miRTarBase - #MIRT446414


—
pre-miRNA Information
pre-miRNA hsa-mir-1299   
Genomic Coordinates chr9: 40929010 - 40929092
Synonyms MIRN1299, hsa-mir-1299, MIR1299
Description Homo sapiens miR-1299 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1299
Sequence 62| UUCUGGAAUUCUGUGUGAGGGA |83
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1042551075 4 dbSNP
rs747216379 19 dbSNP
rs1009712608 20 dbSNP
rs796108267 21 dbSNP
rs796728500 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OCA2   
Synonyms BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1
Description OCA2 melanosomal transmembrane protein
Transcript NM_000275   
Expression
Putative miRNA Targets on OCA2
3'UTR of OCA2
(miRNA target sites are highlighted)		 
>OCA2|NM_000275|3'UTR
   1 TAGACATCCATCTATTGCTCGAAGACTAAAGGAAACTTCATCCATCACAACCCATTAGTCATAAAACTACCCTGACCCCA
  81 CTGTTTGAAGAAGAAAAGGTGCTTACCCTGGAGATGCTACAGAGACACAGTGGAATAGACCTTGACACTAACACTCTAAT
 161 TCAAGCGAATGTTGGAACACCATGACCTCCTCTGTGTGTCCTTTCTCCCCAAGGACAAAATGTAGAAAGATGTGAGATAA
 241 CTTACTCAAGATTCCCCTCCAGAAAAATACGTATGTTTAAAAACCCTTCCTGCTATACATAGGAAAAGACACACATCCAC
 321 CTAAAATTGACTGTACTGTTTAACTGTCAATTCTCCTGAGGCTAAACACAGTTTGTTTTTCTTGTAATCACTTTTCATGT
 401 TAAAATAATCAGCATTCAAATTGTATGCTTTCTGAATATAGACTTTCTGGGAAAAGGTTTACTGCTCGTAAGGAAACATT
 481 TTATGTATTAAAATAAACTGTTCCTTGATAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aggGAGUGUGUCUU-----AAGGUCUu 5'
             ||:|| || :|      |||||| 
Target 5' taaCTTACTCAAGATTCCCCTCCAGAa 3'
 238 - 264 123.00 -14.30
2 
miRNA  3' aggGAGUGUG-UCUUAAGGUCuu 5'
             || ||||   ||||| ||  
Target 5' acaCTAACACTCTAATTCAAGcg 3'
 145 - 167 111.00 -7.80
3 
miRNA  3' agggagUGUGUCU-UAAGGUCUu 5'
                |:|:|||  |||::|: 
Target 5' ttctgaATATAGACTTTCTGGGa 3'
 430 - 452 108.00 -14.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
499953 1 ClinVar
315458 21 ClinVar
315457 50 ClinVar
888268 54 ClinVar
315456 166 ClinVar
888267 271 ClinVar
315455 300 ClinVar
888266 367 ClinVar
888265 371 ClinVar
888264 410 ClinVar
COSN30185516 5 COSMIC
COSN30150801 8 COSMIC
COSN30117510 21 COSMIC
COSN30147803 21 COSMIC
COSN30165840 39 COSMIC
COSN30180721 40 COSMIC
COSN30100567 43 COSMIC
COSN31506223 53 COSMIC
COSN15798803 71 COSMIC
COSN13611623 138 COSMIC
COSN29223513 144 COSMIC
COSN8589627 156 COSMIC
COSN31481388 167 COSMIC
COSN14938195 181 COSMIC
COSN31492267 193 COSMIC
COSN30132819 196 COSMIC
COSN30126067 227 COSMIC
COSN31531589 241 COSMIC
COSN4621323 329 COSMIC
COSN29514570 454 COSMIC
COSN17318296 467 COSMIC
COSN5395746 486 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs138228425 1 dbSNP
rs748456675 4 dbSNP
rs200732154 8 dbSNP
rs1424771632 10 dbSNP
rs751790611 11 dbSNP
rs769170049 20 dbSNP
rs369189827 21 dbSNP
rs1466294640 25 dbSNP
rs1248774032 31 dbSNP
rs766291945 38 dbSNP
rs780660298 40 dbSNP
rs756692515 42 dbSNP
rs751149175 44 dbSNP
rs7175266 50 dbSNP
rs1165904377 52 dbSNP
rs192734230 54 dbSNP
rs554977696 63 dbSNP
rs1361750237 65 dbSNP
rs1414240820 66 dbSNP
rs912331573 70 dbSNP
rs1357580525 71 dbSNP
rs1229054042 73 dbSNP
rs1332405395 78 dbSNP
rs1306595035 79 dbSNP
rs899500978 80 dbSNP
rs1019388795 81 dbSNP
rs1327704792 82 dbSNP
rs187757375 87 dbSNP
rs1488616730 90 dbSNP
rs903036089 95 dbSNP
rs929615250 96 dbSNP
rs1433677405 119 dbSNP
rs919625825 122 dbSNP
rs1254843408 128 dbSNP
rs370691529 129 dbSNP
rs530046601 130 dbSNP
rs779798260 138 dbSNP
rs1160884903 140 dbSNP
rs1381438681 142 dbSNP
rs927120512 145 dbSNP
rs981260733 147 dbSNP
rs971229767 148 dbSNP
rs1169017449 151 dbSNP
rs1020315849 153 dbSNP
rs761820687 158 dbSNP
rs182290687 166 dbSNP
rs937351907 167 dbSNP
rs374736630 173 dbSNP
rs1454752120 178 dbSNP
rs1233417155 180 dbSNP
rs957363734 181 dbSNP
rs1033427242 182 dbSNP
rs1313374068 190 dbSNP
rs1255200335 192 dbSNP
rs981566424 196 dbSNP
rs1211986896 200 dbSNP
rs765257992 201 dbSNP
rs1479476879 205 dbSNP
rs759428753 207 dbSNP
rs1019088847 210 dbSNP
rs1449671288 229 dbSNP
rs1288821150 239 dbSNP
rs1192230690 241 dbSNP
rs1427878345 263 dbSNP
rs940741403 270 dbSNP
rs151210258 271 dbSNP
rs1268328408 272 dbSNP
rs1227109879 273 dbSNP
rs190819188 274 dbSNP
rs1332331130 279 dbSNP
rs1377316380 285 dbSNP
rs766696793 287 dbSNP
rs1301087992 288 dbSNP
rs1369713593 289 dbSNP
rs1219302407 292 dbSNP
rs776180839 300 dbSNP
rs1305279316 302 dbSNP
rs1029234528 314 dbSNP
rs1258308838 317 dbSNP
rs1468270034 318 dbSNP
rs111864417 324 dbSNP
rs111782177 330 dbSNP
rs536434378 333 dbSNP
rs974953317 348 dbSNP
rs540384523 350 dbSNP
rs1478664424 357 dbSNP
rs963705750 359 dbSNP
rs75043266 367 dbSNP
rs112155098 371 dbSNP
rs1038458711 374 dbSNP
rs985 375 dbSNP
rs878861757 378 dbSNP
rs909 380 dbSNP
rs937251089 381 dbSNP
rs1394045355 391 dbSNP
rs1460718027 392 dbSNP
rs927185584 395 dbSNP
rs981354308 401 dbSNP
rs949882089 405 dbSNP
rs186071347 411 dbSNP
rs913109147 419 dbSNP
rs1321421820 427 dbSNP
rs1351522911 428 dbSNP
rs967499517 442 dbSNP
rs1269554619 448 dbSNP
rs547380178 449 dbSNP
rs1411978555 458 dbSNP
rs1395038839 462 dbSNP
rs1278420429 464 dbSNP
rs1333783938 467 dbSNP
rs957692340 468 dbSNP
rs527543942 483 dbSNP
rs975165812 485 dbSNP
rs1055741575 486 dbSNP
rs1489279742 498 dbSNP
rs532284482 498 dbSNP
rs1192011534 510 dbSNP
rs1477799425 514 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agggagugugucuuaAGGUCUu 5'
                         |||||| 
Target 5' ---ucaagauuccccUCCAGAa 3'
 		1 - 19
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000353809.5 | 3UTR | UCAAGAUUCCCCUCCAGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000353809.5 | 3UTR | UCAAGAUUCCCCUCCAGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.19 1.9e-1 -0.188 2.0e-1 23 Click to see details
GSE38226 Liver fibrosis 0.191 2.0e-1 0.364 5.2e-2 21 Click to see details
GSE28544 Breast cancer 0.143 2.5e-1 0.187 1.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.069 3.7e-1 -0.102 3.2e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.056 3.8e-1 0.083 3.3e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.092 3.8e-1 -0.027 4.7e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.047 4.1e-1 0.015 4.7e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-1299 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT079552 VAMP3 vesicle associated membrane protein 3 2 2
MIRT154885 GNAS GNAS complex locus 2 4
MIRT275056 SESN2 sestrin 2 2 4
MIRT303051 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT319158 CCDC71L coiled-coil domain containing 71 like 2 2
MIRT339620 TMPO thymopoietin 2 2
MIRT441961 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT445113 DCAF4 DDB1 and CUL4 associated factor 4 2 2
MIRT445290 CD274 CD274 molecule 2 2
MIRT446037 HMCN1 hemicentin 1 2 2
MIRT446162 C8A complement C8 alpha chain 2 2
MIRT446175 ZNF37A zinc finger protein 37A 2 4
MIRT446414 OCA2 OCA2 melanosomal transmembrane protein 2 2
MIRT446884 TRIM25 tripartite motif containing 25 2 2
MIRT449789 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT450026 EHD3 EH domain containing 3 2 2
MIRT450367 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT479739 CCND1 cyclin D1 2 2
MIRT484809 ZNFX1 zinc finger NFX1-type containing 1 2 2
MIRT485892 ZFP36 ZFP36 ring finger protein 2 2
MIRT486036 UBBP4 ubiquitin B pseudogene 4 2 2
MIRT488295 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT497377 METTL8 methyltransferase like 8 2 2
MIRT508219 ZNF850 zinc finger protein 850 2 6
MIRT510923 PRRX1 paired related homeobox 1 2 4
MIRT512661 STEAP3 STEAP3 metalloreductase 2 2
MIRT520031 YOD1 YOD1 deubiquitinase 2 6
MIRT528490 AGTR2 angiotensin II receptor type 2 2 2
MIRT530083 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT531086 CCDC140 coiled-coil domain containing 140 2 2
MIRT535363 PEX5L peroxisomal biogenesis factor 5 like 2 2
MIRT535595 NUDT21 nudix hydrolase 21 2 2
MIRT538613 CCT5 chaperonin containing TCP1 subunit 5 2 4
MIRT539002 AVL9 AVL9 cell migration associated 2 2
MIRT545918 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT548482 EEF2 eukaryotic translation elongation factor 2 2 2
MIRT555088 PURB purine rich element binding protein B 2 2
MIRT561421 TRIB3 tribbles pseudokinase 3 2 2
MIRT564965 WTAP WT1 associated protein 2 2
MIRT571686 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT574656 KLHL15 kelch like family member 15 2 2
MIRT610037 CNOT6 CCR4-NOT transcription complex subunit 6 2 6
MIRT612436 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT614349 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT615304 CCDC158 coiled-coil domain containing 158 2 2
MIRT615771 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT615889 MT1A metallothionein 1A 2 2
MIRT619147 ZNF326 zinc finger protein 326 2 2
MIRT622042 SSBP2 single stranded DNA binding protein 2 2 2
MIRT637385 R3HDM2 R3H domain containing 2 2 2
MIRT640739 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT644418 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 2
MIRT647638 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT654305 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT654367 RBM23 RNA binding motif protein 23 2 2
MIRT655944 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT655990 MYRF myelin regulatory factor 2 2
MIRT659692 CD226 CD226 molecule 2 2
MIRT665868 TIAF1 TGFB1-induced anti-apoptotic factor 1 2 2
MIRT667317 MYO18A myosin XVIIIA 2 2
MIRT684312 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT694138 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT698529 TFRC transferrin receptor 2 2
MIRT698834 SSR2 signal sequence receptor subunit 2 2 2
MIRT700657 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT705377 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT707314 TMEM184B transmembrane protein 184B 2 2
MIRT709027 KBTBD13 kelch repeat and BTB domain containing 13 2 2
MIRT716032 TMPRSS4 transmembrane protease, serine 4 2 2
MIRT718228 LCE1A late cornified envelope 1A 2 2
MIRT718475 TMEM151A transmembrane protein 151A 2 2
MIRT722333 BEND6 BEN domain containing 6 2 2
MIRT734096 TUG1 taurine up-regulated 1 (non-protein coding) 3 0
MIRT734099 NOTCH3 notch 3 3 0
MIRT755871 LIF LIF, interleukin 6 family cytokine 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-1299 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1299 Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-1299 Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-1299 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1299 Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-1299 Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-1299 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1299 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1299 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-1299 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1299 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-1299 Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-1299 Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1299 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission