 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451908 ILK integrin linked kinase 2 2
MIRT452183 KIAA1456 KIAA1456 2 2
MIRT452610 REPIN1 replication initiator 1 2 2
MIRT453422 GLG1 golgi glycoprotein 1 2 2
MIRT454006 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT455072 ARHGAP39 Rho GTPase activating protein 39 2 2
MIRT455319 TTLL9 tubulin tyrosine ligase like 9 2 2
MIRT455357 KDM5C lysine demethylase 5C 2 2
MIRT455589 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT455711 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT455860 TMEM254 transmembrane protein 254 2 2
MIRT455919 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT455946 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT456935 LRP10 LDL receptor related protein 10 2 2
MIRT457223 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 2
MIRT457431 NOL10 nucleolar protein 10 2 2
MIRT457470 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457907 ZNF212 zinc finger protein 212 2 2
MIRT458046 TSEN54 tRNA splicing endonuclease subunit 54 2 2
MIRT458073 RNLS renalase, FAD dependent amine oxidase 2 2
MIRT458234 NXPH3 neurexophilin 3 2 2
MIRT458307 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458378 ITM2C integral membrane protein 2C 2 2
MIRT458967 ZNF436 zinc finger protein 436 2 2
MIRT459099 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT459446 TMEM37 transmembrane protein 37 2 2
MIRT459671 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT460727 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT460744 SRP14 signal recognition particle 14 2 2
MIRT461531 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461752 DDX11 DEAD/H-box helicase 11 2 2
MIRT461837 F2RL3 F2R like thrombin or trypsin receptor 3 2 2
MIRT462019 RIF1 replication timing regulatory factor 1 2 2
MIRT462631 PHF5A PHD finger protein 5A 2 2
MIRT462772 ZNF8 zinc finger protein 8 2 2
MIRT463032 ZNF689 zinc finger protein 689 2 2
MIRT463886 WNT7B Wnt family member 7B 2 2
MIRT463995 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464371 URM1 ubiquitin related modifier 1 2 2
MIRT465342 TPM3 tropomyosin 3 2 4
MIRT465515 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465602 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT465697 TNPO2 transportin 2 2 10
MIRT466988 SSRP1 structure specific recognition protein 1 2 4
MIRT467630 SLC7A5 solute carrier family 7 member 5 2 2
MIRT468132 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468322 SF3B3 splicing factor 3b subunit 3 2 2
MIRT468502 SESN2 sestrin 2 2 2
MIRT468881 RREB1 ras responsive element binding protein 1 2 2
MIRT469322 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469562 RARA retinoic acid receptor alpha 2 2
MIRT469898 PTRF caveolae associated protein 1 2 2
MIRT470045 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT470068 PTGES2 prostaglandin E synthase 2 2 2
MIRT470238 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470390 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT470500 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT470689 POLR2D RNA polymerase II subunit D 2 2
MIRT470704 POGK pogo transposable element derived with KRAB domain 2 2
MIRT471083 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472482 NACC2 NACC family member 2 2 2
MIRT473583 MAT2A methionine adenosyltransferase 2A 2 2
MIRT474554 KLHDC3 kelch domain containing 3 2 2
MIRT474651 KLF13 Kruppel like factor 13 2 2
MIRT474843 KHSRP KH-type splicing regulatory protein 2 2
MIRT474934 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475573 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT476045 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476080 GRB2 growth factor receptor bound protein 2 2 2
MIRT476440 GBA2 glucosylceramidase beta 2 2 2
MIRT476764 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT478785 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479287 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT479505 CDH6 cadherin 6 2 2
MIRT479732 CCND1 cyclin D1 2 6
MIRT480352 C5orf24 chromosome 5 open reading frame 24 2 2
MIRT480407 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480859 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT481445 ARRB2 arrestin beta 2 2 2
MIRT481732 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT481824 AP2M1 adaptor related protein complex 2 mu 1 subunit 2 2
MIRT482566 ABHD2 abhydrolase domain containing 2 2 2
MIRT482607 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483144 SYCE1L synaptonemal complex central element protein 1 like 2 2
MIRT483214 APOA1 apolipoprotein A1 2 6
MIRT483878 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483917 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483939 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484420 SNX19 sorting nexin 19 2 2
MIRT484489 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484612 SIX3 SIX homeobox 3 2 6
MIRT484705 RNF11 ring finger protein 11 2 2
MIRT485107 SHISA6 shisa family member 6 2 2
MIRT485354 MYO1C myosin IC 2 4
MIRT485609 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT487311 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487417 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487695 CDK14 cyclin dependent kinase 14 2 2
MIRT487791 GPR20 G protein-coupled receptor 20 2 4
MIRT488042 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488058 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488237 DNLZ DNL-type zinc finger 2 4
MIRT488764 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489401 TUBB2A tubulin beta 2A class IIa 2 2
MIRT489777 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490099 FN3K fructosamine 3 kinase 2 2
MIRT490290 ISL2 ISL LIM homeobox 2 2 2
MIRT490378 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491329 GFER growth factor, augmenter of liver regeneration 2 2
MIRT491435 MSX2 msh homeobox 2 2 2
MIRT491769 ZNF385A zinc finger protein 385A 2 2
MIRT491922 WNK2 WNK lysine deficient protein kinase 2 2 2
MIRT491983 UNK unkempt family zinc finger 2 2
MIRT492228 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492404 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT492767 PDGFB platelet derived growth factor subunit B 2 2
MIRT492966 NCS1 neuronal calcium sensor 1 2 2
MIRT493295 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT493650 HDLBP high density lipoprotein binding protein 2 2
MIRT493913 FAM127B retrotransposon Gag like 8A 2 4
MIRT495601 NKX2-5 NK2 homeobox 5 2 2
MIRT496875 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT498514 MYH14 myosin heavy chain 14 2 2
MIRT499178 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT502143 KIF5B kinesin family member 5B 2 8
MIRT502692 CSNK1G1 casein kinase 1 gamma 1 2 4
MIRT508460 HOXB6 homeobox B6 2 4
MIRT510430 ZNF207 zinc finger protein 207 2 6
MIRT511837 GPATCH8 G-patch domain containing 8 2 4
MIRT512368 CPM carboxypeptidase M 2 2
MIRT512506 BTBD19 BTB domain containing 19 2 2
MIRT513065 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513267 SCUBE1 signal peptide, CUB domain and EGF like domain containing 1 2 4
MIRT513575 EVX1 even-skipped homeobox 1 2 2
MIRT515051 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515790 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT521657 PRKD3 protein kinase D3 2 2
MIRT522679 LUZP1 leucine zipper protein 1 2 6
MIRT528845 RAB32 RAB32, member RAS oncogene family 2 2
MIRT533569 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT543738 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT544295 TSPYL1 TSPY like 1 2 2
MIRT544857 MYH2 myosin heavy chain 2 2 4
MIRT557323 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT560522 TMEM98 transmembrane protein 98 2 2
MIRT561565 SLC6A9 solute carrier family 6 member 9 2 2
MIRT562374 ERI2 ERI1 exoribonuclease family member 2 2 2
MIRT565780 SEMA6D semaphorin 6D 2 2
MIRT569548 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT569944 PRRT2 proline rich transmembrane protein 2 2 2
MIRT570016 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572163 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT572322 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573495 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574139 MARVELD1 MARVEL domain containing 1 2 2
MIRT609449 CCDC149 coiled-coil domain containing 149 2 2
MIRT610619 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT623355 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT629854 ACOX1 acyl-CoA oxidase 1 2 2
MIRT630516 CDC73 cell division cycle 73 2 2
MIRT632535 PSMB2 proteasome subunit beta 2 2 2
MIRT633975 SLC35E2 solute carrier family 35 member E2 2 2
MIRT636408 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT641722 LTBR lymphotoxin beta receptor 2 2
MIRT642661 RGS6 regulator of G protein signaling 6 2 2
MIRT649649 MAST3 microtubule associated serine/threonine kinase 3 2 2
MIRT650367 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT651355 ZBTB40 zinc finger and BTB domain containing 40 2 2
MIRT664840 HUS1 HUS1 checkpoint clamp component 2 2
MIRT667322 MYH9 myosin heavy chain 9 2 2
MIRT670680 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT674922 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT675919 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT676493 GJD3 gap junction protein delta 3 2 2
MIRT680162 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT688008 GSN gelsolin 2 2
MIRT688997 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT700337 RAB4A RAB4A, member RAS oncogene family 2 2
MIRT701344 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT703519 FKBP15 FK506 binding protein 15 2 2
MIRT703901 EPT1 selenoprotein I 2 2
MIRT705565 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 2 2
MIRT709709 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT713108 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT718426 ZNF85 zinc finger protein 85 2 2
MIRT719236 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719326 STAC SH3 and cysteine rich domain 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4747 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4747-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4747-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4747-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission