pre-miRNA Information
pre-miRNA hsa-mir-7161   
Genomic Coordinates chr6: 158609707 - 158609790
Description Homo sapiens miR-7161 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7161-5p
Sequence 1| UAAAGACUGUAGAGGCAACUGGU |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1198027002 1 dbSNP
rs530077902 10 dbSNP
rs1446817450 13 dbSNP
rs774892048 14 dbSNP
rs1438482648 16 dbSNP
rs1167166990 19 dbSNP
rs760372681 19 dbSNP
Putative Targets

Gene Information
Gene Symbol GOLGA8J
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uggucaacggagaugUCAGAAAu 5'
                         ||||||| 
Target 5' ------------ucaAGUCUUUc 3'
1 - 11
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000341650.6 | 3UTR | UCAAGUCUUUCUCCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000341650.6 | 3UTR | UCAAGUCUUUCUCCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-7161-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT131193 INCENP inner centromere protein 2 4
MIRT318016 CENPQ centromere protein Q 2 2
MIRT405275 ZNF678 zinc finger protein 678 2 2
MIRT442570 CCDC59 coiled-coil domain containing 59 2 2
MIRT442611 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT444013 GOLGA8H golgin A8 family member H 2 2
MIRT444024 GOLGA8M golgin A8 family member M 2 2
MIRT444339 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT444611 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT446342 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT446558 GOLGA8J golgin A8 family member J 2 2
MIRT447671 PACSIN2 protein kinase C and casein kinase substrate in neurons 2 2 2
MIRT447975 MSH6 mutS homolog 6 2 2
MIRT448895 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT448936 CHD7 chromodomain helicase DNA binding protein 7 2 2
MIRT449414 TRIM5 tripartite motif containing 5 2 2
MIRT450291 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT454877 PCNA proliferating cell nuclear antigen 2 4
MIRT456615 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT462108 TMEM214 transmembrane protein 214 2 2
MIRT471923 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT474437 KLHL21 kelch like family member 21 2 2
MIRT476600 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT480573 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT483890 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT493363 KIF5B kinesin family member 5B 2 2
MIRT494934 TMEM167A transmembrane protein 167A 2 2
MIRT495915 CLDN1 claudin 1 2 2
MIRT501574 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502193 IGF1R insulin like growth factor 1 receptor 2 4
MIRT502928 CDC42SE1 CDC42 small effector 1 2 4
MIRT506393 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 4
MIRT506570 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT509478 GNL3L G protein nucleolar 3 like 2 6
MIRT518537 FLCN folliculin 2 6
MIRT519577 ZNFX1 zinc finger NFX1-type containing 1 2 4
MIRT524088 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 4
MIRT524146 LDHD lactate dehydrogenase D 2 4
MIRT524659 C1orf50 chromosome 1 open reading frame 50 2 10
MIRT526324 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526566 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526612 ZNF780A zinc finger protein 780A 2 4
MIRT526889 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT527115 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT528023 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT529589 TMEM220 transmembrane protein 220 2 2
MIRT532797 STYK1 serine/threonine/tyrosine kinase 1 2 2
MIRT537099 GPC6 glypican 6 2 2
MIRT539070 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 2
MIRT545495 DAPK2 death associated protein kinase 2 2 2
MIRT545814 ZNF608 zinc finger protein 608 2 4
MIRT553533 TMEM185B transmembrane protein 185B 2 4
MIRT557285 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT559552 ARGLU1 arginine and glutamate rich 1 2 4
MIRT561069 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT561710 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT561995 LRRC58 leucine rich repeat containing 58 2 2
MIRT565896 NHS NHS actin remodeling regulator 2 2
MIRT567333 HMGB1 high mobility group box 1 2 2
MIRT568042 CLDN12 claudin 12 2 2
MIRT568315 BAG4 BCL2 associated athanogene 4 2 2
MIRT570677 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT571047 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT571359 SFT2D2 SFT2 domain containing 2 2 2
MIRT571935 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT572786 ZNF277 zinc finger protein 277 2 2
MIRT573936 CNTNAP2 contactin associated protein like 2 2 2
MIRT576962 Anxa4 annexin A4 2 3
MIRT608297 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT613342 AFF1 AF4/FMR2 family member 1 2 2
MIRT613529 ANAPC7 anaphase promoting complex subunit 7 2 2
MIRT614705 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT616658 ORAI1 ORAI calcium release-activated calcium modulator 1 2 2
MIRT624731 ANXA4 annexin A4 2 3
MIRT626525 TSC1 TSC complex subunit 1 2 2
MIRT627647 SCN1A sodium voltage-gated channel alpha subunit 1 2 2
MIRT637423 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT641059 TCP11L1 t-complex 11 like 1 2 4
MIRT645591 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT646455 ZNF705A zinc finger protein 705A 2 2
MIRT656454 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT676551 TMPPE transmembrane protein with metallophosphoesterase domain 2 4
MIRT682720 KIAA1456 KIAA1456 2 2
MIRT698307 TMEM2 transmembrane protein 2 2 2
MIRT701906 MMGT1 membrane magnesium transporter 1 2 2
MIRT702228 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT708642 UBE2W ubiquitin conjugating enzyme E2 W 2 2
MIRT709326 HMBOX1 homeobox containing 1 2 2
MIRT711400 RANBP2 RAN binding protein 2 2 2
MIRT712130 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT714226 ARMC10 armadillo repeat containing 10 2 2
MIRT716914 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT723060 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT723846 MN1 MN1 proto-oncogene, transcriptional regulator 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7161-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (HEYA8)

Error report submission